Preprint
Article

This version is not peer-reviewed.

Identification of the Genes daf-12, sdc-2, and sex-1 Associated with Sexual Differentiation of Haemonchus contortus

Submitted:

16 October 2025

Posted:

17 October 2025

You are already at the latest version

Abstract
Haemonchus contortus (H. contortus) is a gastrointestinal parasite that affects small ruminants, causing anemia, edema, and, in severe cases, death, posing a significant threat to livestock production. This study focused on analyzing the parasite’s sexual differentiation to identify potential molecular targets for the development of control strategies. The genes daf-12, fem-1, and sdc-2 were evaluated based on their orthologs in Caenorhabditis elegans. Specific primers were designed, and nucleic acids were extracted from L3 larvae and adult male and female H. contortus. Gene presence and expression were analyzed using PCR and RT-PCR, along with protein structure modeling and phylogenetic analysis. Results showed differential gene expression depending on life stage and sex: daf-12 was highly expressed in L3 larvae, indicating its involvement in early development; fem-1 showed higher expression in males, suggesting a role in male sexual differentiation; while sdc-2 was more expressed in females, implying a function in regulating female characteristics. These findings provide key insights into the molecular mechanisms underlying sexual differentiation in H. contortus, which could contribute to the development of novel control tools and help mitigate the economic losses caused by this parasite in livestock production.
Keywords: 
;  ;  

1. Introduction

Haemonchosis is a parasitic disease caused by the blood-feeding nematode Haemonchus contortus (H. contortus), which primarily infects small ruminants such as sheep and goats. The economic burden of this parasite is considerable, as it reduces meat and milk production and compromises animal health and welfare [1,2].
Sexual reproduction is essential for population growth in most animals and depends on the generation of two distinct sexes. Sex determination usually occurs at early developmental stages and has profound consequences for development and behavior [3]. In insects, sex is determined by different chromosomal systems (e.g., XY/XX in flies and beetles, ZZ/ZW in butterflies and moths, and XO/XX or Z0/ZZ in some groups), while Hymenoptera use a haplodiploid system in which unfertilized eggs develop into haploid males and fertilized eggs into diploid females [4]. In Drosophila melanogaster, sex determination relies on activation of the sex-lethal gene rather than the presence of a Y chromosome. In mammals such as mice (Mus musculus), the testis-determining gene on the Y chromosome triggers testis formation and systemic hormonal regulation of development and behavior [4,5].
In nematodes, Genetic Sex Determination (GSD) occurs, where sex is defined by the presence or absence of sex chromosomes: females are homogametic XX and males heterogametic XO. Nematode species with chromosomal sex determination typically display a 1:1 sex ratio [6,7]. GSD begins with an initial signal based on the ratio of X chromosomes to autosomes (X:A). This signal initiates a cascade of interacting genes that regulate sexual identity and coordinate the development of male or female traits [8,9]. In addition to sex determination, this cascade also regulates X-chromosome dosage compensation [3].
The free-living nematode Caenorhabditis elegans (C. elegans) has been a fundamental model for studying sex determination. Its pathway is divided into two segments: an upstream branch (from X:A signal to sdc-2) that coordinates sex determination and dosage compensation, and a downstream branch (from her-1 to tra-1) that controls sexual fate [10,11]. Key regulators include xol-1, which promotes male development in XO animals, and sdc-2, which directs female/hermaphrodite fate in XX animals. Downstream, the fem genes (fem-1, fem-2, fem-3) promote tra-1 degradation to enable male development, while active tra-1 specifies female/hermaphrodite identity [3,8,12].
In H. contortus, sexual differentiation also follows an XX/XO system, as demonstrated by microsatellite markers. Males are consistently monomorphic, while females are diploid with expected heterozygosity, and polyandry has been reported, increasing offspring genetic variability [13,14]. Comparative analyses suggest that while some regulators are conserved between C. elegans and H. contortus, others differ. For example, fox-1 and sex-1 orthologs are present but autosomal, and regulators such as xol-1 and sdc-1, sdc-2, sdc-3 appear absent. Most downstream components, including orthologs of her-1 and fem-1/fem-2, are present, though tra-2 and fem-3 were not detected [15,16].
These differences suggest that although H. contortus shares the XX/XO system with C. elegans, its regulatory network is only partially conserved. The aim of this study is to identify and characterize orthologs of key sex-differentiation genes in H. contortus, in order to improve understanding of its reproductive biology and to identify potential molecular targets for novel parasite control strategies.

2. Materials and Methods

2.1. Obtaining H. Contortus L3

The L3 were obtained from the feces of Columbia breed sheep previously infected with a pure strain of H. contortus. This strain has been maintained through successive infections in animals free of other nematodes and was donated by the research group of Dr. Fernando Alba Hurtado from the Multidisciplinary Research Unit of FES-Cuautitlán.

2.2. Sucrose Washing and Recovery of H. Contortus L3

A sucrose solution was prepared by dissolving 20 g of sucrose in 200 mL of pre-heated distilled water. Ten milliliters of this solution were dispensed into four 15-mL conical tubes, and 5 mL of a suspension containing H. contortus L3 were added to each tube, reaching a final volume of 15 mL. The sucrose solution created a density gradient, allowing the larvae to remain suspended.
Tubes were centrifuged at 6,000 × g for 5 min, and the supernatant was decanted. One milliliter of the interphase from each tube was transferred to new 15-mL conical tubes, diluted with 14 mL of distilled water, and centrifuged again under the same conditions. This washing step was repeated three times. Larval pellets obtained after centrifugation were resuspended in 5 mL of 1X PBS and transferred to fresh conical tubes.
To prevent bacterial and fungal growth in the suspension containing H. contortus L3, a 20 µL antibiotic–antimycotic treatment was added, consisting of penicillin (10,000 U/mL), streptomycin (10,000 mg/mL), and amphotericin B (25 µg/mL). The treatment was applied for 24 h under refrigeration at 4 °C.

2.3. Exsheathment and Migration of H. Contortus L3

The conical tube containing H. contortus L3 was centrifuged at 6,000 × g for 5 min, and the supernatant was discarded. Ten milliliters of 1X PBS and 500 µL of sodium hypochlorite were added, followed by centrifugation at 6,000 × g for 5 min and decantation. The larvae were washed three times by adding 10 mL of distilled water, centrifuging under the same conditions, and discarding the supernatant.
A 50-mL conical tube was prepared with 45 mL of 1X PBS supplemented with 90 µL of an antibiotic–antimycotic mixture (penicillin, 10,000 U/mL; streptomycin, 10,000 mg/mL; amphotericin B, 25 µg/mL) and 14.4 µL of ceftriaxone. A mini-Baermann apparatus was assembled by cutting the bottom end of a 15-mL conical tube and placing it inside the 50-mL tube. The open end of the 15-mL tube was covered with a lens-cleaning tissue secured with a rubber band, serving as a filter. The 50-mL tube was then filled with 15 mL of 1X PBS containing antibiotics until the liquid reached the lower edge of the 15-mL tube in contact with the tissue [17].
Finally, the suspension of H. contortus L3 was placed inside the 15-mL tube, allowing the larvae to migrate through the tissue by hydrotaxy while shedding their cuticle. The mini-Baermann apparatus was incubated for 24 h at 37 °C.

2.4. Preservation of H. Contortus L3

The conical tube containing the suspension of H. contortus L3 under antibiotic–antimycotic treatment was removed from the incubator, adjusted to 14 mL with 1X PBS, centrifuged at 6,000 × g for 5 min, and the supernatant discarded. This step was repeated twice. Finally, 3 mL of Trizol (Cat. 15596026, Invitrogen) were added to the L3, the solution was homogenized, and aliquoted into three 1.5-mL microtubes (1 mL each), which were stored at –70 °C until further use.

2.5. Collection of H. Contortus Adult Males and Females

Adult male and female H. contortus were kindly provided by the Helminthology Unit, headed by Dr. María Eugenia López Arellano at CENID-SAI. Parasites were collected directly from the abomasum during necropsies of sheep experimentally infected with H. contortus, which had not been exposed to other pathogens or anthelmintic treatments. These animals belonged to the production unit of CENID-SAI. The collected specimens were washed with 1X PBS and placed in Trizol and stored at –70 °C until use.

2.6. Identification of Genes Associated with Sexual Differentiation in C. elegans

An in-silico search was performed across multiple databases (ScienceDirect, Web of Science, PubMed, Scopus, Wiley, and Bidi-UNAM) using keywords such as “C. elegans,” “sex differentiation,” “sex determination,” and “sex-specific gene expression.” Articles from the last 10 years were prioritized, but earlier studies were included if relevant. Selected studies were evaluated for information on gene function, regulation, and expression related to sexual differentiation.

2.7. Identification of Gene Sequences Related to Sexual Differentiation in the H. contortus Genome

A bioinformatic analysis was performed using C. elegans genes as references. Amino acid sequences were aligned via BLASTp in NCBI, Swiss-Prot, and KEGG databases to identify orthologs in H. contortus. Nucleotide sequences were obtained or inferred from amino acid sequences when unavailable. Genes were selected based on sequence availability and functional relevance. The constitutive gene sod was used as a reference to monitor amplification and normalize results.

2.8. Primer Design for Selected Gene Sequences

Oligonucleotides were designed using the DNA sequences obtained from the conversion of amino acid sequences to nucleotide sequences via the Sequence Manipulation Suite. Complementary strands were generated in the 5’–3’ direction. Oligonucleotide length was optimized to 17–20 base pairs (Table 1). The melting temperature (Tm) was calculated to ensure specific annealing to the template DNA, with an ideal range of 55–65 °C. Terminal complementarity was checked to prevent self- or cross-dimer formation. Designed oligonucleotides were synthesized at the Institute of Biotechnology, UNAM.

2.9. Genomic DNA Extraction

Genomic DNA (gDNA) was extracted from a sample of 1000 exsheathed L3 of H. contortus suspended in 500 µL of 1X PBS. The sample was subjected to lysis by thermal shock in a dry bath at 65 °C for 5 min, followed by mechanical maceration and disruption with a sterile pestle, and immersion in liquid nitrogen for 5 min. This cycle was repeated three times. DNA was then purified using the FavorPrep™ Tissue Genomic DNA Extraction kit (Favorgen®).
gDNAquantification was performed using a Nabi-UV/Vis nanophotometer. RNA integrity was assessed by electrophoresis on 2% agarose gels using 6X TriTack DNA Load-ing Dye (Thermo Scientific®). Gels were documented with the EpiChemi3 Darkroom system and ToupView software.

2.10. RNA Extraction

Total RNA was extracted from a sample of 1000 exsheathed L3 and 10 adult males and females of H. contortus suspended in 500 µL of Trizol. Each sample was subjected to lysis by thermal shock in a dry bath at 65 °C for 5 min, followed by mechanical maceration and disruption with a sterile pestle, and immersion in liquid nitrogen for 5 min. This cycle was repeated three times. RNA was then purified using the Direct-zol™ RNA Miniprep Plus kit (Zymo Research®).
RNA quantification was performed using a Nabi-UV/Vis nanophotometer. RNA integrity was assessed by electrophoresis on 2% agarose gels using 6X TriTack DNA Loading Dye (Thermo Scientific®). Gels were documented with the EpiChemi3 Darkroom system and ToupView software.

2.11. PCR

To confirm the presence of genes associated with sexual differentiation in the H. contortus genome, endpoint PCR was performed using the GoTaq® Green Master Mix 2X kit (Promega). The reaction was carried out with previously extracted gDNA, and primers specifically designed for this analysis.
PCR products were resolved on 2% agarose gels stained with ethidium bromide and compared with a 50 bp molecular marker (Jena Bioscience®). Gels were documented with the EpiChemi3 Darkroom system, and amplicon sizes were estimated using a calibration curve based on marker migration distances.

2.12. RT-PCR

Total RNA previously extracted from L3 and adult males and females was used as a template. RT-PCR reactions were carried out with the GoScript™ Reverse Transcription System kit (Promega®), following the manufacturer’s instructions.
RT-PCR products were resolved on 2% agarose gels stained with ethidium bromide and compared with a 50 bp molecular marker (Jena Bioscience®). Band intensities were quantified using ImageJ, averaged from three replicates, and normalized to the constitutive control (100%).

2.13. Statycal Analysis

Statistical analysis was performed using one-way analysis of variance (ANOVA) on optical densitometry values expressed as relative percentages. Analyses were conducted using GraphPad Prism 9 software, and differences were considered statistically significant at p ≤ 0.05.

2.14. Modeling of the daf-12, fem-1, and sdc-2 Gene Structures

3D models of daf-12, fem-1, and sdc-2 were generated with AlphaFold and validated using SAVES. Stereochemical quality was assessed with PROCHECK Ramachandran plots and ERRAT, yielding Overall Quality Factors comparable to experimentally resolved proteins.

2.15. Phylogenetic Analysis

Phylogenetic trees were constructed using amino acid sequences of DAF-12, FEM-1, and SDC-2 obtained from NCBI and Swiss-Prot (Appendix A). Sequences with high identity and conserved domains were aligned with ClustalW (MEGA 12), and a Neighbor-Joining tree was generated with 1500 Bootstrap replicates.

3. Results

3.1. Determination of the Presence of Genes Related to Sexual Differentiation in the H. contortus Genome

Three amplicons were detected: daf-12 (660 bp), sdc-2 (469 bp), and fem-1 (154 bp) (Figure 1).

3.1.1. daf-12

For daf-12, amplicons of 61 bp were detected, compared with the constitutive sod gene (36 bp). Optical densitometric analysis revealed relative expression levels of 167% in L3, 117% in males, and 101% in females of H. contortus. One-way ANOVA indicated statistically significant differences between L3–males (p ≤ 0.01) and L3–females (p ≤ 0.001) (Figure 2).

3.1.2. fem-1

For fem-1 amplicons of 81 bp were observed in comparison with the constitutive gene sod (36 bp). Optical densitometric analysis revealed relative expression levels of 57% in L3, 140% in males, and 48% in females of H. contortus. Statistical analysis using ANOVA showed significant differences between L3–males (p ≤ 0.001) and males–females (p ≤ 0.0001) (Figure 3).

3.1.3. sdc-2

Amplicons of 74 bp were observed in comparison with the constitutive gene sod (36 bp). Optical densitometric analysis revealed relative expression levels of 72% in L3, 56% in males, and 127% in females of H. contortus. Statistical analysis using ANOVA showed significant differences between L3–females (p ≤ 0.05) and males–females (p ≤ 0.01) (Figure 4).

3.2. Bioinformatic Analysis

3.2.1. 3D Modeling of daf-12

The daf-12 sequence was analyzed in silico and found to encode DAF-12, a protein composed of 686 amino acids (NCBI: QEA03487.1) containing a characteristic nuclear hormone receptor domain. Visual inspection of the 3D model of DAF-12 predicted by AlphaFold revealed a well-defined core composed of α-helices, represented in navy blue, indicating high confidence in the structural prediction for this region (pLDDT > 90). In contrast, orange-colored regions were observed at the termini of the protein, indicating lower confidence (pLDDT < 50) and likely corresponding to flexible or disordered regions (Figure 5a). The 3D model of DAF-12 was further validated using SAVES with the ERRAT and PROCHECK tools. ERRAT generated an overall quality factor of 94.76%, while PROCHECK provided a stereochemical assessment through a Ramachandran plot, which evaluates the orientation of phi (φ) and psi (ψ) angles of amino acids to determine the proper folding and structural stability of the model. The analysis showed that 81.1% of the residues were in the most favored regions of the plot, 9.8% in additionally allowed regions, 3.8% in generously allowed regions, and 5.8% in disallowed regions (Figure 5b).

3.2.2. 3D Modeling of fem-1

The fem-1 sequence was analyzed in silico and found to encode FEM-1, a protein composed of 652 amino acids (NCBI: XGW30565.1) containing an ankyrin repeat domain. Visual inspection of the 3D model of FEM-1 predicted by AlphaFold revealed predominantly α-helices organized in a repetitive and compact pattern, represented in navy blue (pLDDT > 90) and light blue (pLDDT = 90–70), indicating high confidence in the structural prediction for this region. At the protein termini, yellow and orange regions were observed, corresponding to low-confidence predictions (pLDDT < 50) that likely represent flexible segments (Figure 6a). The 3D model of FEM-1 was validated using SAVES with the ERRAT and PROCHECK tools. ERRAT generated an overall quality factor of 76.79%, while PROCHECK provided a stereochemical evaluation through a Ramachandran plot. The analysis showed that 82.4% of residues were in the most favored regions and 17% in additionally allowed regions, with no residues found in generously allowed or disallowed regions (Figure 6b).

3.2.3. 3D Modeling of sdc-2

The sdc-2 sequence was analyzed in silico and found to encode SDC-2, a protein composed of 486 amino acids (NCBI: CDJ84099.1). Visual inspection of the 3D model of SDC-2 predicted by AlphaFold revealed α-helices, some represented in navy blue (pLDDT > 90) and others in light blue (pLDDT = 90–70), indicating high and moderate confidence in the structural prediction. At the protein termini, yellow (pLDDT > 50) and orange (pLDDT < 50) regions were observed, corresponding to low-confidence predictions that are likely to represent flexible regions (Figure 7a). The 3D model of SDC-2 was validated using SAVES with the ERRAT and PROCHECK tools. ERRAT generated an overall quality factor of 86.24%, while PROCHECK provided a stereochemical evaluation through a Ramachandran plot. The analysis showed that 74.8% of residues were located in the most favored regions, 24.5% in additionally allowed regions, 0.5% in generously allowed regions, and 0.2% in disallowed regions (Figure 7b).

3.3. Phylogenetic Analysis

Phylogenetic trees were reconstructed for daf-12, fem-1, and sdc-2 genes using representative protein sequences from invertebrates (insects, arthropods, nematodes, cestodes, trematodes) and vertebrates (reptiles, birds, fish, mammals) available in GenBank and Swiss-Prot. Analyses were performed using the Neighbor-joining method with 1500 bootstrap (BS) replicates.
For daf-12, the tree showed a clear separation among major taxonomic groups, with well-supported clades for insects, arthropods, nematodes, trematodes, cestodes, fish, amphibians, and mammals. H. contortus clustered within the nematode clade together with C. elegans (BS = 100), Oesophagostomum dentatum (BS = 96), and Toxocara canis (BS = 100), indicating conservation of daf-12 among free-living and parasitic nematodes (Figure 8). Lower similarity was observed between nematodes and vertebrates, with BS = 78 for Ovis aries and Capra hircus, the definitive hosts of H. contortus (Figure 8). These results suggest that daf-12 functions in developmental regulation are conserved across taxa.
For fem-1, a similar pattern was observed, with well-defined clades for all major groups. H. contortus grouped with C. elegans (BS = 100), Ancylostoma caninum (BS = 100), and Toxocara canis (BS = 100), confirming conservation of fem-1 in sexual differentiation processes of free-living and parasitic nematodes (Figure 9). In vertebrates, mammalian sequences were strongly supported (BS = 100 for Ovis aries and Capra hircus), suggesting possible roles of fem-1 in the parasite–host interaction (Figure 9).
For sdc-2, the phylogenetic tree also revealed distinct clades for arthropods, nematodes, trematodes, fish, reptiles, birds, and mammals. H. contortus clustered with C. elegans (BS = 92), supporting functional conservation of sdc-2 in developmental regulation, including X-chromosome dosage compensation during sexual differentiation (Figure 10). However, moderate support was obtained for Trichinella spiralis (BS = 56), indicating incomplete conservation of sdc-2 among nematodes. In vertebrates, mammalian sequences showed high support, particularly Ovis aries (BS = 96) (Figure 10).

4. Discussion

Haemonchosis caused by H. contortus is a globally recognized disease due to its pathogenicity in sheep and goats, although it has also been documented in other ruminants such as cattle, deer, antelopes, and camelids. This parasite represents a major challenge to the livestock industry because of the severe economic losses it causes. It is estimated that H. contortus is responsible for global losses exceeding USD 1.3 billion, associated with decreased animal productivity (e.g., weight gain, meat and milk production), management costs, anthelmintic treatments, and mortality [18]. Control currently relies mainly on the use of anthelmintics; however, their intensive and indiscriminate use has resulted in the widespread emergence of resistance among gastrointestinal nematode populations [19]. This situation highlights the urgent need for alternative, sustainable, and specific control strategies that do not rely solely on anthelmintics. A deeper understanding of the biology of H. contortus, particularly essential processes such as development, reproduction, and sexual differentiation, may offer new opportunities for control. Sexual differentiation is of particular interest given the parasite’s life cycle and infective capacity: adult females can produce 1,000–5,000 eggs per day, which are shed into the environment through feces, contaminating pastures and perpetuating infection [20]. Understanding the mechanisms underlying sexual differentiation could therefore provide strategies to interfere with reproduction and persistence of the parasite in animal production systems.
In free-living nematodes such as C. elegans, several genes have been shown to play key roles in sexual differentiation, acting within highly conserved regulatory cascades [21]. However, in H. contortus these genes remain poorly characterized, and their functions in the dynamics of parasitism are largely unknown. Characterizing the presence, expression, and structure of genes associated with sexual differentiation—such as daf-12, fem-1, and sdc-2—provides valuable insights not only into the basic biology of H. contortus, but also into the identification of potential molecular targets for novel antiparasitic therapies or reproductive control strategies.
In C. elegans, daf-12 encodes a nuclear receptor belonging to the steroid hormone receptor family. It plays a central role in the dafachronic acid-mediated signaling pathway, regulating crucial developmental processes such as diapause, reproductive transitions, and longevity [22,23]. Orthologous sequences identified in H. contortus revealed conserved functional domains, particularly the ligand-binding domain (LBD) and the DNA-binding domain (DBD) [24], suggesting functional conservation despite parasitic adaptations. Molecular analyses confirmed the presence and expression of daf-12. Amplicons of different sizes were obtained: 660 bp from genomic DNA and 61 bp from cDNA, differences consistent with intron–exon organization. Relative expression analysis revealed high expression in infective L3 (67%), but markedly lower levels in adult males (17%) and females (1%). This stage-dependent regulation aligns with the infective role of L3 and with observations in C. elegans, where daf-12 controls developmental arrest and latency exit [22,25]. Structural modeling using AlphaFold revealed a compact α-helical core typical of nuclear receptors, validated by SAVES with an Overall Quality Factor of 94.76% and favorable stereochemical parameters. Phylogenetic analysis further confirmed strong clustering of H. contortus with other nematodes, supported by high bootstrap values, while vertebrate orthologs diverged functionally, including homologs such as the vitamin D receptor and bile acid receptor [26,27]. Collectively, these findings highlight daf-12 as a key regulator of development and sexual differentiation in H. contortus and a potential molecular target for novel control strategies.
In C. elegans, fem-1 is essential for male sexual determination. It promotes degradation of the transcription factor TRA-1 via the ubiquitin–proteasome pathway in association with FEM-2 and FEM-3, thereby enabling male development and spermatogenesis [28,29]. The ortholog identified in H. contortus exhibited strong similarity with C. elegans FEM-1, particularly within ankyrin repeat domains, key for protein–protein interactions [30]. PCR confirmed both presence and expression of fem-1, with amplicons of 154 bp from genomic DNA and 81 bp from cDNA, again reflecting intron–exon structure. Expression analysis revealed sex- and stage-dependent patterns: subexpression in L3 (43%), higher expression in adult females (52%), and a relative overexpression in adult males (40%). This expression profile is consistent with a conserved role in male sexual differentiation, as reported in C. elegans. Structural predictions revealed an ankyrin repeat-rich α-helical protein with high-confidence regions, validated by SAVES (Overall Quality Factor 76.79%) and PROCHECK stereochemistry analyses. Phylogenetic analysis placed H. contortus within a well-supported nematode clade alongside C. elegans and other parasites, indicating evolutionary conservation of fem-1 functions. In vertebrates, orthologs were more divergent and associated with broader roles such as apoptosis and neuronal development [31]. Overall, fem-1 appears to play a conserved role in male differentiation and reproductive processes in nematodes, making it a promising target for antiparasitic interventions.
In the case of sdc-2 in C. elegans has dual functions in female sex determination and dosage compensation in XX individuals, initiating assembly of the dosage compensation complex (DCC) and repressing her-1 to promote female development [32,33]. In H. contortus, an ortholog was identified, suggesting partial conservation of dosage compensation and sexual regulation mechanisms. PCR confirmed presence and expression of sdc-2, with amplicons of 469 bp from genomic DNA and 74 bp from cDNA, consistent with intron–exon differences. Expression analysis revealed low levels in L3 (28%) and males (44%), but significant overexpression in females (27%), in agreement with its role in sex determination and X-chromosome regulation. Structural modeling predicted an α-helical protein core with flexible terminal regions, validated by SAVES (Overall Quality Factor 86.24%) and PROCHECK analysis, indicating a reliable structural model. Phylogenetic analysis grouped H. contortus with C. elegans and Trichinella spiralis within a conserved nematode clade, while arthropods, trematodes, and vertebrates formed distinct clades. Notably, vertebrate orthologs showed divergent functions, including roles in transcriptional regulation, angiogenesis, and even tumor invasiveness [34,35]. These results suggest that while sdc-2 retains core regulatory functions in nematodes, its role has diversified in vertebrates.
Together, these findings confirm that daf-12, fem-1, and sdc-2 play crucial and conserved roles in the sexual differentiation and development of H. contortus. Their evolutionary conservation among nematodes, combined with structural and expression analyses, underscores their importance in reproductive regulation. Importantly, these genes represent promising molecular targets for developing novel strategies to disrupt parasite reproduction and control haemonchosis in livestock.

5. Conclusions

This study confirmed the presence and expression of daf-12, fem-1, and sdc-2 in H. contortus, with stage- and sex-specific expression patterns consistent with their described roles in C. elegans. Structural modeling and validation confirmed conserved functional domains, while phylogenetic analyses revealed strong evolutionary conservation among nematodes and divergence from other phyla. These findings underscore the importance of these genes in the development and reproduction of H. contortus and support their potential as molecular targets for novel antiparasitic strategies.

Author Contributions

Conceptualization, V.H.D.R.A. and H.A.D.; methodology, V.H.D.R.A., S.M.O., I.G.D.E., Y.A.C., H.A.D., F.A.H., M.R.C.P. and C.C.V.; validation, V.H.D.R.A., S.M.O., I.G.D.E., Y.A.C., H.A.D., F.A.H., M.R.C.P and C.C.V.; formal analysis, V.H.D.R.A., S.M.O., Y.A.C., H.A.D. and F.A.H.; investigation, V.H.D.R.A., S.M.O., I.G.D.E., Y.A.C., H.A.D., F.A.H., M.R.C.P. and C.C.V.; resources, V.H.D.R.A.; data curation, V.H.D.R.A., Y.A.C. and H.A.D.; writing—original draft preparation, V.H.D.R.A. and S.M.O.; writing—review and editing, V.H.D.R.A., S.M.O., I.G.D.E., Y.A.C., H.A.D., F.A.H., M.R.C.P and C.C.V.; visualization, V.H.D.R.A., and H.A.D.; supervision, V.H.D.R.A., Y.A.C. and H.A.D.; project administration, V.H.D.R.A.; funding acquisition, V.H.D.R.A. and F.A.H. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Grant IA-207023 from Programa de Apoyo a Proyectos de Investigación e Innovación Tecnológica, (PAPIIT), Dirección General de Asuntos del Personal Académico, (DGAPA), Universidad Nacional Autónoma de México, (UNAM) to Víctor Hugo Del Río- Araiza, and by Grant PAPIIT IN-215324 to Fernando Alba-Hurtado.

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The datasets generated and analyzed during the current study are included in the present manuscript. Furthermore, they are available from the corresponding author on request.

Acknowledgments

The authors wish to thank Maria Eugenia López Arellano, from CENID-SAI, INIFAP, for providing the adult Haemonchus contortus parasites. We also thank the Secretaría de Ciencia, Humanidades, Tecnología e Innovación (SECIHTI) for supporting this research through graduate scholarships awarded to Selina Montes de Oca-Lagunas and Melodía Rubí Castro-Pérez.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
DNA Deoxyribonucleic Acid
cDNA Complementary DNA
gDNA Genomic DNA
RNA Ribonucleic Acid
mRNA Messenger RNA
BLASTn Basic Local Alignment Search Tool nucleotide
BLASTp Basic Local Alignment Search Tool protein
BS Bootstrap
DCC Dosage Compensation Complex
daf-12 Dauer formation 12
DBD DNA-Binding Domain
fem-1 Feminization-1
GSD Genetic Sex Determination
L3 Larval stage 3
PCR Polymerase Chain Reaction
PBS Phosphate-Buffered Saline
sdc-1 Sex Determination and Dosage Compensation-1
SOD Superoxide Dismutase
Tm Melting Temperature

Appendix A

Appendix A.1. Accession Data of the Sequences Used for the Phylogenetic Analysis of DAF-12

Accession number Species Protein Data base
XP 0539946974.1 Anastrepha ludens Nuclear hormone receptor HR96 NCBI
NP 524493.1 Drosophila melanogaster Hormone receptor-like in 96 NCBI
XP 037952769.1 Teleopsis dalmanni Nuclear hormone receptor HR96-like NCBI
XP 030369834.1 Scaptodrosophila lebanonensis Nuclear hormone receptor HR96 isoform X1 NCBI
KAH8407185.1 Zaprionus bogoriensis Nuclear hormone receptor HR96 isoform X1 NCBI
XP 013110462.2 Stomoxys calcitrans Nuclear hormone receptor HR96 NCBI
AEC03603.1 Musca domestica Nuclear receptor HR96 NCBI
XP 065371768.1 Calliphora vicina Nuclear hormone receptor HR96 NCBI
KNC27967.1 Lucilia cuprina Nuclear hormone receptor HR96 NCBI
XP 001981892.1 Drosophila erecta Nuclear hormone receptor HR96 NCBI
XP 016036188.1 Drosophila simulans Nuclear hormone receptor HR96 NCBI
XP 033163627.1 Drosophila mauritiana Nuclear hormone receptor HR96 NCBI
XP 037570853.1 Dermacentor silvarum Vitamin D3 receptor NCBI
XP 037523479.1 Rhipicephalus sanguineus Vitamin D3 receptor isoform X1 NCBI
XP 037286542.1 Rhipicephalus microplus Vitamin D3 receptor-like NCBI
XP 003748267.1 Galendromus occidentalis Vitamin D3 receptor NCBI
KAK5968683.1 Trichostrongylus colubriformis Nuclear receptor subfamily 6 group A member 1 NCBI
XSG12237.1 Toxocara canis Nuclear hormone receptor DAF-12, partial NCBI
ALF38191.1 Anisakis simplex Nuclear hormone receptor, partial NCBI
KHJ95871.1 Oesophagostomum dentatum Ligand-binding domain of nuclear hormone receptor, partial NCBI
NP 001041239.1 Caenorhabditis elegans Nuclear hormone receptor family member daf-12 NCBI
KJH46651.1 Dictyocaulus viviparus Zinc finger, C4 type NCBI
KAK6030423.1 Ostertagia ostertagi Zinc finger, C4 type NCBI
QEA03487.1 Haemonchus contortus Nuclear hormone receptor DAF-12 NCBI
KAG5443350.1 Clonorchis sinensis Nuclear hormone receptor member daf-12 NCBI
XP 035587464.2 Schistosoma haematobium Nuclear hormone receptor, partial NCBI
TPP66369.1 Fasciola gigantica Nuclear hormone receptor HR96 NCBI
THD27323.1 Fasciola hepatica Nuclear hormone receptor HR96 NCBI
KAF8568779.1 Paragonimus westermani Nuclear hormone receptor, partial NCBI
KAH9283862.1 Echinococcus granulosus Nuclear hormone receptor family member daf-12 NCBI
KAL5964423.1 Taenia solium Nuclear hormone receptor family member daf-12 NCBI
CDS25950.1 Hymenolepis microstoma Nuclear hormone receptor HR96 NCBI
CDS43059.1 Echinococcus multilocularis Nuclear hormone receptor HR96 NCBI
XP 040281812.1 Bufo bufo Vitamin D3 receptor isoform X1 NCBI
XP 040196717.1 Rana temporaria Vitamin D3 receptor isoform X1 NCBI
XP 002935703.1 Xenopus tropicalis Vitamin D3 receptor NCBI
XP 044143545.1 Bufo gargarizans Vitamin D3 receptor NCBI
XP 033795349.1 Geotrypetes seraphini Vitamin D3 receptor NCBI
XP 069509284.1 Ambystoma mexicanum Vitamin D3 receptor isoform X1 NCBI
XP 072262732.1 Pyxicephalus adspersus Vitamin D3 receptor NCBI
XP 030054021.1 Microcaecilia unicolor Vitamin D3 receptor NCBI
XP 029450950.1 Rhinatrema bivittatum Vitamin D3 receptor isoform X1 NCBI
XP 007240874.1 Astyanax mexicanus Vitamin D3 receptor A NCBI
XP 026775925.1 Pangasianodon hypophthalmus Vitamin D3 receptor A NCBI
NP 570994.1 Danio rerio Vitamin D3 receptor A NCBI
XP 028855014.1 Denticeps clupeoides Vitamin D3 receptor NCBI
XP 014868079.1 Poecilia mexicana Vitamin D3 receptor NCBI
XP 020468294.1 Monopterus albus Vitamin D3 receptor NCBI
NP 001121989.1 Oryzias latipes Vitamin D3 receptor NCBI
W5PWT0 Ovis aries Bile acid receptor Swiss-Prot
Q96RI1 Homo sapiens Bile acid receptor Swiss-Prot
Q60641 Mus musculus Bile acid receptor Swiss-Prot
Q3SZL0 Bos taurus Bile acid receptor Swiss-Prot
A0A8D0VZF6 Sus scrofa Nuclear receptor subfamily 1 group H member 4 Swiss-Prot
A0A452FGV9 Capra hircus Nuclear receptor subfamily 1 group H member 4 Swiss-Prot
A0A0G2K6D2 Rattus norvegicus Nuclear receptor subfamily 1, group H, member 4 Swiss-Prot

Appendix A.2. Accession Data of the Sequences Used for the Phylogenetic Analysis of FEM-1

Accession number Species Protein Data base
NP 611508.1 Drosophila melanogaster Fem-1, isoform A NCBI
XP 047115103.1 Schistocerca piceifrons Protein fem-1 homolog B NCBI
XP 063885865.1 Scylla paramamosain Protein fem-1 homolog B-like isoform X1 NCBI
XP 001654238.1 Aedes aegypti Protein fem-1 homolog B-like isoform X1 NCBI
XP 023933934.1 Bicyclus anynana Protein fem-1 homolog B-like isoform X1 NCBI
XP 011202197.2 Bactrocera dorsalis Protein fem-1 homolog B-like isoform X1 NCBI
XP 002138527.2 Drosophila pseudoobscura Protein fem-1 homolog B-like isoform X1 NCBI
XP 050712882.1 Eriocheir sinensis Protein fem-1 homolog B-like isoform X1 NCBI
XP 036330667.1 Rhagoletis pomonella Protein fem-1 homolog B-like isoform X1 NCBI
XP 031341515.1 Photinus pyralis Protein fem-1 homolog B NCBI
XP 061507539.1 Anopheles gambiae Protein fem-1 homolog B NCBI
XP 022128557.1 Pieris rapae Protein fem-1 homolog B-like isoform X1 NCBI
XP 019768800.1 Dendroctonus ponderosae Protein fem-1 homolog B-like isoform X1 NCBI
XP 023012557.1 Leptinotarsa decemlineata Protein fem-1 homolog B-like isoform X1 NCBI
XP 049701068.1 Helicoverpa armigera Protein fem-1 homolog B-like isoform X1 NCBI
XP 068896437.1 Tenebrio molitor Protein fem-1 homolog B-like isoform X1 NCBI
XP 050044960.1 Dermacentor andersoni Protein fem-1 homolog B NCBI
XP 037563812.1 Dermacentor silvarum Protein fem-1 homolog B NCBI
XP 037511638.1 Rhipicephalus sanguineus Protein fem-1 homolog B NCBI
XP 037291813.1 Rhipicephalus microplus Protein fem-1 homolog B-like NCBI
XP 022670278.1 Varroa destructor Protein fem-1 homolog B-like isoform X1 NCBI
XGW30566.1 Haemonchus contortus Protein fem-1 homolog B NCBI
KAK5970382.1 Trichostrongylus colubriformis Sex-determining protein fem-1 NCBI
RCN43014.1 Ancylostoma caninum Ankyrin repeat protein NCBI
KJH51017.1 Dictyocaulus viviparus Ankyrin repeat protein NCBI
KAK6025858.1 Ostertagia ostertagi Ankyrin repeat protein NCBI
KHN80228.1 Toxocara canis Sex-determining protein fem-1 NCBI
PIO65957.1 Teladorsagia circumcincta Ankyrin repeat protein NCBI
MCP9265608.1 Dirofilaria immitis Protein fem-1 NCBI
NP 500824.1 Caenorhabditis elegans Sex-determining protein fem-1 NCBI
THD25860.1 Fasciola hepatica Protein fem-1 NCBI
KAA0198803.1 Fasciolopsis buskii Fem-1 A NCBI
TPP64208.1 Fasciola gigantica Protein fem-1 NCBI
KAG5441328.1 Clonorchis sinensis Protein fem-1 C NCBI
TNN08969.1 Schistosoma japonicum Protein fem-1 NCBI
XP 035585568.1 Schistosoma haematobium Protein fem-1 C NCBI
XP 018647049.1 Schistosoma mansoni Sex-determining protein fem-1 NCBI
KAH9279482.1 Echinococcus granulosus Protein fem-1 -like protein C NCBI
CDS43292.1 Echinococcus multilocularis Sex-determining protein fem-1 NCBI
KAL5961090.1 Taenia solium Sex-determining protein fem-1 NCBI
CDS26165.1 Hymenolepis microstoma Sex-determining protein fem-1 NCBI
XP 005722081.1 Pundamilia nyererei Protein fem-1 homolog C NCBI
XP 003446110.1 Oreochromis niloticus Protein fem-1 homolog C NCBI
XP 006789826.1 Neolamprologus brichardi Protein fem-1 homolog C NCBI
XP 015828271.1 Nothobranchius furzeri Protein fem-1 homolog C NCBI
XP 013870593.1 Austrofundulus limnaeus Protein fem-1 homolog C-like NCBI
XP 064901447.1 Columba livia Protein fem-1 homolog C isoform X1 NCBI
XP 065717267.1 Patagioenas fasciata Protein fem-1 homolog C NCBI
XP 065513711.1 Caloenas nicobarica Protein fem-1 homolog C NCBI
NXK13339.1 Herpetotheres cachinnans FEM1C protein Swiss-Prot
XP 072716475.1 Ciconia boyciana Protein fem-1 homolog C NCBI
NXV77506.1 Atlantisia rogersi FEM1C protein, partial NCBI
XP 027827254.2 Ovis aries Protein fem-1 homolog C NCBI
XP 017909215.1 Capra hircus Protein fem-1 homolog C isoform X1 NCBI
P0C6P7 Rattus norvegicus Protein fem-1 homolog B Swiss-Prot
A0A2I3SXM4 Pan troglodytes Fem-1 homolog B Swiss-Prot
G7MY25_MACMU Macaca mulatta FEM1B Swiss-Prot
I3L6T4 Sus scrofa Fem-1 homolog B Swiss-Prot
A0A8C0K439 Canis lupus dingo Fem-1 homolog B NCBI
A0A8C9P293_SPEDA Spermophilus dauricus Fem-1 homolog B Swiss-Prot
NP 001039691.1 Bos taurus Protein fem-1 homolog A NCBI
Q9Z2G0 Mus musculus Protein fem-1 homolog B Swiss-Prot
Q9UK73 Homo sapiens Protein fem-1 homolog B Swiss-Prot

Appendix A.3. Accession Data of the Sequences Used for the Phylogenetic Analysis of SDC-2

Accession number Species Protein Data base
XP 050040600.1 Dermacentor andersoni Syndecan 3 NCBI
XP 037507833.1 Rhipicephalus sanguineus Syndecan-like NCBI
XP 037507832.1 Rhipicephalus sanguineus Syndecan NCBI
XP 037570033.1 Dermacentor silvarum Syndecan-like NCBI
XP 065291937.1 Dermacentor albipictus Syndecan-like NCBI
CDJ84099.1 Haemonchus contortus CBN-SDC-2 protein NCBI
NP 509924.1 Caenorhabditis elegans Sex determination and dosage compensation protein sdc-2 NCBI
XP 003379719.1 Trichinella spiralis Syndecan-2 NCBI
CAH8611371.1 Schistosoma bovis Syndecan NCBI
KAH8873224.1 Schistosoma japonicum Syntenin-2 (Syndecan-binding protein 2) NCBI
XP 018653325.1 Schistosoma mansoni Putative syntenin-2 (Syndecan-binding protein 2) NCBI
CAH8865890.1 Trichobilharzia regenti Syndecan NCBI
XP 062265467.1 Platichthys flesus Syndecan-2 NCBI
XP 036793385.1 Oncorhynchus mykiss Syndecan-2 isoform X1 NCBI
XP 067257318.1 Chanodichthys erythropterus Syndecan-2-A-like isoform X1 NCBI
XP 053302077.1 Pleuronectes platessa Syndecan-2 NCBI
XP 060948873.1 Limanda limanda Syndecan-2 NCBI
XP 034455044.1 Hippoglossus hippoglossus Syndecan-2 NCBI
XP 028255454.1 Parambassis ranga Syndecan-2-A-like NCBI
XP 037748165.1 Chelonia mydas Syndecan-2-A-like isoform X1 NCBI
XP 038247599.1 Dermochelys coriacea Syndecan-2-A-like isoform X2 NCBI
XP 044859986.1 Mauremys mutica Syndecan-2 NCBI
XP 053874007.1 Malaclemys terrapin pileata Syndecan-2 NCBI
XP 039382872.1 Mauremys reevessi Syndecan-2 NCBI
NP 001001462.2 Gallus gallus Syndecan-2 precursor NCBI
XP 015711411.1 Coturnix japonica Syndecan-2 NCBI
XP 021243681.1 Numida meleagris Syndecan-2 NCBI
NP 001290149.1 Meleagris gallopavo Syndecan-2 precursor NCBI
XP 005042472.1 Ficedula albicollis Syndecan-2 NCBI
XP 042665043.1 Centrocercus urophasianus Syndecan-2 NCBI
XP 065609569.1 Cyrtonyx montezumae Syndecan-2 NCBI
XP 014953400.1 Ovis aries Syndecan-2-A-like isoform X1 NCBI
NP 001029960.2 Bos taurus Syndecan-2 precursor NCBI
NP 032330.1 Mus musculus Syndecan-2 precursor NCBI
NP 037214.1 Rattus norvegicus Syndecan-2 precursor NCBI
NP 001247893.1 Macaca mulatta Syndecan-2 precursor NCBI
NP 001302683.1 Sus scrofa Syndecan-2 precursor NCBI
NP 002989.2 Homo sapiens Syndecan-2 precursor NCBI

References

  1. Arsenopoulos, K. V.; Fthenakis, G.C.; Katsarou, E.I.; Papadopoulos, E. Haemonchosis: A Challenging Parasitic Infection of Sheep and Goats. Anim. 2021, Vol. 11, Page 363 2021, 11, 363. [Google Scholar] [CrossRef]
  2. Naeem, M.; Iqbal, Z.; Roohi, N. Ovine Haemonchosis: A Review. Trop. Anim. Health Prod. 2020, 53, 1–12. [Google Scholar] [CrossRef]
  3. Goodwin, E.B.; Ellis, R.E. Turning Clustering Loops: Sex Determination in Caenorhabditis Elegans. Curr. Biol. 2002, 12, R111–R120. [Google Scholar] [CrossRef]
  4. Kageyama, D. Sex Determination, Insects. Encycl. Reprod. Vol. 1-6, Second Ed. 2018, 6, 198–203. [Google Scholar] [CrossRef]
  5. Forger, N.G.; de Vries, G.J. Cell Death and Sexual Differentiation of Behavior: Worms, Flies, and Mammals. Curr. Opin. Neurobiol. 2010, 20, 776–783. [Google Scholar] [CrossRef] [PubMed]
  6. Foster, J.M.; Grote, A.; Mattick, J.; Tracey, A.; Tsai, Y.C.; Chung, M.; Cotton, J.A.; Clark, T.A.; Geber, A.; Holroyd, N.; et al. Sex Chromosome Evolution in Parasitic Nematodes of Humans. Nat. Commun. 2020 111 2020, 11, 1–12. [Google Scholar] [CrossRef] [PubMed]
  7. Pires-daSilva, A. Evolution of the Control of Sexual Identity in Nematodes. Semin. Cell Dev. Biol. 2007, 18, 362–370. [Google Scholar] [CrossRef]
  8. Hansen, D.; Pilgrim, D. Sex and the Single Worm: Sex Determination in the Nematode C. Elegans. Mech. Dev. 1999, 83, 3–15. [Google Scholar] [CrossRef]
  9. Shinya, R.; Sun, S.; Dayi, M.; Tsai, I.J.; Miyama, A.; Chen, A.F.; Hasegawa, K.; Antoshechkin, I.; Kikuchi, T.; Sternberg, P.W. Possible Stochastic Sex Determination in Bursaphelenchus Nematodes. Nat. Commun. 2022, 13. [Google Scholar] [CrossRef]
  10. Wolff, J.R.; Zarkower, D. Somatic Sexual Differentiation in Caenorhabditis Elegans. Curr. Top. Dev. Biol. 2008, 83, 1–39. [Google Scholar] [CrossRef]
  11. Meng, K.; Shi, Y.C.; Li, W.X.; Wang, J.; Cheng, B.J.; Li, T.L.; Li, H.; Jiang, N.; Liu, R. Testosterone Mediates Reproductive Toxicity in Caenorhabditis Elegans by Affecting Sex Determination in Germ Cells through Nhr-69/ Mpk-1/ Fog-1/ 3. Toxics 2024, 12. [Google Scholar] [CrossRef]
  12. Ellis, R.E. Sex Determination in Nematode Germ Cells. Sex Dev. 2022, 16, 305–322. [Google Scholar] [CrossRef] [PubMed]
  13. Redman, E.; Grillo, V.; Saunders, G.; Packard, E.; Jackson, F.; Berriman, M.; Gilleard, J.S. Genetics of Mating and Sex Determination in the Parasitic Nematode Haemonchus Contortus. Genetics 2008, 180, 1877–1887. [Google Scholar] [CrossRef] [PubMed]
  14. Sallé, G.; Doyle, S.R.; Cortet, J.; Cabaret, J.; Berriman, M.; Holroyd, N.; Cotton, J.A. The Global Diversity of Haemonchus Contortus Is Shaped by Human Intervention and Climate. Nat. Commun. 2019, 10. [Google Scholar] [CrossRef] [PubMed]
  15. Doyle, S.R.; Tracey, A.; Laing, R.; Holroyd, N.; Bartley, D.; Bazant, W.; Beasley, H.; Beech, R.; Britton, C.; Brooks, K.; et al. Genomic and Transcriptomic Variation Defines the Chromosome-Scale Assembly of Haemonchus Contortus, a Model Gastrointestinal Worm. Commun. Biol. 2020, 3, 656. [Google Scholar] [CrossRef]
  16. Zheng, Y.; Young, N.D.; Wang, T.; Chang, B.C.H.; Song, J.; Gasser, R.B. Systems Biology of Haemonchus Contortus – Advancing Biotechnology for Parasitic Nematode Control. Biotechnol. Adv. 2025, 81. [Google Scholar] [CrossRef]
  17. Huynh, T.; McKean, E.L.; Hawdon, J.M. Mini-Baermann Funnel, a Simple Device for Cleaning Nematode Infective Larvae. J. Parasitol. 2022, 108, 403–407. [Google Scholar] [CrossRef]
  18. Brinzer, R.A.; McIntyre, J.R.; Britton, C.; Laing, R. The Parasitic Nematode Haemonchus Contortus Lacks Molybdenum Cofactor Synthesis, Leading to Sulphite Sensitivity and Lethality in Vitro. Int. J. Parasitol. 2025, 55, 117–128. [Google Scholar] [CrossRef]
  19. Tuerhong, R.; Tuersong, W.; Maimaiti, A.; Maimaitiyiming, H.; Zhang, Y.; Xuekelaiti, D.; Tuoheti, A.; Xin, L.; Abula, S. Genetic Diversity Analysis of Benzimidazole Resistance-Associated Genes in Haemonchus Contortus from Four Regions in Southern Xinjiang. Vet. Parasitol. 2025, 336, 110426. [Google Scholar] [CrossRef]
  20. Okino, C.H.; Bello, H.J.S.; Niciura, S.C.M.; Melito, G.R.; Cunha, A.F. da; Costa, E.C. da; de Campos, E.M.; Kapritchkoff, R.T.I.; Minho, A.P.; Esteves, S.N.; et al. Haemonchus Contortus Parasitic Stages Development and Host Immune Responses in Lambs of Different Sheep Breeds. Vet. Immunol. Immunopathol. 2025, 284, 110936. [Google Scholar] [CrossRef]
  21. Zarkower, D. Somatic Sex Determination. WormBook 2006, 1–12. [Google Scholar] [CrossRef]
  22. Antebi, A.; Yeh, W.H.; Tait, D.; Hedgecock, E.M.; Riddle, D.L. Daf-12 Encodes a Nuclear Receptor That Regulates the Dauer Diapause and Developmental Age in C. Elegans. Genes Dev. 2000, 14, 1512. [Google Scholar] [CrossRef]
  23. Antebi, A. Nuclear Receptor Signal Transduction in C. Elegans. Wormbook 2015, 1. [Google Scholar] [CrossRef] [PubMed]
  24. Blum, M.; Chang, H.Y.; Chuguransky, S.; Grego, T.; Kandasaamy, S.; Mitchell, A.; Nuka, G.; Paysan-Lafosse, T.; Qureshi, M.; Raj, S.; et al. The InterPro Protein Families and Domains Database: 20 Years On. Nucleic Acids Res. 2021, 49, D344–D354. [Google Scholar] [CrossRef] [PubMed]
  25. Ma, G.; Wang, T.; Korhonen, P.K.; Young, N.D.; Nie, S.; Ang, C.S.; Williamson, N.A.; Reid, G.E.; Gasser, R.B. Dafachronic Acid Promotes Larval Development in Haemonchus Contortus by Modulating Dauer Signalling and Lipid Metabolism. PLoS Pathog. 2019, 15. [Google Scholar] [CrossRef] [PubMed]
  26. Mcdonnell, D.P.; Mangelsdorf, D.J.; Pike, J.W.; Haussler, M.R.; O’Malley, B.W. Molecular Cloning of Complementary DNA Encoding the Avian Receptor for Vitamin D. Science (80-. ). 1987, 235, 1214–1217. [Google Scholar] [CrossRef]
  27. Makishima, M.; Okamoto, A.Y.; Repa, J.J.; Tu, H.; Learned, R.M.; Luk, A.; Hull, M. V.; Lustig, K.D.; Mangelsdorf, D.J.; Shan, B. Identification of a Nuclear Receptor for Bile Acids. Science (80-. ). 1999, 284, 1362–1365. [Google Scholar] [CrossRef]
  28. Doniach, T.; Hodgkin, J. A Sex-Determining Gene, Fem-1, Required for Both Male and Hermaphrodite Development in Caenorhabditis Elegans. Dev. Biol. 1984, 106, 223–235. [Google Scholar] [CrossRef]
  29. Spence, A.M.; Coulson, A.; Hodgkin, J. The Product of Fem-1, a Nematode Sex-Determining Gene, Contains a Motif Found in Cell Cycle Control Proteins and Receptors for Cell-Cell Interactions. Cell 1990, 60, 981–990. [Google Scholar] [CrossRef]
  30. Mehra, A.; Gaudet, J.; Heck, L.; Kuwabara, P.E.; Spence, A.M. Negative Regulation of Male Development in Caenorhabditis Elegans by a Protein-Protein Interaction between TRA-2A and FEM-3. Genes Dev. 1999, 13, 1453–1463. [Google Scholar] [CrossRef]
  31. Ventura-Holman, T.; Lu, D.; Si, X.; Izevbigie, E.B.; Maher, J.F. The Fem1c Genes: Conserved Members of the Fem1 Gene Family in Vertebrates. Gene 2003, 314, 133–139. [Google Scholar] [CrossRef]
  32. Dawes, H.E.; Berlin, D.S.; Lapidus, D.M.; Nusbaum, C.; Davis, T.L.; Meyer, B.J. Dosage Compensation Proteins Targeted to X Chromosomes by a Determinant of Hermaphrodite Fate. Science (80-. ). 1999, 284, 1800–1804. [Google Scholar] [CrossRef]
  33. Meyer, B.J. Targeting X Chromosomes for Repression. Curr. Opin. Genet. Dev. 2010, 20, 179–189. [Google Scholar] [CrossRef]
  34. Chen, E.; Hermanson, S.; Ekker, S.C. Syndecan-2 Is Essential for Angiogenic Sprouting during Zebrafish Development. Blood 2004, 103, 1710–1719. [Google Scholar] [CrossRef]
  35. Tsoyi, K.; Osorio, J.C.; Chu, S.G.; Fernandez, I.E.; De Frias, S.P.; Sholl, L.; Cui, Y.; Tellez, C.S.; Siegfried, J.M.; Belinsky, S.A.; et al. Lung Adenocarcinoma Syndecan-2 Potentiates Cell Invasiveness. Am. J. Respir. Cell Mol. Biol. 2019, 60, 659–666. [Google Scholar] [CrossRef]
Figure 1. Endpoint PCR detection of daf-12 (660 bp), sdc-2 (469 bp), and fem-1 (154 bp) in the H. contortus genome. C1: sdc-2; C2: daf-12; C 3: fem-1.
Figure 1. Endpoint PCR detection of daf-12 (660 bp), sdc-2 (469 bp), and fem-1 (154 bp) in the H. contortus genome. C1: sdc-2; C2: daf-12; C 3: fem-1.
Preprints 181216 g001
Figure 2. RT-PCR for daf-12. (a) Relative expression of the daf-12 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H.contortus. (b) Optical densitometric analysis of daf-12. Statistical analysis using ANOVA revealed significant differences, indicated with **(p ≤ 0.01) and ***(p ≤ 0.001).
Figure 2. RT-PCR for daf-12. (a) Relative expression of the daf-12 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H.contortus. (b) Optical densitometric analysis of daf-12. Statistical analysis using ANOVA revealed significant differences, indicated with **(p ≤ 0.01) and ***(p ≤ 0.001).
Preprints 181216 g002
Figure 3. RT-PCR for fem-1. (a) Relative expression of the fem-1 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H.contortus. (b) Optical densitometric analysis of fem-1. Statistical analysis using ANOVA revealed significant differences, indicated with ***(p ≤ 0.001) and ****(p ≤ 0.0001).
Figure 3. RT-PCR for fem-1. (a) Relative expression of the fem-1 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H.contortus. (b) Optical densitometric analysis of fem-1. Statistical analysis using ANOVA revealed significant differences, indicated with ***(p ≤ 0.001) and ****(p ≤ 0.0001).
Preprints 181216 g003
Figure 4. RT-PCR for sdc-2. (a) Relative expression of the sdc-2 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H. contortus. (b) Optical densitometric analysis of sdc-2. Statistical analysis using ANOVA revealed significant differences, indicated with *(p ≤ 0.05) and **(p ≤ 0.01).
Figure 4. RT-PCR for sdc-2. (a) Relative expression of the sdc-2 gene using the constitutive gene sod as control. The figure shows agarose gel electrophoresis with a 50 bp molecular weight marker (MPM). Samples correspond to third-stage larvae (L3), adult males, and adult females of H. contortus. (b) Optical densitometric analysis of sdc-2. Statistical analysis using ANOVA revealed significant differences, indicated with *(p ≤ 0.05) and **(p ≤ 0.01).
Preprints 181216 g004
Figure 5. In silico 3D model of DAF-12 predicted by AlphaFold and its structural validation. (a) The model displays a well-defined α-helical core (navy blue) with high confidence in the structural prediction (pLDDT > 90), while orange-colored termini indicate lower confidence regions (pLDDT < 50), likely corresponding to flexible or disordered segments. (b) ERRAT yielded an overall quality factor of 94.76%, and PROCHECK Ramachandran analysis confirmed that most residues were in favored regions.
Figure 5. In silico 3D model of DAF-12 predicted by AlphaFold and its structural validation. (a) The model displays a well-defined α-helical core (navy blue) with high confidence in the structural prediction (pLDDT > 90), while orange-colored termini indicate lower confidence regions (pLDDT < 50), likely corresponding to flexible or disordered segments. (b) ERRAT yielded an overall quality factor of 94.76%, and PROCHECK Ramachandran analysis confirmed that most residues were in favored regions.
Preprints 181216 g005
Figure 6. In silico 3D model of FEM-1 predicted by AlphaFold and its structural validation. (a) The model revealed a repetitive and compact arrangement of α-helices with high confidence (pLDDT > 70), while terminal regions showed low-confidence segments (pLDDT < 50). (b) Validation with SAVES tools yielded an overall quality factor of 76.79% in ERRAT, and PROCHECK Ramachandran analysis showed 82.4% of residues in the most favored regions and 17% in additionally allowed regions.
Figure 6. In silico 3D model of FEM-1 predicted by AlphaFold and its structural validation. (a) The model revealed a repetitive and compact arrangement of α-helices with high confidence (pLDDT > 70), while terminal regions showed low-confidence segments (pLDDT < 50). (b) Validation with SAVES tools yielded an overall quality factor of 76.79% in ERRAT, and PROCHECK Ramachandran analysis showed 82.4% of residues in the most favored regions and 17% in additionally allowed regions.
Preprints 181216 g006
Figure 7. In silico 3D model of SDC-2 predicted by AlphaFold and its structural validation. (a) The model revealed a repetitive and compact arrangement of α-helices with high confidence (pLDDT > 90), while terminal regions showed low-confidence segments (pLDDT < 90-70). (b) Validation with SAVES tools yielded an overall quality factor of 86.24% in ERRAT, and PROCHECK Ramachandran analysis showed 74.8% of residues in the most favored regions and 24.5% in additionally allowed regions.
Figure 7. In silico 3D model of SDC-2 predicted by AlphaFold and its structural validation. (a) The model revealed a repetitive and compact arrangement of α-helices with high confidence (pLDDT > 90), while terminal regions showed low-confidence segments (pLDDT < 90-70). (b) Validation with SAVES tools yielded an overall quality factor of 86.24% in ERRAT, and PROCHECK Ramachandran analysis showed 74.8% of residues in the most favored regions and 24.5% in additionally allowed regions.
Preprints 181216 g007
Figure 8. Phylogenetic tree of DAF-12. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Figure 8. Phylogenetic tree of DAF-12. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Preprints 181216 g008
Figure 9. Phylogenetic tree of FEM-1. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Figure 9. Phylogenetic tree of FEM-1. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Preprints 181216 g009
Figure 10. Phylogenetic tree of SDC-2. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Figure 10. Phylogenetic tree of SDC-2. Constructed by Neighbor-Joining with 1500 bootstrap replicates using MEGA 12; bootstrap support values are shown at the nodes.
Preprints 181216 g010
Table 1. Oligonucleotides for the amplification of selected sexual differentiation genes of H. contortus.
Table 1. Oligonucleotides for the amplification of selected sexual differentiation genes of H. contortus.
Genes Sequence Forward Sequence reverse Tm (°C)
sod GCTGGCACTGATGATTTGGG CGCCAGCATTTCCTGTCTTC 62
daf-12 ATGCAAGGCGTTTTTCCGTC CGACCATCGGCGAAATTGAC 60
fem-1 GATGCGTTGAAGCTGTTGG CACGAAGGTTACGGTTTGC 60
sdc-2 CGAGTCCAGCGATTCATCCA AGCTGTCGTTTGCGTCACTA 60
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

© 2026 MDPI (Basel, Switzerland) unless otherwise stated

Accessibility

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings