Submitted:
20 November 2025
Posted:
24 November 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Study Area and Bird Population
2.2. Samples for Pathogen Detection
2.3. Molecular Screening
2.4. Statistical Analysis
3. Results
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| WRC | Wildlife Rehabilitation Center |
| WNV | West Nile Virus |
References
- Hogerwerf, L.; Roof, I.; de Jong, M.J.K.; Dijkstra, F.; van der Hoek, W. Animal sources for zoonotic transmission of psittacosis: a systematic review. BMC Infect Dis 2020, 20, 192. [Google Scholar] [CrossRef]
- Sachse, K.; Laroucau, K.; Vanrompay, D. Avian Chlamydiosis. Current Clinical Microbiology Reports 2015, 2. [Google Scholar] [CrossRef]
- Stokes, H.S.; Berg, M.L.; Bennett, A.T.D. A Review of Chlamydial Infections in Wild Birds. Pathogens 2021, 10. [Google Scholar] [CrossRef] [PubMed]
- Aaziz, R.; Laroucau, K.; Gobbo, F.; Salvatore, D.; Schnee, C.; Terregino, C.; Lupini, C.; Di Francesco, A. Occurrence of Chlamydiae in Corvids in Northeast Italy. Animals (Basel) 2022, 12. [Google Scholar] [CrossRef] [PubMed]
- Beeckman, D.S.; Vanrompay, D.C. Zoonotic Chlamydophila psittaci infections from a clinical perspective. Clin Microbiol Infect 2009, 15, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Zocevic, A.; Vorimore, F.; Marhold, C.; Horvatek, D.; Wang, D.; Slavec, B.; Prentza, Z.; Stavianis, G.; Prukner-Radovcic, E.; Dovc, A.; et al. Molecular characterization of atypical Chlamydia and evidence of their dissemination in different European and Asian chicken flocks by specific real-time PCR. Environ Microbiol 2012, 14, 2212–2222. [Google Scholar] [CrossRef] [PubMed]
- Ravichandran, K.; Anbazhagan, S.; Karthik, K.; Angappan, M.; Dhayananth, B. A comprehensive review on avian chlamydiosis: a neglected zoonotic disease. Trop Anim Health Prod 2021, 53, 414. [Google Scholar] [CrossRef]
- Hogerwerf, L.; B, D.E.G.; Baan, B.; W, V.D.H. Chlamydia psittaci (psittacosis) as a cause of community-acquired pneumonia: a systematic review and meta-analysis. Epidemiol Infect 2017, 145, 3096–3105. [Google Scholar] [CrossRef]
- Arenas-Valls, N.; Chacon, S.; Perez, A.; Del Pozo, R. Atypical Chlamydia Psittaci Pneumonia. Four Related Cases. Arch Bronconeumol 2017, 53, 277–279. [Google Scholar] [CrossRef]
- Fernández, P.; Iborra, M.A.; Simón, M.; Segovia, M. Brote de neumonía por Chlamydia psittaci en la Región de Murcia. Enfermedades Infecciosas y Microbiología Clínica 2020, 38, 300–301. [Google Scholar] [CrossRef]
- Kaptoul, D.; Viladrich, P.F.; Domingo, C.; Niubo, J.; Martinez-Yelamos, S.; De Ory, F.; Tenorio, A. West Nile virus in Spain: report of the first diagnosed case (in Spain) in a human with aseptic meningitis. Scand J Infect Dis 2007, 39, 70–71. [Google Scholar] [CrossRef]
- European Center for Disease Prevention and Control – ECDC, 2020. Epidemiological update: West Nile virus transmission season in Europe, 2020. Available online: https://www.ecdc.europa.eu/en/news-events/epidemiological-update-west-nile-virus-transmission-season-europe-2020 (accessed on 9 October, 2025).
- European Center for Disease Prevention and Control – ECDC, 2024. Available online: https://www.ecdc.europa.eu/sites/default/files/documents/Communicable-disease-threats-report-week-50-2024.pdf (accessed on 9 October, 2025).
- Abad-Cobo, A.; Llorente, F.; Barbero, M.D.C.; Cruz-Lopez, F.; Fores, P.; Jimenez-Clavero, M.A. Serosurvey Reveals Exposure to West Nile Virus in Asymptomatic Horse Populations in Central Spain Prior to Recent Disease Foci. Transbound Emerg Dis 2017, 64, 1387–1392. [Google Scholar] [CrossRef] [PubMed]
- Williams, R.A.J.; Sanchez-Llatas, C.J.; Domenech, A.; Madrid, R.; Fandino, S.; Cea-Callejo, P.; Gomez-Lucia, E.; Benitez, L. Emerging and Novel Viruses in Passerine Birds. Microorganisms 2023, 11. [Google Scholar] [CrossRef]
- Figuerola, J.; Soriguer, R.; Rojo, G.; Gomez Tejedor, C.; Jimenez-Clavero, M.A. Seroconversion in wild birds and local circulation of West Nile virus, Spain. Emerg Infect Dis 2007, 13, 1915–1917. [Google Scholar] [CrossRef]
- Jimenez-Clavero, M.A.; Sotelo, E.; Fernandez-Pinero, J.; Llorente, F.; Blanco, J.M.; Rodriguez-Ramos, J.; Perez-Ramirez, E.; Hofle, U. West Nile virus in golden eagles, Spain, 2007. Emerg Infect Dis 2008, 14, 1489–1491. [Google Scholar] [CrossRef]
- Llorente, F.; Perez-Ramirez, E.; Fernandez-Pinero, J.; Soriguer, R.; Figuerola, J.; Jimenez-Clavero, M.A. Flaviviruses in game birds, southern Spain, 2011-2012. Emerg Infect Dis 2013, 19, 1023–1025. [Google Scholar] [CrossRef]
- Lopez, G.; Jimenez-Clavero, M.A.; Vazquez, A.; Soriguer, R.; Gomez-Tejedor, C.; Tenorio, A.; Figuerola, J. Incidence of West Nile virus in birds arriving in wildlife rehabilitation centers in southern Spain. Vector Borne Zoonotic Dis 2011, 11, 285–290. [Google Scholar] [CrossRef] [PubMed]
- Marzal, A.; Ferraguti, M.; Muriel, J.; Magallanes, S.; Ortiz, J.A.; Garcia-Longoria, L.; Bravo-Barriga, D.; Guerrero-Carvajal, F.; Aguilera-Sepulveda, P.; Llorente, F.; et al. Circulation of zoonotic flaviviruses in wild passerine birds in Western Spain. Vet Microbiol 2022, 268, 109399. [Google Scholar] [CrossRef]
- Garcia San Miguel Rodriguez-Alarcon, L.; Fernandez-Martinez, B.; Sierra Moros, M.J.; Vazquez, A.; Julian Paches, P.; Garcia Villacieros, E.; Gomez Martin, M.B.; Figuerola Borras, J.; Lorusso, N.; Ramos Aceitero, J.M.; et al. Unprecedented increase of West Nile virus neuroinvasive disease, Spain, summer 2020. Euro Surveill 2021, 26. [Google Scholar] [CrossRef] [PubMed]
- Aguilera-Sepulveda, P.; Napp, S.; Llorente, F.; Solano-Manrique, C.; Molina-Lopez, R.; Obon, E.; Sole, A.; Jimenez-Clavero, M.A.; Fernandez-Pinero, J.; Busquets, N. West Nile Virus Lineage 2 Spreads Westwards in Europe and Overwinters in North-Eastern Spain (2017-2020). Viruses 2022, 14. [Google Scholar] [CrossRef]
- Levison, M.E. Diseases Transmitted by Birds. Microbiol Spectr 2015, 3. [Google Scholar] [CrossRef]
- Stallknecht, D.E. Impediments to wildlife disease surveillance, research, and diagnostics. Curr Top Microbiol Immunol 2007, 315, 445–461. [Google Scholar] [CrossRef]
- Stitt, T.; Mountifield, J.; Stephen, C. Opportunities and obstacles to collecting wildlife disease data for public health purposes: results of a pilot study on Vancouver Island, British Columbia. Can Vet J 2007, 48, 83–87. [Google Scholar] [CrossRef]
- Astorga, R.J.; Cubero, M.J.; Leon, L.; Maldonado, A.; Arenas, A.; Tarradas, M.C.; Perea, A. Serological survey of infections in waterfowl in the Guadalquivir marshes (Spain). Avian Dis 1994, 38, 371–375. [Google Scholar] [CrossRef]
- Perez-Sancho, M.; Garcia-Seco, T.; Porrero, C.; Garcia, N.; Gomez-Barrero, S.; Camara, J.M.; Dominguez, L.; Alvarez, J. A ten-year-surveillance program of zoonotic pathogens in feral pigeons in the City of Madrid (2005-2014): The importance of a systematic pest control. Res Vet Sci 2020, 128, 293–298. [Google Scholar] [CrossRef] [PubMed]
- Vazquez, B.; Esperon, F.; Neves, E.; Lopez, J.; Ballesteros, C.; Munoz, M.J. Screening for several potential pathogens in feral pigeons (Columba livia) in Madrid. Acta Vet Scand 2010, 52, 45. [Google Scholar] [CrossRef]
- Navarro, J.; Gremillet, D.; Afan, I.; Miranda, F.; Bouten, W.; Forero, M.G.; Figuerola, J. Pathogen transmission risk by opportunistic gulls moving across human landscapes. Sci Rep 2019, 9, 10659. [Google Scholar] [CrossRef] [PubMed]
- Plaza, P.I.; Lambertucci, S.A. How are garbage dumps impacting vertebrate demography, health, and conservation? Global Ecology and Conservation 2017, 12, 9–20. [Google Scholar] [CrossRef]
- Andersen, M.C.; Adams, H.; Hope, B.; Powell, M. Risk assessment for invasive species. Risk Anal 2004, 24, 787–793. [Google Scholar] [CrossRef]
- Williams, R.A.J.; Criollo Valencia, H.A.; Lopez Marquez, I.; Gonzalez Gonzalez, F.; Llorente, F.; Jimenez-Clavero, M.A.; Busquets, N.; Mateo Barrientos, M.; Ortiz-Diez, G.; Ayllon Santiago, T. West Nile Virus Seroprevalence in Wild Birds and Equines in Madrid Province, Spain. Vet Sci 2024, 11. [Google Scholar] [CrossRef] [PubMed]
- Pantchev, A.; Sting, R.; Bauerfeind, R.; Tyczka, J.; Sachse, K. New real-time PCR tests for species-specific detection of Chlamydophila psittaci and Chlamydophila abortus from tissue samples. Vet J 2009, 181, 145–150. [Google Scholar] [CrossRef]
- Jiménez-Clavero, M.A.; Agüero, M.; Rojo, G.; Gómez-Tejedor, C. A new fluorogenic real-time RT-PCR assay for detection of lineage 1 and lineage 2 West Nile viruses. J Vet Diagn Invest 2006, 18, 459–462. [Google Scholar] [CrossRef]
- Harkinezhad, T.; Geens, T.; Vanrompay, D. Chlamydophila psittaci infections in birds: a review with emphasis on zoonotic consequences. Vet Microbiol 2009, 135, 68–77. [Google Scholar] [CrossRef]
- Aguirre, J.I.; Vergara, P. Census methods for White stork (Ciconia ciconia): bias in sampling effort related to the frequency and date of nest visits. Journal of Ornithology 2009, 150, 147–153. [Google Scholar] [CrossRef]
- Blanco, G. Population dynamics and communal roosting of White Storks foraging at a Spanish refuse dump. Colon Waterbird 1996, 19, 273–276. [Google Scholar] [CrossRef]
- Schulz, H. 1999.Der Welbestand des Weißstorch im Aufwind?-White Storks on the up? – Proceedings, Internat. Symp. On the White Stork, Hamburg 1996-NABU (Naturschutzbund Deutschland e. V.), Bonn: 351-365. (Cited in Van den Bossche, 2002).
- Molina, B. & Del Moral, J. C. 2005. La Cigüeña Blanca en España.VI Censo Internacional (2004). SEO/BirdLife. Madrid.
- Camacho, M.; Hernandez, J.M.; Lima-Barbero, J.F.; Hofle, U. Use of wildlife rehabilitation centres in pathogen surveillance: A case study in white storks (Ciconia ciconia). Prev Vet Med 2016, 130, 106–111. [Google Scholar] [CrossRef] [PubMed]
- Sukon, P.; Nam, N.H.; Kittipreeya, P.; Sara-In, A.; Wawilai, P.; Inchuai, R.; Weerakhun, S. Global prevalence of chlamydial infections in birds: A systematic review and meta-analysis. Prev Vet Med 2021, 192, 105370. [Google Scholar] [CrossRef] [PubMed]
- Riccio, M.B.; García, J.P.; Chiapparrone, M.L.; Cantón, J.; Cacciato, C.; Origlia, J.A.; Cadario, M.E.; Diab, S.S.; Uzal, F.A.
- Infection in a Commercial Psittacine Breeding Aviary in Argentina. Animals-Basel 2024, 14.
- 10.3390/ani14131959.
- Piasecki, T.; Chrzastek, K.; Wieliczko, A. Detection and identification of Chlamydophila psittaci in asymptomatic parrots in Poland. BMC Vet Res 2012, 8, 233. [Google Scholar] [CrossRef] [PubMed]
- Sheleby-Elias, J.; Solorzano-Morales, A.; Romero-Zuniga, J.J.; Dolz, G. Molecular Detection and Genotyping of Chlamydia psittaci in Captive Psittacines from Costa Rica. Vet Med Int 2013, 2013, 142962. [Google Scholar] [CrossRef]
- Tripinichgul, S.; Weerakhun, S.; Kanistanon, K. Prevalence and Risk Factors of Avian Chlamydiosis Detected by Polymerase Chain Reaction in Psittacine Birds in Thailand. J Avian Med Surg 2023, 36, 372–379. [Google Scholar] [CrossRef]
- López, J.; Mogedas, M.; Ballesteros, C.; Martín-Maldonado, B.; Sacristán, I.; García, R.; Ortiz, J.C.; Esperón, F. Infectious agents present in monk parakeet (Myiopsitta monachus) and rose-ringed parakeet (Psittacula krameri) invasive species in the parks of Madrid and Seville, Spain. Frontiers in Veterinary Science, 2023. [Google Scholar] [CrossRef]
- Szymańska-Czerwińska, M.; Mitura, A.; Niemczuk, K.; Zaręba, K.; Jodełko, A.; Pluta, A.; Scharf, S.; Vitek, B.; Aaziz, R.; Vorimore, F.; et al. Dissemination and genetic diversity of chlamydial agents in Polish wildfowl: Isolation and molecular characterisation of avian Chlamydia abortus strains. PLoS One 2017, 12, e0174599. [Google Scholar] [CrossRef]
- Blomqvist, M.; Christerson, L.; Waldenström, J.; Lindberg, P.; Helander, B.; Gunnarsson, G.; Herrmann, B.; Olsen, B. Chlamydia psittaci in birds of prey, Sweden. Infect Ecol Epidemiol 2012, 2. [Google Scholar] [CrossRef]
- Amery-Gale, J.; Legione, A.R.; Marenda, M.S.; Owens, J.; Eden, P.A.; Konsak-Ilievski, B.M.; Whiteley, P.L.; Dobson, E.C.; Browne, E.A.; Slocombe, R.F.; et al. Surveillance for Chlamydia Spp. With Multilocus Sequence Typing Analysis in Wild and Captive Birds in Victoria, Australia. J Wildl Dis 2020, 56, 16–26. [Google Scholar] [CrossRef]
- Stalder, S.; Marti, H.; Borel, N.; Mattmann, P.; Vogler, B.; Wolfrum, N.; Albini, S. Detection of Chlamydiaceae in Swiss wild birds sampled at a bird rehabilitation centre. Vet Rec Open 2020, 7, e000437. [Google Scholar] [CrossRef]
- Andersen, A.A. Comparison of pharyngeal, fecal, and cloacal samples for the isolation of Chlamydia psittaci from experimentally infected cockatiels and turkeys. J Vet Diagn Invest 1996, 8, 448–450. [Google Scholar] [CrossRef]
- Plaza, P.I.; Blanco, G.; Madariaga, M.J.; Boeri, E.; Teijeiro, M.L.; Bianco, G.; Lambertucci, S.A. Scavenger birds exploiting rubbish dumps: Pathogens at the gates. Transbound Emerg Dis 2019, 66, 873–881. [Google Scholar] [CrossRef]
- Konicek, C.; Vodrážka, P.; Barták, P.; Knotek, Z.; Hess, C.; Račka, K.; Hess, M.; Troxler, S. DETECTION OF ZOONOTIC PATHOGENS IN WILD BIRDS IN THE CROSS-BORDER REGION AUSTRIA - CZECH REPUBLIC. J Wildl Dis 2016, 52, 850–861. [Google Scholar] [CrossRef]
- Tiyawattanaroj, W.; Lindenwald, R.; Mohr, L.; Günther, E.; Legler, M. - Monitoring of the infectious agent Chlamydia psittaci in common swifts (Apus apus) in the area of Hannover, Lower Saxony, Germany. 2021, - 134, - 5. - 134.
- Favier, P.; Wiemeyer, G.M.; Arias, M.B.; Lara, C.S.; Vilar, G.; Crivelli, A.J.; Ludvik, H.K.; Ardiles, M.I.; Teijeiro, M.L.; Madariaga, M.J.; et al. Chlamydia psittaci Screening of Animal Workers from Argentina Exposed to Carrier Birds. Ecohealth 2024, 21, 38–45. [Google Scholar] [CrossRef]
- Ossa-Giraldo, A.C.; Usuga-Perilla, X.; Correa, J.S.; Segura, J.A. Chlamydia psittaci seropositivity in workers exposed to birds and review of the literature: Evidence of circulation in Antioquia. Biomedica 2023, 43, 330–343. [Google Scholar] [CrossRef]
- Komar, N.; Langevin, S.; Hinten, S.; Nemeth, N.; Edwards, E.; Hettler, D.; Davis, B.; Bowen, R.; Bunning, M. Experimental infection of North American birds with the New York 1999 strain of West Nile virus. Emerg Infect Dis 2003, 9, 311–322. [Google Scholar] [CrossRef]
- Atama, N.C.; Chestakova, I.V.; de Bruin, E.; van den Berg, T.J.; Munger, E.; Reusken, C.; Oude Munnink, B.B.; van der Jeugd, H.; van den Brand, J.M.A.; Koopmans, M.P.G.; et al. Evaluation of the use of alternative sample types for mosquito-borne flavivirus surveillance: Using Usutu virus as a model. One Health 2022, 15, 100456. [Google Scholar] [CrossRef] [PubMed]
- Langevin, S.A.; Bunning, M.; Davis, B.; Komar, N. Experimental infection of chickens as candidate sentinels for West Nile virus. Emerg Infect Dis 2001, 7, 726–729. [Google Scholar] [CrossRef] [PubMed]
- Senne, D.A.; Pedersen, J.C.; Hutto, D.L.; Taylor, W.D.; Schmitt, B.J.; Panigrahy, B. Pathogenicity of West Nile virus in chickens. Avian Dis 2000, 44, 642–649. [Google Scholar] [CrossRef]
- Swayne, D.E.; Beck, J.R.; Smith, C.S.; Shieh, W.J.; Zaki, S.R. Fatal encephalitis and myocarditis in young domestic geese (Anser anser domesticus) caused by West Nile virus. Emerg Infect Dis 2001, 7, 751–753. [Google Scholar] [CrossRef]
- Swayne, D.E.; Beck, J.R.; Zaki, S. Pathogenicity of West Nile virus for turkeys. Avian Dis 2000, 44, 932–937. [Google Scholar] [CrossRef]
- Brown, C.; O'Brien, V. Are Wild Birds Important in the Transport of Arthropod-borne Viruses? Ornithological Monographs 2011, 71, 1–64. [Google Scholar] [CrossRef]
- Engel, D.; Jost, H.; Wink, M.; Borstler, J.; Bosch, S.; Garigliany, M.M.; Jost, A.; Czajka, C.; Luhken, R.; Ziegler, U.; et al. Reconstruction of the Evolutionary History and Dispersal of Usutu Virus, a Neglected Emerging Arbovirus in Europe and Africa. mBio 2016, 7, e01938–01915. [Google Scholar] [CrossRef]
- Roiz, D.; Vazquez, A.; Ruiz, S.; Tenorio, A.; Soriguer, R.; Figuerola, J. Evidence that Passerine Birds Act as Amplifying Hosts for Usutu Virus Circulation. Ecohealth 2019, 16, 734–742. [Google Scholar] [CrossRef]
- Artois, M.; Bengis, R.; Delahay, R.J.; Duchêne, M.J.; Duff, J.P.; Ferroglio, E.; Gortazar, C.; Hutchings, M.R.; Kock, R.A.; Leighton, F.A.; et al. Wildlife Disease Surveillance and Monitoring. Management of Disease in Wild Mammals 2009, 187–213. [Google Scholar]
- Drewe, J.A.; Hoinville, L.J.; Cook, A.J.; Floyd, T.; Stark, K.D. Evaluation of animal and public health surveillance systems: a systematic review. Epidemiol Infect 2012, 140, 575–590. [Google Scholar] [CrossRef] [PubMed]
- Figuerola J., T. S., González, M.A, Ruiz-López, M.J., Sergio Magallanes, S., Vázquez A. Análisis del riesgo de circulación del Virus del Nilo Occidental en España. Ministerio de Sanidad; 2024.
| Order of birds | Common names (number of samples) |
C. psittaci n (%) |
WNV n (%) |
|---|---|---|---|
| Ciconiiformes | White Stork (83), Little Egret (24), Little Bittern (1) | 108 (23.3%) | 125 (22.3%) |
| Accipitriformes | Black Kite (27), Common Buzzard (18), Griffon Vulture (12), Red Kite (12), Short-toed Eagle (10), Imperial Eagle (4), Black Vulture (4), Golden Eagle (2), Western Marsh Harrier (2), Sparrowhawk (2), Northern Goshawk (1) | 94 (20.3%) | 118 (21.1%) |
| Psittaciformes | Monk Parakeet (79), Cockatiel (2), Peach-faced Lovebird (2), Red-winged Parrot (1), Blue-fronted Amazon (1), Lovebird (1), Grey Parrot (1) | 87 (18.8%) | 110 (19.6%) |
| Charadriiformes | Mediterranean Gull (51), Black-headed Gull (9), Common Snipe (1) | 61 (13.1%) | 64 (11.4%) |
| Anseriformes | Mallard (19), Egyptian Goose (4), Domestic Goose (1), Mute Swan (1) | 25 (5.4%) | 25 (4.5%) |
| Strigiformes | Eurasian Eagle-Owl (23), Little Owl (2) | 25 (5.4%) | 35 (6.2%) |
| Falconiformes | Lesser Kestrel (11), Peregrine Falcon (4), Common Kestrel (2) | 17 (3.7%) | 25 (4.5%) |
| Passeriformes | House Sparrow (4), Eurasian Magpie (4), Song Thrush (2), European Robin (2), Common Raven (1), Great Grey Shrike (1) | 14 (3.0%) | 19 (3.4%) |
| Suliformes | Great Cormorant (11) | 11 (2.4%) | 13 (2.3%) |
| Pelecaniformes | Grey Heron (6), Common Spoonbill (2), Black-crowned Night Heron (1) | 9 (1.9%) | 9 (1.6%) |
| Gruiformes | Great Bustard (6), Common Crane (1), Common Coot (1) | 8 (1.7%) | 11 (2.0%) |
| Columbiformes | Rock Pigeon (2), Wood Pigeon (1) | 3 (0.6%) | 4 (0.7%) |
| Apodiformes | Common Swift (1) | 1 (0.2%) | 1 (0.2%) |
| Podicipediformes | Great Crested Grebe (1) | 1 (0.2%) | 1 (0.2%) |
| TOTAL | 464 (100%) | 560 (100%) |
| Pathogen and primer | Nucleotide sequence (5´to 3´) and labelling | Reference |
|---|---|---|
|
Chlamydia psittaci |
||
| CppsOMP1-F | CACTATGTGGGAAGGTGCTTCA | |
| CppsOMP1-R | CTGCGCGGATGCTAATGG | Pantchev et al., 2009 [33] |
| CppsOMP1-S | FAMa-CGCTACTTGGTGTGACBHQ1b | |
| West Nile Virus | ||
| WN-LCV-F1 | GTGATCCATGTAAGCCCTCAGAA | |
| WN-LCV-R1 | GTCTGACATTGGGCTTTGAAGTTA | Jiménez-Clavero et al., 2006 [34] |
| WN-LCV-S1 | FAMa-AGGACCCCACATGTT-MGBc | |
| WN-LCV-S2 | FAMa-AGGACCCCACGTGCT-MGBc |
| Variable | C. psittaci (n=464) | WNV (n=560) |
|---|---|---|
| Sample type | ||
| Pooled cloacal/tracheal | 251 (54.1%) | 251 (44.8%) |
| Tracheal swab | 96 (20.7%) | 109 (19.5%) |
| Cloacal swab | 91 (19.6%) | 104 (18.6%) |
| Brain | 26 (5.6%) | 96 (17.1%) |
| Sampling by month | ||
| January | 111 (23.9%) | 118 (21.1%) |
| February | 53 (11.4%) | 74 (13.2%) |
| March | 46 (9.9%) | 64 (11.4%) |
| April | 0 (0.0%) | 51 (9.1%) |
| May | 14 (3.0%) | 21 (3.8%) |
| June | 34 (7.3%) | 36 (6.4%) |
| July | 34 (7.3%) | 44 (7.9%) |
| August | 16 (3.4%) | 25 (4.5%) |
| September | 22 (4.7%) | 28 (5.0%) |
| October | 49 (10.6%) | 47 (8.4%) |
| November | 19 (4.1%) | 31 (5.5%) |
| December | 29 (6.3%) | 21 (3.8%) |
| Sex* | ||
| Female | 54 (46.2%) | 78 (45.6%) |
| Male | 63 (53.8%) | 93 (54.4%) |
| Age* | ||
| Adults | 186 (83.4%) | 239 (80.5%) |
| Young | 27 (12.1%) | 48 (16.2%) |
| Juveniles | 10 (4.5%) | 10 (3.4%) |
| Year | C. psittaci tested | C. psittaci % positive (95% CI) | WNV tested | WNV % positive (95% CI) |
|---|---|---|---|---|
| 2013 | 88 | 0.00% (0.00–4.11) | 130 | 0.00% (0.00–2.80) |
| 2014 | 38 | 0.00% (0.00–9.25) | 55 | 0.00% (0.00–6.49) |
| 2015 | 78 | 0.00% (0.00–4.62) | 115 | 0.00% (0.00–3.16) |
| 2016 | 40 | 0.00% (0.00–8.81) | 40 | 0.00% (0.00–8.81) |
| 2017 | 16 | 0.00% (0.00–20.59) | 16 | 0.00% (0.00–20.59) |
| 2018 | 2 | 0.00% (0.00–84.19) | 2 | 0.00% (0.00–84.19) |
| 2019 | 7 | 0.00% (0.00–40.96) | 7 | 0.00% (0.00–40.96) |
| 2020 | 61 | 0.00% (0.00–5.87) | 61 | 0.00% (0.00–5.87) |
| 2021 | 73 | 1.37% (0.03–7.40) | 73 | 0.00% (0.00–4.93) |
| 2022 | 61 | 0.00% (0.00–5.87) | 61 | 0.00% (0.00–5.87) |
| TOTAL | 464 | 0.22% (0.01–1.19) | 560 | 0.00% (0.00–0.66) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).