Submitted:
09 June 2025
Posted:
09 June 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Histological Analysis
2.2. Gene Expression Analysis
3. Discussion
4. Materials and Methods
4.1. Ethics
4.2. Fish Origin
4.3. Experimental Setup and Sampling
4.4. RNA Extraction, cDNA Synthesis and Real-Time PCR Analysis
4.5. Histological Observations
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Esteban, M.A. An Overview of the Immunological Defenses in Fish Skin. Int. Sch. Res. Not. 2012, 2012, 853470. [Google Scholar]
- Esteban, M.Á.; Cerezuela, R. Fish Mucosal Immunity: Skin. In Mucosal Health in Aquaculture; Academic Press: 2015; pp. 67–92.
- Sveen, L.; Karlsen, C.; Ytteborg, E. Mechanical Induced Wounds in Fish – A Review on Models and Healing Mechanisms. Rev. Aquac. 2020, 12, 2446–2465. [Google Scholar] [CrossRef]
- Cordero, H.; Cuesta, A.; Meseguer, J.; Esteban, M.A. Characterization of the Gilthead Seabream (Sparus aurata L.) Immune Response under a Natural Lymphocystis Disease Virus Outbreak. J. Fish Dis. 2016, 39, 1467–1476. [Google Scholar] [CrossRef]
- Ceballos-Francisco, D.; Cordero, H.; Guardiola, F.A.; Cuesta, A.; Esteban, M.Á. Healing and Mucosal Immunity in the Skin of Experimentally Wounded Gilthead Seabream (Sparus aurata L). Fish Shellfish Immunol. 2017, 71, 210–219. [Google Scholar] [CrossRef]
- Guardiola, F.A.; Cuartero, M.; Collado-González, M.M.; Arizcún, M.; Diaz Banos, F.G.; Meseguer, J.; Esteban, M.A. Description and Comparative Study of Physico-Chemical Parameters of the Teleost Fish Skin Mucus. Biorheology 2015, 52, 247–256. [Google Scholar] [CrossRef] [PubMed]
- Jurado, J.; Fuentes-Almagro, C.A.; Guardiola, F.A.; Cuesta, A.; Esteban, M.Á.; Prieto-Álamo, M.J. Proteomic Profile of the Skin Mucus of Farmed Gilthead Seabream (Sparus aurata). J. Proteomics 2015, 120, 21–34. [Google Scholar] [CrossRef] [PubMed]
- Fontenot, D.K.; Neiffer, D.L. Wound Management in Teleost Fish: Biology of the Healing Process, Evaluation, and Treatment. Vet. Clin. Exot. Anim. Pract. 2004, 7, 57–86. [Google Scholar] [CrossRef]
- Richardson, R.; Metzger, M.; Knyphausen, P.; Ramezani, T.; Slanchev, K.; Kraus, C.; …; Hammerschmidt, M. Re-Epithelialization of Cutaneous Wounds in Adult Zebrafish Combines Mechanisms of Wound Closure in Embryonic and Adult Mammals. Development 2016, 143, 2077–2088.
- Sundin, L.; Nilsson, G.E. Acute Defense Mechanisms against Hemorrhage from Mechanical Gill Injury in Rainbow Trout. Am. J. Physiol. Regul. Integr. Comp. Physiol. 1998, 275, R460–R465. [Google Scholar] [CrossRef]
- Jensen, L.B.; Wahli, T.; McGurk, C.; Eriksen, T.B.; Obach, A.; Waagbø, R.; …; Tafalla, C. Effect of Temperature and Diet on Wound Healing in Atlantic Salmon (Salmo salar L.). Fish Physiol. Biochem. 2015, 41, 1527–1543. [CrossRef]
- Schmidt, J.G.; Andersen, E.W.; Ersbøll, B.K.; Nielsen, M.E. Muscle Wound Healing in Rainbow Trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2016, 48, 273–284. [Google Scholar] [CrossRef] [PubMed]
- Wahli, T.; Verlhac, V.; Girling, P.; Gabaudan, J.; Aebischer, C. Influence of Dietary Vitamin C on the Wound Healing Process in Rainbow Trout (Oncorhynchus mykiss). Aquaculture 2003, 225, 371–386. [Google Scholar] [CrossRef]
- Krasnov, A.; Skugor, S.; Todorcevic, M.; Glover, K.A.; Nilsen, F. Gene Expression in Atlantic Salmon Skin in Response to Infection with the Parasitic Copepod Lepeophtheirus salmonis, Cortisol Implant, and Their Combination. BMC Genomics 2012, 13, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Sveen, L.R.; Timmerhaus, G.; Krasnov, A.; Takle, H.; Stefansson, S.O.; Handeland, S.O.; Ytteborg, E. High Fish Density Delays Wound Healing in Atlantic Salmon (Salmo salar). Sci. Rep. 2018, 8, 16907. [Google Scholar] [CrossRef]
- Sveen, L.R.; Timmerhaus, G.; Krasnov, A.; Takle, H.; Handeland, S.; Ytteborg, E. Wound Healing in Post-Smolt Atlantic Salmon (Salmo salar L.). Sci. Rep. 2019, 9, 3565. [Google Scholar] [CrossRef]
- Ugelvik, M.S.; Dalvin, S. The Effect of Different Intensities of the Ectoparasitic Salmon Lice (Lepeophtheirus salmonis) on Atlantic Salmon (Salmo salar). J. Fish Dis. 2022, 45, 1133–1147. [Google Scholar] [CrossRef]
- FishBase, 2025, 〈https://fishbase.mnhn.fr/summary/Thymallus-thymallus〉(accessed 18 May 2025).
- Fopp-Bayat, D.; Kaczmarczyk, D.; Szczepkowski, M. Genetic Characteristics of Polish Whitefish (Coregonus lavaretus maraena) Broodstocks—Recommendations for the Conservation Management. Czech J. Anim. Sci. 2015, 60, 171–177. [Google Scholar] [CrossRef]
- Bochert, R.; Horn, T.; Luft, P. Maraena Whitefish (Coregonus maraena) Larvae Reveal Enhanced Growth during First Feeding with Live Artemia Nauplii. Fish. Aquat. Life 2017, 25, 3–10. [Google Scholar] [CrossRef]
- Law, M. Differential Diagnosis of Ulcerative Lesions in Fish. Environ. Health Perspect. 2001, 109 (Suppl. 5), 681–686. [Google Scholar]
- Noga, E.J. Skin Ulcers in Fish: Pfiesteria and Other Etiologies. Toxicol. Pathol. 2000, 28(6), 807–823. [Google Scholar] [CrossRef]
- Quilhac, A.; Sire, J.Y. Spreading, Proliferation, and Differentiation of the Epidermis after Wounding a Cichlid Fish, Hemichromis bimaculatus. Anat. Rec. 1999, 254(3), 435–451. [Google Scholar] [CrossRef]
- Richardson, R.; Slanchev, K.; Kraus, C.; Knyphausen, P.; Eming, S.; Hammerschmidt, M. Adult Zebrafish as a Model System for Cutaneous Wound-Healing Research. J. Investig. Dermatol. 2013, 133(6), 1655–1665. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, J.G. Wound healing in rainbow trout (Oncorhynchus mykiss) and common carp (Cyprinus carpio): with a focus on gene expression and wound imaging. Doctoral dissertation Technical University of Denmark 2013.
- Nosanchuk, J.D.; Casadevall, A. Impact of Melanin on Microbial Virulence and Clinical Resistance to Antimicrobial Compounds. Antimicrob. Agents Chemother. 2006, 50(11), 3519–3528. [Google Scholar] [CrossRef]
- Kulczykowska, E. Stress Response System in the Fish Skin—Welfare Measures Revisited. Front. Physiol. 2019, 10, 436622. [Google Scholar] [CrossRef]
- Gozdowska, M.; Sokołowska, E.; Pomianowski, K.; Kulczykowska, E. Melatonin and Cortisol as Components of the Cutaneous Stress Response System in Fish: Response to Oxidative Stress. Comp. Biochem. Physiol. A 2022, 268, 111207. [Google Scholar] [CrossRef] [PubMed]
- Gunimaladevi, I.; Savan, R.; Sakai, M. Identification, Cloning and Characterization of Interleukin-17 and Its Family from Zebrafish. Fish Shellfish Immunol. 2006, 21(4), 393–403. [Google Scholar] [CrossRef]
- Korenaga, H.; Kono, T.; Sakai, M. Isolation of Seven IL-17 Family Genes from the Japanese Pufferfish Takifugu rubripes. Fish Shellfish Immunol. 2010, 28(5–6), 809–818. [Google Scholar] [CrossRef]
- Murakami, A.; Mano, N.; Rahman, M.H.; Hirose, H. MMP-9 Is Expressed during Wound Healing in Japanese Flounder Skin. Fish. Sci. 2006, 72, 1004–1010. [Google Scholar] [CrossRef]
- Skugor, S.; Glover, K.A.; Nilsen, F.; Krasnov, A. Local and Systemic Gene Expression Responses of Atlantic Salmon (Salmo salar L.) to Infection with the Salmon Louse (Lepeophtheirus salmonis). BMC Genomics 2008, 9, 1–18. [Google Scholar] [CrossRef]
- Raja, S.K.; Garcia, M.S.; Isseroff, R.R. Wound Re-Epithelialization: Modulating Keratinocyte Migration in Wound Healing. Front. Biosci. 2007, 12(3), 2849–2868. [Google Scholar] [CrossRef] [PubMed]
- Xue, M.; Jackson, C.J. Extracellular Matrix Reorganization during Wound Healing and Its Impact on Abnormal Scarring. Adv. Wound Care 2015, 4(3), 119–136. [Google Scholar] [CrossRef] [PubMed]
- Reiss, M.J.; Han, Y.P.; Garcia, E.; Goldberg, M.; Yu, H.; Garner, W.L. Matrix Metalloproteinase-9 Delays Wound Healing in a Murine Wound Model. Surgery 2010, 147(2), 295–302. [Google Scholar] [CrossRef] [PubMed]
- Landen, N.X.; Li, D.; Ståhle, M. Transition from Inflammation to Proliferation: A Critical Step during Wound Healing. Cell. Mol. Life Sci. 2016, 73, 3861–3885. [Google Scholar] [CrossRef] [PubMed]
- Krone, P.H.; Lele, Z.; Sass, J.B. Heat Shock Genes and the Heat Shock Response in Zebrafish Embryos. Biochem. Cell Biol. 1997, 75(5), 487–497. [Google Scholar] [CrossRef]
- Iwama, G.K.; Thomas, P.T.; Forsyth, R.B.; Vijayan, M.M. Heat Shock Protein Expression in Fish. Rev. Fish Biol. Fish. 1998, 8, 35–56. [Google Scholar] [CrossRef]
- Brzuzan, P.; Woźny, M.; Ciesielski, S.; Łuczyński, M.K.; Góra, M.; Kuźmiński, H.; Dobosz, S. Microcystin-LR Induced Apoptosis and mRNA Expression of p53 and cdkn1a in Liver of Whitefish (Coregonus lavaretus L.). Toxicon 2009, 54(2), 170–183. [Google Scholar] [CrossRef]
- Mai, W.J.; Liu, P.; Wang, W. Characterization of the Tilapia p53 Gene and Its Role in Chemical-Induced Apoptosis. Biotechnol. Lett. 2012, 34, 1797–1805. [Google Scholar] [CrossRef]
- Borena, B.M.; Martens, A.; Broeckx, S.Y.; Meyer, E.; Chiers, K.; Duchateau, L.; Spaas, J.H. Regenerative Skin Wound Healing in Mammals: State-of-the-Art on Growth Factor and Stem Cell Based Treatments. Cell. Physiol. Biochem. 2015, 36(1), 1–23. [Google Scholar] [CrossRef]
- Sire, J.Y.; Allizard, F.; Babiar, O.; Bourguignon, J.; Quilhac, A. Scale Development in Zebrafish (Danio rerio). J. Anat. 1997, 190(4), 545–561. [Google Scholar] [CrossRef]
- Schultz, G.S.; Ladwig, G.; Wysocki, A. Extracellular Matrix: Review of Its Roles in Acute and Chronic Wounds. World Wide Wounds 2005, 1–18. [Google Scholar]
- Barrientos, S.; Stojadinovic, O.; Golinko, M.S.; Brem, H.; Tomic-Canic, M. Growth Factors and Cytokines in Wound Healing. Wound Repair Regen. 2008, 16(5), 585–601. [Google Scholar] [CrossRef]
- Yoshinari, N.; Kawakami, A. Mature and Juvenile Tissue Models of Regeneration in Small Fish Species. Biol. Bull. 2011, 221(1), 62–78. [Google Scholar] [CrossRef] [PubMed]
- Rolfe, K.J.; Grobbelaar, A.O. A Review of Fetal Scarless Healing. ISRN Dermatol. 2012, 2012, Article ID 698034. [Google Scholar] [CrossRef]
- Schmidt, J.G.; Nielsen, M.E. Expression of Immune System-Related Genes during Ontogeny in Experimentally Wounded Common Carp (Cyprinus carpio) Larvae and Juveniles. Dev. Comp. Immunol. 2014, 42(2), 186–196. [Google Scholar] [CrossRef] [PubMed]
- Martin, C.W.; Muir, I.F.K. The Role of Lymphocytes in Wound Healing. Br. J. Plast. Surg. 1990, 43(6), 655–662. [Google Scholar] [CrossRef]
- Espinosa, C.; Esteban, M.Á. Effect of Dietary Supplementation with Yeast Saccharomyces cerevisiae on Skin, Serum and Liver of Gilthead Seabream (Sparus aurata L). J. Fish Biol. 2020, 97(3), 869–881. [Google Scholar] [CrossRef]
- Eming, S.A.; Krieg, T.; Davidson, J.M. Inflammation in Wound Repair: Molecular and Cellular Mechanisms. J. Investig. Dermatol. 2007, 127(3), 514–525. [Google Scholar] [CrossRef]
- Whyte, S.K. The Innate Immune Response of Finfish–A Review of Current Knowledge. Fish Shellfish Immunol. 2007, 23(6), 1127–1151. [Google Scholar] [CrossRef]
- Wang, T.; Secombes, C.J. The Cytokine Networks of Adaptive Immunity in Fish. Fish Shellfish Immunol. 2013, 35(6), 1703–1718. [Google Scholar] [CrossRef]
- Chen, Y.M.; Wang, T.Y.; Chen, T.Y. Immunity to Betanodavirus Infections of Marine Fish. Dev. Comp. Immunol. 2014, 43(2), 174–183. [Google Scholar] [CrossRef] [PubMed]
- Sirbulescu, R.F.; Boehm, C.K.; Soon, E.; Wilks, M.Q.; Ilieş, I.; Yuan, H.; ... Poznansky, M.C. Mature B Cells Accelerate Wound Healing after Acute and Chronic Diabetic Skin Lesions. Wound Repair Regen. 2017, 25(5), 774–791.
- Efron, J.E.; Frankel, H.L.; Lazarou, S.A.; Wasserkrug, H.L.; Barbul, A. Wound Healing and T-Lymphocytes. J. Surg. Res. 1990, 48(5), 460–465. [Google Scholar] [CrossRef] [PubMed]
- Iwata, Y.; Yoshizaki, A.; Komura, K.; Shimizu, K.; Ogawa, F.; Hara, T.; ... Sato, S. CD19, a Response Regulator of B Lymphocytes, Regulates Wound Healing through Hyaluronan-Induced TLR4 Signaling. Am. J. Pathol. 2009, 175(2), 649–660. [CrossRef] [PubMed]
- Chen, Z.; Ceballos-Francisco, D.; Guardiola, F.A.; Huang, D.; Esteban, M.Á. Skin Wound Healing in Gilthead Seabream (Sparus aurata L.) Fed Diets Supplemented with Arginine. Fish Shellfish Immunol. 2020, 104, 347–358. [Google Scholar] [CrossRef]
- Rowley, A.F. The Evolution of Inflammatory Mediators. Mediators Inflamm. 1996, 5, 3–13. [Google Scholar] [CrossRef]
- Jeffries, K.M.; Hinch, S.G.; Sierocinski, T.; Clark, T.D.; Eliason, E.J.; Donaldson, M.R.; ... Miller, K.M. Consequences of High Temperatures and Premature Mortality on the Transcriptome and Blood Physiology of Wild Adult Sockeye Salmon (Oncorhynchus nerka). Ecol. Evol. 2012, 2(7), 1747–1764.
- Pfaffl, M.W. A New Mathematical Model for Relative Quantification in Real-Time RT–PCR. Nucleic Acids Res. 2001, 29(9), e45. [Google Scholar] [CrossRef] [PubMed]
- Zawistowski, S. Histological Technique, Histology and the Principles of Histopathology; PZWL: Warsaw, Poland, 1983. [Google Scholar]



| Gene | Primer sequences | References |
|
Interleukin 17D (IL-17D) |
F: TGGGCCTACAGGCTGAATTA R: GACCAGACAGCCCTTACAAA |
[30] |
|
Cluster of differentiation 4 (CD-4) |
F: TGCATTGTTCCTCTCTTCCACAGC R: CCGTCCCAAGGTACCATAGTACCAA |
[32] |
|
Heat shock protein 90 (HSP-90) |
F: GAACCTCTGCAAGCTCATGAAGGA R: ACCAGCCTGTTTGACACAGTCACCT |
[32] |
|
Metalloproteinase-9 (MMP-9) |
F: AGTCTACGGTAGCAGCAATGAAGGC R: CGTCAAAGGTCTGGTAGGAGCGTAT |
[32] |
|
p53 protein (p53) |
F: CGAGCCCTGGCCGTCTATAA R: GGGCAGGACCTTCATTGTTC |
[39] |
|
Transforming growth factor-β (TGF-β) |
F: AATCGGAGAGTTGCTGTGTGCGA R: GGGTTGTGGTGCTTATACAGAGCCA |
[32] |
|
Eukaryotic translation initiation factor 3 subunit 6 (eIF3S6) |
F: GTCGCCGTACCAGCAGGTGATT R: CGTGGGCCATCTTCTTCTCGA |
[32] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).