Submitted:
27 February 2026
Posted:
28 February 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Test Specimen Preparation
2.2. Preparation of Bacterial Mix
2.3. Pellicle Formation on Test Specimens
2.4. Incubation of Test Specimens with Bacterial Mix
2.5. DNA Isolation
2.6. SYBR Green qPCR
2.7. Statistical Analysis
3. Results
3.1. S. gordonii
3.2. S.oralis
3.3. A. spp.
3.4. S.mitis
3.5. S. sanguinis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bernardo, M.; Luis, H.; Martin, M.D.; Leroux, B.G.; Rue, T.; Leitão, J.; DeRouen, T.A. Survival and reasons for failure of amalgam versus composite posterior restorations placed in a randomized clinical trial. J Am Dent Assoc 2007, 138, 775–783. [Google Scholar] [CrossRef]
- Eltahlah, D.; Lynch, C.D.; Chadwick, B.L.; Blum, I.R.; Wilson, N.H.F. An update on the reasons for placement and replacement of direct restorations. J Dent 2018, 72, 1–7. [Google Scholar] [CrossRef]
- Friedl, K.H.; Hiller, K.A.; Schmalz, G. Placement and replacement of composite restorations in Germany. Oper Dent 1995, 20, 34–38. [Google Scholar]
- Deligeorgi, V.; Mjör, I.A.; Wilson, N.H. An overview of reasons for the placement and replacement of restorations. Prim Dent Care 2001, 8, 5–11. [Google Scholar] [CrossRef]
- Sbordone, L.; Bortolaia, C. Oral microbial biofilms and plaque-related diseases: microbial communities and their role in the shift from oral health to disease. Clin Oral Investig 2003, 7, 181–188. [Google Scholar] [CrossRef]
- Marsh, P.D.; Devine, D.A. How is the development of dental biofilms influenced by the host? J Clin Periodontol 2011, 38 Suppl 11, 28–35. [Google Scholar] [CrossRef] [PubMed]
- Park, J.W.; Song, C.W.; Jung, J.H.; Ahn, S.J.; Ferracane, J.L. The effects of surface roughness of composite resin on biofilm formation of Streptococcus mutans in the presence of saliva. Oper Dent 2012, 37, 532–539. [Google Scholar] [CrossRef] [PubMed]
- Cazzaniga, G.; Ottobelli, M.; Ionescu, A.; Garcia-Godoy, F.; Brambilla, E. Surface properties of resin-based composite materials and biofilm formation: A review of the current literature. Am J Dent 2015, 28, 311–320. [Google Scholar]
- Kolenbrander, P.E. Oral microbial communities: biofilms, interactions, and genetic systems. Annu Rev Microbiol 2000, 54, 413–437. [Google Scholar] [CrossRef]
- Rüttermann, S.; Trellenkamp, T.; Bergmann, N.; Beikler, T.; Ritter, H.; Janda, R. Bacterial viability and physical properties of antibacterially modified experimental dental resin composites. PLoS One 2013, 8, e79119. [Google Scholar] [CrossRef] [PubMed]
- Al-Ahmad, A.; Follo, M.; Selzer, A.C.; Hellwig, E.; Hannig, M.; Hannig, C. Bacterial colonization of enamel in situ investigated using fluorescence in situ hybridization. J Med Microbiol 2009, 58, 1359–1366. [Google Scholar] [CrossRef]
- Li, J.; Helmerhorst, E.J.; Leone, C.W.; Troxler, R.F.; Yaskell, T.; Haffajee, A.D.; Socransky, S.S.; Oppenheim, F.G. Identification of early microbial colonizers in human dental biofilm. J Appl Microbiol 2004, 97, 1311–1318. [Google Scholar] [CrossRef]
- Wiegand, A.; Buchalla, W.; Attin, T. Review on fluoride-releasing restorative materials--fluoride release and uptake characteristics, antibacterial activity and influence on caries formation. Dent Mater 2007, 23, 343–362. [Google Scholar] [CrossRef]
- Knorr, S.D.; Combe, E.C.; Wolff, L.F.; Hodges, J.S. The surface free energy of dental gold-based materials. Dent Mater 2005, 21, 272–277. [Google Scholar] [CrossRef]
- Teughels, W.; Van Assche, N.; Sliepen, I.; Quirynen, M. Effect of material characteristics and/or surface topography on biofilm development. Clinical oral implants research 2006, 17, 68–81. [Google Scholar] [CrossRef]
- Bürgers, R.; Hahnel, S.; Reichert, T.E.; Rosentritt, M.; Behr, M.; Gerlach, T.; Handel, G.; Gosau, M. Adhesion of Candida albicans to various dental implant surfaces and the influence of salivary pellicle proteins. Acta biomaterialia 2010, 6, 2307–2313. [Google Scholar] [CrossRef]
- Mjör, I.A.; Moorhead, J.E.; Dahl, J.E. Reasons for replacement of restorations in permanent teeth in general dental practice. Int Dent J 2000, 50, 361–366. [Google Scholar] [CrossRef] [PubMed]
- Henrich, B.; Hermann, I.; Di Giulio, M.; Köhrer, K.; Deenen, R.; Sivalingam, S.; Peters, U.; Beikler, T.; Janda, R.; Rüttermann, S. Reexamination in vitro and in situ of an antibacterially modified experimental dental resin composite with molecular methods: A pilot study. Advances in Materials Science and Engineering 2016. [Google Scholar] [CrossRef]
- Derchi, G.; Vano, M.; Barone, A.; Covani, U.; Diaspro, A.; Salerno, M. Bacterial adhesion on direct and indirect dental restorative composite resins: An in vitro study on a natural biofilm. The Journal of prosthetic dentistry 2017, 117, 669–676. [Google Scholar] [CrossRef]
- Park, J.-W.; An, J.-S.; Lim, W.H.; Lim, B.-S.; Ahn, S.-J. Microbial changes in biofilms on composite resins with different surface roughness: An in vitro study with a multispecies biofilm model. The Journal of prosthetic dentistry 2019, 122, 493. e491–493. e498. [Google Scholar] [CrossRef] [PubMed]
- Hansel, C.; Leyhausen, G.; Mai, U.E.; Geurtsen, W. Effects of various resin composite (co)monomers and extracts on two caries-associated micro-organisms in vitro. J Dent Res 1998, 77, 60–67. [Google Scholar] [CrossRef]
- Imazato, S.; Ebi, N.; Takahashi, Y.; Kaneko, T.; Ebisu, S.; Russell, R.R. Antibacterial activity of bactericide-immobilized filler for resin-based restoratives. Biomaterials 2003, 24, 3605–3609. [Google Scholar] [CrossRef]
- Pereira, C.; Eskelson, E.; Cavalli, V.; Liporoni, P.C.S.; Jorge, A.O.C.; Rego, M.d. Streptococcus mutans biofilm adhesion on composite resin surfaces after different finishing and polishing techniques. Operative dentistry 2011, 36, 311–317. [Google Scholar] [CrossRef]
- Cazzaniga, G.; Ottobelli, M.; Ionescu, A.C.; Paolone, G.; Gherlone, E.; Ferracane, J.L.; Brambilla, E. In vitro biofilm formation on resin-based composites after different finishing and polishing procedures. Journal of dentistry 2017, 67, 43–52. [Google Scholar] [CrossRef] [PubMed]
- Kozmos, M.; Virant, P.; Rojko, F.; Abram, A.; Rudolf, R.; Raspor, P.; Zore, A.; Bohinc, K. Bacterial Adhesion of Streptococcus mutans to Dental Material Surfaces. Molecules 2021, 26. [Google Scholar] [CrossRef] [PubMed]
- Montanaro, L.; Campoccia, D.; Rizzi, S.; Donati, M.E.; Breschi, L.; Prati, C.; Arciola, C.R. Evaluation of bacterial adhesion of Streptococcus mutans on dental restorative materials. Biomaterials 2004, 25, 4457–4463. [Google Scholar] [CrossRef]
- Shahal, Y.; Steinberg, D.; Hirschfeld, Z.; Bronshteyn, M.; Kopolovic, K. In vitro bacterial adherence onto pellicle-coated aesthetic restorative materials. J Oral Rehabil 1998, 25, 52–58. [Google Scholar] [CrossRef] [PubMed]
- Poggio, C.; Arciola, C.R.; Rosti, F.; Scribante, A.; Saino, E.; Visai, L. Adhesion of Streptococcus mutans to different restorative materials. Int J Artif Organs 2009, 32, 671–677. [Google Scholar] [CrossRef]
- Hahnel, S.; Rosentritt, M.; Bürgers, R.; Handel, G. Surface properties and in vitro Streptococcus mutans adhesion to dental resin polymers. J Mater Sci Mater Med 2008, 19, 2619–2627. [Google Scholar] [CrossRef]
- Ikeda, M.; Matin, K.; Nikaido, T.; Foxton, R.M.; Tagami, J. Effect of surface characteristics on adherence of S. mutans biofilms to indirect resin composites. Dent Mater J 2007, 26, 915–923. [Google Scholar] [CrossRef]
- Bourbia, M.; Ma, D.; Cvitkovitch, D.G.; Santerre, J.P.; Finer, Y. Cariogenic bacteria degrade dental resin composites and adhesives. J Dent Res 2013, 92, 989–994. [Google Scholar] [CrossRef] [PubMed]
- Bilgili, D.; Dündar, A.; Barutçugil, Ç.; Tayfun, D.; Özyurt Ö, K. Surface properties and bacterial adhesion of bulk-fill composite resins. J Dent 2020, 95, 103317. [Google Scholar] [CrossRef]
- Hauser-Gerspach, I.; Kulik, E.M.; Weiger, R.; Decker, E.M.; Von Ohle, C.; Meyer, J. Adhesion of Streptococcus sanguinis to dental implant and restorative materials in vitro. Dent Mater J 2007, 26, 361–366. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, K.; Ohashi, S.; Taki, E.; Hirata, K. Adherence of oral streptococci to composite resin of varying surface roughness. Dent Mater J 1996, 15, 201–204. [Google Scholar] [CrossRef]
- Hotta, M.; Morikawa, T.; Tamura, D.; Kusakabe, S. Adherence of Streptococcus sanguinis and Streptococcus mutans to saliva-coated S-PRG resin blocks. Dent Mater J 2014, 33, 261–267. [Google Scholar] [CrossRef] [PubMed]
- Takatsuka, T.; Konishi, N.; Nakabo, S.; Hashimoto, T.; Torii, Y.; Yoshiyama, M. Adhesion in vitro of oral streptococci to porcelain, composite resin cement and human enamel. Dent Mater J 2000, 19, 363–372. [Google Scholar] [CrossRef]
- Satou, N.; Satou, J.; Yukihiro, A.; Shintani, H.; Inoue, T. In vitro adherence of Streptococcus sanguis ATCC 10556 to various dental cements. Dent Mater J 1985, 4, 216–222. [Google Scholar] [CrossRef] [PubMed]
- Hamza, B.; Eliades, T.; Attin, T.; Schwendener, S.; Karygianni, L. Initial bacterial adherence and biofilm formation on novel restorative materials used in paediatric dentistry. Dent Mater 2024, 40, 573–579. [Google Scholar] [CrossRef]
- Nabert-Georgi, C.; Rodloff, A.C.; Jentsch, H.; Reissmann, D.R.; Schaumann, R.; Stingu, C.S. Influence of oral bacteria on adhesion of Streptococcus mutans and Streptococcus sanguinis to dental materials. Clin Exp Dent Res 2018, 4, 72–77. [Google Scholar] [CrossRef]
- Engel, A.S.; Kranz, H.T.; Schneider, M.; Tietze, J.P.; Piwowarcyk, A.; Kuzius, T.; Arnold, W.; Naumova, E.A. Biofilm formation on different dental restorative materials in the oral cavity. BMC Oral Health 2020, 20, 162. [Google Scholar] [CrossRef]
- Kawai, K.; Urano, M. Adherence of plaque components to different restorative materials. Oper Dent 2001, 26, 396–400. [Google Scholar] [PubMed]
- Nedeljkovic, I.; Teughels, W.; De Munck, J.; Van Meerbeek, B.; Van Landuyt, K.L. Is secondary caries with composites a material-based problem? Dent Mater 2015, 31, e247-277. [Google Scholar] [CrossRef] [PubMed]
- Hoshino, T.; Kawaguchi, M.; Shimizu, N.; Hoshino, N.; Ooshima, T.; Fujiwara, T. PCR detection and identification of oral streptococci in saliva samples using gtf genes. Diagn Microbiol Infect Dis 2004, 48, 195–199. [Google Scholar] [CrossRef]
- Demarco, F.F.; Corrêa, M.B.; Cenci, M.S.; Moraes, R.R.; Opdam, N.J. Longevity of posterior composite restorations: not only a matter of materials. Dent Mater 2012, 28, 87–101. [Google Scholar] [CrossRef]
- Marsh, P.D. Dental plaque as a biofilm and a microbial community - implications for health and disease. BMC Oral Health 2006, 6 Suppl 1, S14. [Google Scholar] [CrossRef]
- Bradshaw, D.J.; Marsh, P.D. Analysis of pH-driven disruption of oral microbial communities in vitro. Caries Res 1998, 32, 456–462. [Google Scholar] [CrossRef]
- Kuramitsu, H.K.; He, X.; Lux, R.; Anderson, M.H.; Shi, W. Interspecies interactions within oral microbial communities. Microbiol Mol Biol Rev 2007, 71, 653–670. [Google Scholar] [CrossRef]
- Kolenbrander, P.E.; Palmer, R.J., Jr.; Periasamy, S.; Jakubovics, N.S. Oral multispecies biofilm development and the key role of cell-cell distance. Nat Rev Microbiol 2010, 8, 471–480. [Google Scholar] [CrossRef] [PubMed]
- Scannapieco, F.A. Saliva-bacterium interactions in oral microbial ecology. Crit Rev Oral Biol Med 1994, 5, 203–248. [Google Scholar] [CrossRef]
- Jakubovics, N.S.; Palmer, R.J. Oral microbial ecology: current research and new perspectives; Caister Academic Press: Norfolk, 2013; p. 232. [Google Scholar]
- Mishra, A.; Wu, C.; Yang, J.; Cisar, J.O.; Das, A.; Ton-That, H. The Actinomyces oris type 2 fimbrial shaft FimA mediates co-aggregation with oral streptococci, adherence to red blood cells and biofilm development. Mol Microbiol 2010, 77, 841–854. [Google Scholar] [CrossRef]
- Rogers, J.D.; Palmer, R.J., Jr.; Kolenbrander, P.E.; Scannapieco, F.A. Role of Streptococcus gordonii amylase-binding protein A in adhesion to hydroxyapatite, starch metabolism, and biofilm formation. Infect Immun 2001, 69, 7046–7056. [Google Scholar] [CrossRef]
- Chahal, G.; Quintana-Hayashi, M.P.; Gaytán, M.O.; Benktander, J.; Padra, M.; King, S.J.; Linden, S.K. Streptococcus oralis Employs Multiple Mechanisms of Salivary Mucin Binding That Differ Between Strains. Front Cell Infect Microbiol 2022, 12, 889711. [Google Scholar] [CrossRef]
- Sumney, D.L.; Jordan, H.V. Characterization of bacteria isolated from human root surface carious lesions. J Dent Res 1974, 53, 343–351. [Google Scholar] [CrossRef]
- Cahill, T.J.; Prendergast, B.D. Infective endocarditis. Lancet 2016, 387, 882–893. [Google Scholar] [CrossRef] [PubMed]
- Vogkou, C.T.; Vlachogiannis, N.I.; Palaiodimos, L.; Kousoulis, A.A. The causative agents in infective endocarditis: a systematic review comprising 33,214 cases. Eur J Clin Microbiol Infect Dis 2016, 35, 1227–1245. [Google Scholar] [CrossRef]
- Bik, E.M.; Long, C.D.; Armitage, G.C.; Loomer, P.; Emerson, J.; Mongodin, E.F.; Nelson, K.E.; Gill, S.R.; Fraser-Liggett, C.M.; Relman, D.A. Bacterial diversity in the oral cavity of 10 healthy individuals. Isme j 2010, 4, 962–974. [Google Scholar] [CrossRef] [PubMed]
- Becker, M.R.; Paster, B.J.; Leys, E.J.; Moeschberger, M.L.; Kenyon, S.G.; Galvin, J.L.; Boches, S.K.; Dewhirst, F.E.; Griffen, A.L. Molecular analysis of bacterial species associated with childhood caries. J Clin Microbiol 2002, 40, 1001–1009. [Google Scholar] [CrossRef]
- Gross, E.L.; Beall, C.J.; Kutsch, S.R.; Firestone, N.D.; Leys, E.J.; Griffen, A.L. Beyond Streptococcus mutans: dental caries onset linked to multiple species by 16S rRNA community analysis. PLoS One 2012, 7, e47722. [Google Scholar] [CrossRef] [PubMed]
- Busscher, H.J.; Bos, R.; van der Mei, H.C. Initial microbial adhesion is a determinant for the strength of biofilm adhesion. FEMS Microbiol Lett 1995, 128, 229–234. [Google Scholar] [CrossRef] [PubMed]
- Rickard, A.H.; Gilbert, P.; High, N.J.; Kolenbrander, P.E.; Handley, P.S. Bacterial coaggregation: an integral process in the development of multi-species biofilms. Trends Microbiol 2003, 11, 94–100. [Google Scholar] [CrossRef]
- Caous, J.S.; Lövenklev, M.; Fäldt, J.; Langton, M. Adhesion of Streptococcus mitis and Actinomyces oris in co-culture to machined and anodized titanium surfaces as affected by atmosphere and pH. BMC Oral Health 2013, 13, 4. [Google Scholar] [CrossRef]
- Yamauchi, M.; Yamamoto, K.; Wakabayashi, M.; Kawano, J. In vitro adherence of microorganisms to denture base resin with different surface texture. Dent Mater J 1990, 9, 19–24. [Google Scholar] [CrossRef] [PubMed]
- Sissons, C.H. Artificial dental plaque biofilm model systems. Adv Dent Res 1997, 11, 110–126. [Google Scholar] [CrossRef] [PubMed]
- ten Cate, J.M. Biofilms, a new approach to the microbiology of dental plaque. Odontology 2006, 94, 1–9. [Google Scholar] [CrossRef]
- Aas, J.A.; Paster, B.J.; Stokes, L.N.; Olsen, I.; Dewhirst, F.E. Defining the normal bacterial flora of the oral cavity. J Clin Microbiol 2005, 43, 5721–5732. [Google Scholar] [CrossRef]
- Groeger, S.; Zhou, Y.; Ruf, S.; Meyle, J. Pathogenic Mechanisms of Fusobacterium nucleatum on Oral Epithelial Cells. Front Oral Health 2022, 3, 831607. [Google Scholar] [CrossRef]
- Mei, L.; Busscher, H.J.; van der Mei, H.C.; Ren, Y. Influence of surface roughness on streptococcal adhesion forces to composite resins. Dent Mater 2011, 27, 770–778. [Google Scholar] [CrossRef]
- Sang, T.; Ye, Z.; Fischer, N.G.; Skoe, E.P.; Echeverría, C.; Wu, J.; Aparicio, C. Physical-chemical interactions between dental materials surface, salivary pellicle and Streptococcus gordonii. Colloids Surf B Biointerfaces 2020, 190, 110938. [Google Scholar] [CrossRef]
- Silkie, S.S.; Tolcher, M.P.; Nelson, K.L. Reagent decontamination to eliminate false-positives in Escherichia coli qPCR. J Microbiol Methods 2008, 72, 275–282. [Google Scholar] [CrossRef]
- Aslanzadeh, J. Preventing PCR amplification carryover contamination in a clinical laboratory. Ann Clin Lab Sci 2004, 34, 389–396. [Google Scholar] [PubMed]
- Kwok, S.; Higuchi, R. Avoiding false positives with PCR. Nature 1989, 339, 237–238. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Ruijter, J.M.; van den Hoff, M.J.B.; Kubista, M.; Pfaffl, M.W.; Shipley, G.L.; Tran, N.; Rödiger, S.; Untergasser, A.; Mueller, R.; et al. MIQE 2.0: Revision of the Minimum Information for Publication of Quantitative Real-Time PCR Experiments Guidelines. Clin Chem 2025, 71, 634–651. [Google Scholar] [CrossRef] [PubMed]
- Mackay, I.M. Real-time PCR in the microbiology laboratory. Clin Microbiol Infect 2004, 10, 190–212. [Google Scholar] [CrossRef] [PubMed]





| Product | Material class | Batch | Company |
| Admira Fusion | Ormocer | 2044350 | Voco, Cuxhaven, Germany |
| Clearfil AP-X | Hybrid Composite | 9E0731 | Kuraray, Chiyoda, Japan |
| Durafill VS | Microfiller Composite | K010230 | Kulzer, Hanau, Germany |
| Filtek Supreme XTE | Nanocomposite | NC10955 | 3M Espe, Landsberg am Lech, Germany |
| Venus Diamond | Ultra-fine particle hybrid composite | K010201 | Kulzer, Hanau, Germany |
| Species | Strain |
| A.naeslundii A.spp.: A. oris |
DSM 43013 + 1:1 DSM 23056 |
| S. mitis | DSM 12643 |
| S. oralis | DSM 20627 |
| S. sanguinis | DSM 20068 |
| S. gordonii | DSM 6777 |
| Species | Primer | Reference |
| A. spp. A. naeslundii A. oris |
F GGT CTC TGG GCC GTT ACT GA R TGG CCC CCA CAC CTA GTG F GGG CCT GGG AAA GAT TG R TGA CCG TGC ACC CTC TCA F TGC CTG CTG CAT GGT GG R AAA GGG ACA GGC CTG CTT C |
Henrich et al., 2016 [18] Henrich et al., 2016 [18] This study |
| S. mitis | GAGCTTGCTTCTCCGGATGA AATTGCACCTTTTAAGCAAATGTCA |
Henrich et al., 2016 [18] |
| S. oralis | F TCC CGG TCA GCA AAC TCC AGC C R GCA ACC TTT GGA TTT GCA AC |
Hoshino et al., 2004 [43] |
| S. sanguinis | F GGA TAG TGG CTC AGG GCA GCC AGT T R GAA CAG TTG CTG GAC TTG CTT GTC |
Hoshino et al., 2004 [43] |
| S. gordonii | F CTA TGC GGA TGA TGC TAA TCA AGT G R GGA GTC GCT ATA ATC TTG TCA GAA A |
Hoshino et al., 2004 [43] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
