Submitted:
29 December 2025
Posted:
30 December 2025
You are already at the latest version
Abstract
A reliable and reproducible method for the isolation, culture, and identification of an osteoblast cell line from crucian carp (Carassius auratus) was established in this study using vertebral bone tissue from Chongming crucian carp, a locally important aquaculture strain from the lower Yangtze River region. Osteoblast cells were isolated using a tissue explant culture method, and optimal in vitro culture conditions were systematically evaluated. The established osteoblast cell line, designated Chongming Carassius auratus osteoblast cells (COBC), was characterized through chromosomal karyotype analysis, osteocalcin enzyme-linked immunosorbent assay (ELISA), and osteogenesis-related gene expression analysis. Additionally, cellular responses to environmental stress were assessed. The results showed that COBC exhibited optimal proliferation in L-15 medium supplemented with 20% fetal bovine serum at 28 ℃ under 5% CO2. Alkaline phosphatase staining, Alizarin Red staining, and von Kossa staining all yielded positive results, thereby confirming that the isolated cells possessed typical and stable osteoblastic properties, with the osteocalcin content of 36,884 ng/L. Quantitative PCR analysis revealed that osteogenic marker genes, including runx2a and runx2b, were expressed at significantly higher levels in COBCs than in muscle tissue. Under hypoxia-reoxygenation stress, COBC exhibited enhanced apoptotic responses, marked alterations in related gene expression, and modulation of antioxidant enzyme activities, suggesting a certain degree of adaptive capacity to oxygen fluctuations. This study provides the first systematic description of the establishment and biological characterization of COBC, as well as its responses to hypoxic stress. These findings offer a valuable in vitro cell model and technical support for studies on fish bone tissue biology and the assessment of environmental stress effects.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Primary Culture and Subculture
2.3. Cryopreservation and Recovery of Cells
2.4. Investigation of Optimal Growth Conditions for COBCs
2.5. Chromosome Analysis of COBCs
2.6. Biological Characterization of COBCs
2.7. Hypoxic Stress in COBCs
2.8. Antioxidant Enzyme Activity
2.9. RNA Extraction and Quantitative Real-Time PCR (qRT-PCR)
2.10. Statistical Analysis
3. Results
3.1. Primary Culture and Subculture Observation of COBCs
3.2. Effects of Culture Medium Components on the Growth of COBCs
3.3. Chromosome Analysis
3.4. Biological Characterization of the COBCs
3.5. Gene Expression Analysis
3.6. Effects of Hypoxic Stress on COBCs
3.7. Gene Expression Responses of COBCs Under Hypoxia and Reoxygenation
3.8. Enzyme Activity of COBCs
4. Discussion
5. Conclusion
Author Contributions
Funding
Informed Consent Statement
Institutional Review Board Statement
Data Availability
Conflicts of Interest
References
- Chachami, G., Kalousi, A., Papatheodorou, L., Lyberopoulou, A., Nasikas, V., Tanimoto, K., Simos, G., Malizos, K. N., & Georgatsou, E. An association study between hypoxia inducible factor-1alpha (HIF-1α) polymorphisms and osteonecrosis. Plos One 2013, 8(11), e79647. [CrossRef]
- Deme, D., & Telekes, A. Prognostic importance of lactate dehydrogenase (LDH) in oncology. Orvosi Hetilap 2017, 158(50), 1977-1988.
- Du, H. Y., Xiong, S. B., Lv, H., Zhao, S. M., & Manyande, A. Comprehensive analysis of transcriptomics and metabolomics to understand the flesh quality regulation of crucian carp (Carassius auratus) treated with short term micro-flowing water system. Food Research International 2021, 147, 13, 110519. [CrossRef]
- Ducy, P., Starbuck, M., Priemel, M., Shen, J., Pinero, G., Geoffroy, V., Amling, M., & Karsenty, G. A Cbfa1-dependent genetic pathway controls bone formation beyond embryonic development. Genes & development. 1999, 13(8), 1025-1036. [CrossRef]
- Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., & Karsenty, G. Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 1997, 89(5), 747-754. [CrossRef]
- Farquharson, C. Bones and Cartilage: Developmental and Evolutionary Skeletal Biology. In: Taylor & Francis. 2015. [CrossRef]
- Fraternale, A., Paoletti, M. F., Casabianca, A., Nencioni, L., Garaci, E., Palamara, A. T., & Magnani, M. GSH and analogs in antiviral therapy. Molecular aspects of medicine 2009, 30(1-2), 99-110. [CrossRef]
- Fu, S., Cai, Y. Regulatory effects of osteoblasts on os teoclastic bone resorption. Shaanxi Medical Journal 2004, 33(11): 1040-1041.
- Fu, X., Li, N., Lai, Y., Luo, X., Wang, Y., Shi, C., Huang, Z., Wu, S., & Su, J. A novel fish cell line derived from the brain of Chinese perch Siniperca chuatsi: development and characterization. Journal of Fish Biology 2015, 86(1), 32-45. [CrossRef]
- Gong, Z., Zhang, Q., Liu, J., Hu, G., Chen, S., & Wang, N. Establishment, characterization and application in germplasm conservation and disease resistance: An embryonic cell line from Yangtze sturgeon (Acipenser dabryanus). Aquaculture 2023, 575, 739807. [CrossRef]
- Guan, N., Lan, T., Chen, Y., Liu, L., Zhou, F., Gao. Z. Establishment and characterization of bone cell line for blunt snout bream (Megalobrama amblycephala). Journal of fisheries of china 2018, 42(4), 513-521.
- Han, Y. Isolated culture and identification about bionomics in rat osteoblast. Fuzhou: Fujian Agricultural and Forestry University. 2008.
- Huang, Y., Wang, S., Hu, D., Zhang, L., & Shi, S. Knockdown of GCNT2 promoted osteoblast differentiation by activating PI3K/AKT/mTOR pathway in osteoblasts. Scientific Reports 2025, 15(1), 42251. [CrossRef]
- Jing, H., Gao, L., Zhang, M., Wang, N., Lin, X., Zhang, L., & Wu, S. Establishment from the snout and kidney of goldfish, Carassius auratus, of two new cell lines and their susceptibility to infectious pancreatic necrosis virus. Fish Physiology and Biochemistry 2016, 42(1), 303-311. [CrossRef]
- Jing, H., Kong, F., Yuan, X., Zhang, M., Wang, N., Chen, D., Wu, S,. A review: The research development of fish cell lines. Chinese Journal of Fisheries 2023, 36(3), 120.
- Jiang, L., Zhang, J., Han, C., OuYang, Q. Clinical significance of changes of serum osteocalcin (BGP) levels in subjects of different age-groups. Journal of Radioimmunology 2006, 19.
- Komori, T. Regulation of osteoblast differentiation by transcription factors. Journal of cellular biochemistry 2006, 99(5), 1233-1239. [CrossRef]
- Kuchimaru, T., Hoshino, T., Aikawa, T., Yasuda, H., Kobayashi, T., Kadonosono, T., & Kizaka-Kondoh, S. Bone resorption facilitates osteoblastic bone metastasis by insulin-like growth factor and hypoxia. Von Kossa staining showing aberrant bone formation due to bone metastasis of murine osteosarcoma LM8 cells. Cancer science 2014, 105(5), Maycover. [CrossRef]
- Lakra, W., Swaminathan, T. R., & Joy, K. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiology and Biochemistry 2011, 37(1), 1-20. [CrossRef]
- Lall, S. P., & Lewis-McCrea, L. M. Role of nutrients in skeletal metabolism and pathology in fish—An overview. Aquaculture 2007, 267(1-4), 3-19. [CrossRef]
- Li, N., Felber, K., Elks, P., Croucher, P., & Roehl, H. H. Tracking gene expression during zebrafish osteoblast differentiation. Developmental dynamics 2009, 238(2), 459-466.
- Li, X., Ding, L., Feng, N., Sha, H., Zou, G., & Liang, H. Elucidating the Molecular Network Underpinning Hypoxia Adaptation in the Liver of Silver Carp (Hypophthalmichthys molitrix) via Transcriptome Analysis. Animals 2025, 15(24), 3577. [CrossRef]
- Long, F. Building strong bones: molecular regulation of the osteoblast lineage. Nature reviews Molecular cell biology 2012, 13(1), 27-38. [CrossRef]
- Lu, K. W., Wang, H., Xiao, G., Wang, L., Yi, X., Chu, X., & Huang, L. Primary cultured and establishment of hypoxic/reoxygenation model of human dermal microvascular endothelial cells. J. Cardiovasc. Pulmonary Dis. 2015, 34, 132-136.
- Lushchak, V. I. Environmentally induced oxidative stress in aquatic animals. Aquatic toxicology 2011, 101(1), 13-30. [CrossRef]
- Marie, P. J. Signaling pathways affecting skeletal health. Current osteoporosis reports 2012, 10(3), 190-198. [CrossRef]
- Marques, C. L., Rafael, M. S., Cancela, M. L., & Laizé, V. Establishment of primary cell cultures from fish calcified tissues. Cytotechnology 2007, 55(1), 9-13. [CrossRef]
- Nakashima, K., Zhou, X., Kunkel, G., Zhang, Z., Deng, J. M., Behringer, R. R., & De Crombrugghe, B. The novel zinc finger-containing transcription factor osterix is required for osteoblast differentiation and bone formation. Cell 2002, 108(1), 17-29. [CrossRef]
- Nelson, R. L., Turyk, M., Kim, J., & Persky, V. Bone mineral density and the subsequent risk of cancer in the NHANES I follow-up cohort. BMC cancer. 2002, 2(1), 22. [CrossRef]
- Olsén, K. H., & Bonow, M. Crucian carp (Carassius carassius), an anonymous fish with great skills. Ichthyological Research 2003, 70(3), 313-331. [CrossRef]
- Parfitt, A. M. Skeletal heterogeneity and the purposes of bone remodeling: implications for the understanding of osteoporosis. In Osteoporosis. 2001, 433-447.
- Rafael, M. S., Marques, C., Parameswaran, V., Cancela, M., & Laizé, V. Fish bone-derived cell lines: an alternative in vitro cell system to study bone biology. Journal of Applied Ichthyology 2010, 26(2), 230-234. [CrossRef]
- Rissanen, E., Tranberg, H. K., Sollid, J., Nilsson, G. r. E., & Nikinmaa, M. Temperature regulates hypoxia-inducible factor-1 (HIF-1) in a poikilothermic vertebrate, crucian carp (Carassius carassius). Journal of Experimental Biology 2006, 209(6), 994-1003. [CrossRef]
- Rosa, J., Tiago, D., Dias, J., Cancela, M., & Laizé, V. Serum-specific stimulation of proliferation and mineralization of fish bone-derived cells. Journal of Applied Ichthyology 2010, 26(2), 251-256. [CrossRef]
- Semenza, G. L. Oxygen homeostasis. Wiley Interdisciplinary Reviews: Systems Biology and Medicine 2010, 2(3), 336-361.
- Vijayakumar, P., Laizé, V., Cardeira, J., Trindade, M., & Cancela, M. L. Development of an in vitro cell system from zebrafish suitable to study bone cell differentiation and extracellular matrix mineralization. Zebrafish 2013, 10(4), 500-509. [CrossRef]
- Wang, C., Li, Y. Studies on the Karyotype of Goldfish (Carassius auratus) Ⅰ. A Comparative Study of Chromosomes in Crucian and Red Dragon-eye Goldfish. Acta Genetica Sinica. 1982, (3), 238-242+249-250.
- Wang, J., Gao, X., Wang, L., Du, C., Hou, C., Liu, F., Xie, Q., Lou, B., Jin, S., & Zhu, J. Establishment of the first cell line from the small yellow croaker (Larimichthys polyactis) and its application in unraveling the mechanism of ROS-induced apoptosis under hypoxia. Aquaculture 2023, 563, 738900. [CrossRef]
- Wang, R., Zhang, N., Wang, R., Wang, S., & Wang, N. Two skin cell lines from wild-type and albino Japanese flounder (Paralichthys olivaceus): Establishment, characterization, virus susceptibility, efficient transfection, and application to albinism study. Fish Physiology and Biochemistry 2017, 43(6), 1477-1486. [CrossRef]
- Wei, S., Yu, Y., & Qin, Q. Establishment of a new fish cell line from the caudal fin of golden pompano Trachinotus ovatus and its susceptibility to iridovirus. Journal of Fish Biology 2018, 92(6), 1675-1686. [CrossRef]
- Witten, P. E., Harris, M., Huysseune, A., & Winkler, C. Small teleost fish provide new insights into human skeletal diseases. Methods in cell biology 2017, 138, 321-346.
- Witten, P. E., & Huysseune, A. A comparative view on mechanisms and functions of skeletal remodelling in teleost fish, with special emphasis on osteoclasts and their function. Biological Reviews 2009, 84(2), 315-346. [CrossRef]
- Wolf, K., & Quimby, M. Established eurythermic line of fish cells in vitro. Science,1962, 135(3508), 1065-1066. [CrossRef]
- Xie, Y., Chen, K., Ma, X. Isolation and identification and comparative study of calvarial osteoblasts and osteocytes of rats. Medical & Pharmaceutical Journal of Chinese People’s Liberation Army 2015, 27(3), 1-5.
- Xiao, Y., Zeng, L., Xu, J., & Zhou, Y. Establishment and characterization of a cell line derived from fin of Cryprinus carpiod. Chinese Journal of Cell Biology 2012, 34(8), 767-774.
- Xu, W., Feng, Y., Chen, S., Wang, H., Wen, J., Zheng, G., Wang, G., & Zou, S. Establishment and identification of the gill cell line from the blunt snout bream (Megalobrama amblycephala) and its application in studying gill remodeling under hypoxia. Fish Physiology and Biochemistry 2024, 50(6), 2475-2488. [CrossRef]
- Yan, T., Liu, T., Tong, G., Xu, H., Zhang, T., Kuang, Y. Establishment of a Zebrafish Danio rerio Osteoblast Cell Line from Vertebrae. Chinese journal of fisheries 2024, 37(6), 45-52.
- Yasui, K., & Baba, A. Therapeutic potential of superoxide dismutase (SOD) for resolution of inflammation. Inflammation Research 2006, 55(9), 359-363. [CrossRef]
- Zeng, G., Zong, S., Zou, B., Li. K. Effect of polygonatum polysaccharides on the expression of ALP and BGP in the differentiation of the osteoblast by mouse bone marrow derived mesenchymal stem cells. Chinese Journal of Osteoporosis 2014, 20(7).
- Zhang, H., Li, K., Wang, N., Zhai, J., & Chen, S. Establishment and characterization of a liver cell line from spotted knifejaw (Oplegnathus punctatus). Journal of Agricultural Biotechnology 2020, 28(2), 360-368.
- Zhang, W., Chen, H., Liu, W., Jia, K., & Yi, M. Characterizing Marine Medaka (Oryzias melastigma) Haploid Embryonic Stem Cells: A Valuable Tool for Marine Fish Genetic Research. Animals: an Open Access Journal from MDPI. 2024, 14(18), 2739. [CrossRef]
- Zhou, M., Wang, J., Cao, R., Zhang, F., Luo, X., Liao, Y., Chen, W., Ding, H., Tan, X., & Qiao, Z. Hypoxia-induced differences in the expression of pyruvate dehydrogenase kinase 1-related factors in the renal tissues and renal interstitial fibroblast-like cells of Yak (Bos Grunniens). Animals 2024. 14(21), 3110. [CrossRef]
- Zhu, H., Jia, Z., Misra, B. R., Zhang, L., Cao, Z., Yamamoto, M., Trush, M. A., Misra, H. P., & Li, Y. Nuclear factor E2-related factor 2-dependent myocardiac cytoprotection against oxidative and electrophilic stress. Cardiovascular Toxicology 2008, 8(2), 71-85. [CrossRef]
- Zhu, J., Tang, Y., Wu, Q., Ji, Y. C., & Kang, F. W. Mechanism of participation of osteocytes in the formation of osteoclasts under hypoxia. Hua xi kou qiang yi xue za zhi. 2019, 37(5), 463-468. [CrossRef]








| Gene | Primer sequence (5’-3’) |
|---|---|
| runx2a | F: GCATCCCGGTAGATCCGAG |
| R: GCACCGAGCACAGAAAGTTG | |
| runx2b | F: GCCACTTACCACAGAGCCAT |
| R: CCTCGGGCTCCTACCAGTTC | |
| alp | F: CTGCAAAACGGTGGCTTGAT |
| R: GGCAATATTCCTGTTGAGGTCTT | |
| bglapl | F: GAGCGCAGGTCTTCCTGACA |
| R: TCACAGGCCAGGTTTGCTTC | |
| osterix | F: GGGACGGGTTTGGGTTTGTA |
| R: TCAAACGTCCCTCAACCCTC | |
| Caspase-3 | F: AAGAGGACGGCATGGTTGAG |
| R: TACCCTGGAGATGTGGCGTA | |
| Bcl-2 | F: ACCGTCAATAAAGGAGTCGAGG |
| R: AGGCATTCAGAGTCATTCCCCC | |
| hif-1α | F: CCCTCAAGCAGCAAGAAGTTG |
| R: TCTAGTTTGGTCAGGACTGGGG | |
| β-actin | F: GCTCTTCCCCATGCAATCCT |
| R: AAAGTCCAGGGCCACATAGC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).