Submitted:
16 April 2023
Posted:
17 April 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Plasmid, strains, cells, virus and antibody
2.2. Design and synthesis of boIFN-λ3
2.3. Construction of recombinant expression vector
2.4. Expression and identification of boIFN-λ3/λ3V18M
2.5. Screening dominant expression strains of boIFN-λ3/λ3V18M
2.6. Optimization of expression conditions
2.7. Purification of boIFN-λ3
2.8. Recombinant protein glycosylation analysis
2.9. Antiviral activity assay
2.10. Physicochemical characteristics analysis of boIFN-λ3/λ3V18M
2.11. Antiproliferative assays of boIFN-λ3
2.12. Statistical
3. Results
3.1. Design of pPICZαA-boIFNλ3/λ3V18M plasmid
3.2. Construction and identification of pPICZαA-boIFNλ3/λ3V18M plasmid
3.3. High-level expression of a synthetic boIFN-λ3 gene in P. pastoris
3.4. Optimized expression of the recombinant boIFN-λ3/λ3V18M
3.5. Expression and purification analysis of the recombinant boIFN-λ3/λ3V18M
3.6. Glycosylation analysis of the recombinant boIFN-λ3/λ3V18M
3.7. Antiviral activities of the recombinant boIFN-λ3/λ3V18M
3.8. Antibody neutralization for the recombinant boIFN-λ3/λ3V18M
3.9. Physicochemical characteristic of boIFN-λ3/λ3V18M
3.10. Antiproliferative of boIFN-λ3/λ3V18M
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Diaz-San, S.F.; Weiss, M.; Perez-Martin, E.; Koster, M.J.; Zhu, J.; Grubman, M.J.; de Los, S.T. Antiviral activity of bovine type III interferon against foot-and-mouth disease virus. Virology 2011, 413, 283–292. [Google Scholar] [CrossRef] [PubMed]
- Kelly, C.; Klenerman, P.; Barnes, E. Interferon lambdas: The next cytokine storm. Gut 2011, 60, 1284–1293. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.H.; Wang, Y.N.; Chang, Q.Y.; Ma, P.; Hu, Y.; Cao, X. Type III interferons in viral infection and antiviral immunity. Cell. Physiol. Biochem. 2018, 51, 173–185. [Google Scholar] [CrossRef] [PubMed]
- Andreakos, E.; Zanoni, I.; Galani, I.E. Lambda interferons come to light: Dual function cytokines mediating antiviral immunity and damage control. Curr. Opin. Immunol. 2019, 56, 67–75. [Google Scholar] [CrossRef] [PubMed]
- Lozhkov, A.A.; Klotchenko, S.A.; Ramsay, E.S.; Moshkoff, H.D.; Moshkoff, D.A.; Vasin, A.V.; Salvato, M.S. The key roles of interferon lambda in human molecular defense against respiratory viral infections. Pathogens 2020, 9. [Google Scholar] [CrossRef] [PubMed]
- Wolk, K.; Witte, K.; Sabat, R. Interleukin-28 and interleukin-29: Novel regulators of skin biology. J Interferon Cytokine Res 2010, 30, 617–628. [Google Scholar] [CrossRef] [PubMed]
- Tu, Y.; Wang, G.; Wang, Y.; Chen, W.; Zhang, L.; Liu, Y.; Jiang, C.; Wang, S.; Bu, Z.; Cai, X. Extracellular expression and antiviral activity of a bovine interferon-alpha through codon optimization in Pichia pastoris. Microbiol. Res. 2016, 191, 12–18. [Google Scholar] [CrossRef]
- Gao, M.; Guo, Y.; Luo, X.; Du J; Wang, Y. ; Cao, C.; Wang, J.; Han, W. Design, biological activity and signaling pathway of bovine consensus omega interferon expressed in Pichia pastoris. Mol. Immunol. 2019, 106, 46–52. [Google Scholar] [CrossRef]
- Yang, Z.; Zhang, Z. Engineering strategies for enhanced production of protein and bio-products in Pichia pastoris: A review. Biotechnol. Adv. 2018, 36, 182–195. [Google Scholar] [CrossRef]
- Damasceno, L.M.; Huang, C.J.; Batt, C.A. Protein secretion in Pichia pastoris and advances in protein production. Appl Microbiol Biotechnol 2012, 93, 31–39. [Google Scholar] [CrossRef]
- Qu, Z.; Li, M.; Guo, Y.; Liu, Y.; Wang, J.; Gao, M. Expression, purification, and characterisation of recombinant ferritin in insect cells using the baculovirus expression system. Biotechnol. Lett. 2020, 42, 57–65. [Google Scholar] [CrossRef] [PubMed]
- Gao, M.J.; Zheng, Z.Y.; Wu, J.R.; Dong, S.J.; Li, Z.; Jin, H.; Zhan, X.B.; Lin, C.C. Improvement of specific growth rate of Pichia pastoris for effective porcine interferon-alpha production with an on-line model-based glycerol feeding strategy. Appl Microbiol Biotechnol 2012, 93, 1437–1445. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Song, Z.; Cheng, X.; Wang, Y.; Luo, X.; An, R.; Wang, J.; Gao, M. Molecular and functional characterization of ovis aries IFN-epsilon. Mol. Immunol. 2020, 119, 1–7. [Google Scholar] [CrossRef]
- Gao, M.; Liu, Y.; Guo, Y.; Wang, Y.; Dai, H.; Song, Z.; Wang, J.; Han, W. Identification and characterization of a rabbit novel IFN-alpha unlocated in genome. Dev. Comp. Immunol. 2018, 78, 91–99. [Google Scholar] [CrossRef]
- Guo, Y.; An, D.; Liu, Y.; Bao, J.; Luo, X.; Cheng, X.; Wang, Y.; Gao, M.; Wang, J. Characterization and signaling pathway analysis of interferon-kappa in bovine. Dev. Comp. Immunol. 2017, 67, 213–220. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Song, Z.; Li, C.; Yu, Y.; Dai, H.; Luo, X.; Wang, Y.; Wang, J.; Gao, M. A novel Type-I interferon family, bovine Interferon-Chi, is involved in Positive-Feedback regulation of interferon production. Front Immunol 2020, 11, 528854. [Google Scholar] [CrossRef]
- Major, J.; Crotta, S.; Llorian, M.; Mccabe, T.M.; Gad, H.H.; Priestnall, S.L.; Hartmann, R.; Wack, A. Type I and III interferons disrupt lung epithelial repair during recovery from viral infection. Science 2020, 369, 712–717. [Google Scholar] [CrossRef]
- Juturu, V.; Wu, J.C. Heterologous protein expression in pichia pastoris: Latest research progress and applications. Chembiochem 2018, 19, 7–21. [Google Scholar] [CrossRef]
- Karbalaei, M.; Rezaee, S.A.; Farsiani, H. Pichia pastoris: A highly successful expression system for optimal synthesis of heterologous proteins. J. Cell. Physiol. 2020, 235, 5867–5881. [Google Scholar] [CrossRef]
- Li, M.L.; Xu, W.W.; Gao, Y.D.; Guo, Y.; Wang, W.J.; Wang, C.; Jiang, S.Y.; Willden, A.; Huang, J.F.; Zhang, H.T. Interferon-lambda3 (IFN-lambda3) and its cognate receptor subunits in tree shrews (Tupaia belangeri): Genomic sequence retrieval, molecular identification and expression analysis. PLoS One 2013, 8, e60048. [Google Scholar] [CrossRef]
- Lazear, H.M.; Schoggins, J.W.; Diamond, M.S. Shared and distinct functions of type i and type III interferons. Immunity 2019, 50, 907–923. [Google Scholar] [CrossRef] [PubMed]
- Gad, H.H.; Dellgren, C.; Hamming, O.J.; Vends, S.; Paludan, S.R.; Hartmann, R. Interferon-lambda is functionally an interferon but structurally related to the interleukin-10 family. J. Biol. Chem. 2009, 284, 20869–20875. [Google Scholar] [CrossRef] [PubMed]









| No. | Oligonucleotide fragments (5′-3′) |
|---|---|
| P1 | AGCTCTCGAGXhoⅠAAAAGAGTTCCAGTTCCATCTGCCCCAAGAGCTTTGCC |
| P2 | AGACAAGGACTTAAATTGAGCCACGTGACAACCACGGGCTGGTGGCAAAGCTCTTGGGG |
| P2′ | AGACAAGGACTTAAATTGAGCCATGTGACAACCACGGGCTGGTGGCAAAGCTCTTGGGG |
| P3 | GCTCAATTTAAGTCCTTGTCTCCACAAGAATTGCAAGCCTTTAAGACTGCTAGAGACGC |
| P4 | AGAACAGTCCCAGTCCTTTGGCAAGAAAGAGTCTTCGAAAGCGTCTCTAGCAGTCTTAA |
| P5 | AAGGACTGGGACTGTTCTACTCACTTGTTCCCAAGAACTAGAGACTTGAAGCACTTGCA |
| P6 | AGGCCAATTCAGCTTCCAAAGCAACAGGTCTTTCCCAAACTTGCAAGTGCTTCAAGTCT |
| P7 | GGAAGCTGAATTGGCCTTGACTTTGACTGTTTTGGAAGCTATGGCTAACTCTTCTTTGG |
| P8 | GTTTTGCAAAGTCAACAATGGCTGTTCCAAAGAGTGACCCAAAGAAGAGTTAGCCATAG |
| P9 | CATTGTTGACTTTGCAAAACATCCACTCTAAGTTGCAAGCCTGTGTTCCAGCTCAACCA |
| P10 | CAACCAGTGGTGCAATCTACCTCTAGGTCTGGAAGAGGCGGTTGGTTGAGCTGGAACAC |
| P11 | AGATTGCACCACTGGTTGCACAGATTGCAAGAGGCTAGAAAGGAATCCCAAGACTGTTT |
| P12 | AGTCAACAATCTCAACAAGTTGAACATAACAGAAGCCTCCAAACAGTCTTGGGATTCCT |
| P13 | AACTTGTTGAGATTGTTGACTAGAGACTTGAAGTGTGTTGCTTCTGGTGACCAATGTGT |
| P14 | GACTTCTAGAXbaⅠTTAAACACATTGGTCACCAGAAG |
| 100 mL volume | Total protein(mg) | Target protein(mg) | Purity (%) | |
| BoIFN-λ3 | Ammonium sulfate precipitation | 180 | 152.1 | 84.5 |
| Ion exchange chromatography | 32 | 29.44 | 92 | |
| BoIFN-λ3 V18M | Ammonium sulfate precipitation | 175 | 148.75 | 85 |
| Ion exchange chromatography | 34 | 31.45 | 92.5 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).