Submitted:
09 June 2025
Posted:
10 June 2025
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
Transcriptomic Data Analysis of PDGFRα Expression
Animal models and housing conditions
Hematoxylin and eosin (H&E) staining
Immunohistochemistry (IHC)
RNA isolation and quantitative real-time PCR
Statistical analysis
3. Results
3.1. Dynamic expression patterns of PDGFRα in human and mouse tissues
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| KCNK3 PDGFRα TASK-1 |
potassium two pore domain channel subfamily K member 3 Platelet-derived growth factor receptor alpha Tandem of P domains in a weak inward rectifying K+ channel-related Acid-Sensitive K+-1 |
References
- Heldin, C.H.; Westermark, B. Mechanism of action and in vivo role of platelet-derived growth factor. Physiol Rev 1999, 79, 1283–1316. [Google Scholar] [CrossRef]
- LaRochelle, W.J.; Jeffers, M.; McDonald, W.F.; Chillakuru, R.A.; Giese, N.A.; Lokker, N.A.; Sullivan, C.; Boldog, F.L.; Yang, M.; Vernet, C.; et al. PDGF-D, a new protease-activated growth factor. Nat Cell Biol 2001, 3, 517–521. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Ponten, A.; Aase, K.; Karlsson, L.; Abramsson, A.; Uutela, M.; Backstrom, G.; Hellstrom, M.; Bostrom, H.; Li, H.; et al. PDGF-C is a new protease-activated ligand for the PDGF alpha-receptor. Nat Cell Biol 2000, 2, 302–309. [Google Scholar] [CrossRef]
- Gray, K.; Eitzman, B.; Raszmann, K.; Steed, T.; Geboff, A.; McLachlan, J.; Bidwell, M. Coordinate regulation by diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A) and -B chains and the PDGF receptor alpha- and beta-subunits in the mouse uterus and vagina: potential mediators of estrogen action. Endocrinology 1995, 136, 2325–2340. [Google Scholar] [CrossRef] [PubMed]
- Kypta, R.M.; Goldberg, Y.; Ulug, E.T.; Courtneidge, S.A. Association between the PDGF receptor and members of the src family of tyrosine kinases. Cell 1990, 62, 481–492. [Google Scholar] [CrossRef]
- Liu, Z.L.; Chen, H.H.; Zheng, L.L.; Sun, L.P.; Shi, L. Angiogenic signaling pathways and anti-angiogenic therapy for cancer. Signal Transduct Target Ther 2023, 8, 198. [Google Scholar] [CrossRef] [PubMed]
- Zymek, P.; Bujak, M.; Chatila, K.; Cieslak, A.; Thakker, G.; Entman, M.L.; Frangogiannis, N.G. The role of platelet-derived growth factor signaling in healing myocardial infarcts. J Am Coll Cardiol 2006, 48, 2315–2323. [Google Scholar] [CrossRef]
- Nilsson, E.E.; Detzel, C.; Skinner, M.K. Platelet-derived growth factor modulates the primordial to primary follicle transition. Reproduction 2006, 131, 1007–1015. [Google Scholar] [CrossRef]
- Pascuali, N.; Scotti, L.; Abramovich, D.; Irusta, G.; Di Pietro, M.; Bas, D.; Tesone, M.; Parborell, F. Inhibition of platelet-derived growth factor (PDGF) receptor affects follicular development and ovarian proliferation, apoptosis and angiogenesis in prepubertal eCG-treated rats. Mol Cell Endocrinol 2015, 412, 148–158. [Google Scholar] [CrossRef]
- Kezele, P.R.; Ague, J.M.; Nilsson, E.; Skinner, M.K. Alterations in the ovarian transcriptome during primordial follicle assembly and development. Biol Reprod 2005, 72, 241–255. [Google Scholar] [CrossRef]
- Shen, Y.; Xu, M.; Ren, L.; Li, X.; Han, X.; Cao, X.; Yao, J.; Yan, B. A novel retinoic acid drug, EYE-502, inhibits choroidal neovascularization by targeting endothelial cells and pericytes. Sci Rep 2023, 13, 10439. [Google Scholar] [CrossRef] [PubMed]
- Saddouk, F.Z.; Kuzemczak, A.; Saito, J.; Greif, D.M. Endothelial HIFalpha/PDGF-B to smooth muscle Beclin1 signaling sustains pathological muscularization in pulmonary hypertension. JCI Insight 2024, 9. [Google Scholar] [CrossRef] [PubMed]
- Redmer, D.A.; Doraiswamy, V.; Bortnem, B.J.; Fisher, K.; Jablonka-Shariff, A.; Grazul-Bilska, A.T.; Reynolds, L.P. Evidence for a role of capillary pericytes in vascular growth of the developing ovine corpus luteum. Biol Reprod 2001, 65, 879–889. [Google Scholar] [CrossRef]
- Fraser, H.M. Regulation of the ovarian follicular vasculature. Reprod Biol Endocrinol 2006, 4, 18. [Google Scholar] [CrossRef]
- Mattar, D.; Samir, M.; Laird, M.; Knight, P.G. Modulatory effects of TGF-beta1 and BMP6 on thecal angiogenesis and steroidogenesis in the bovine ovary. Reproduction 2020, 159, 397–408. [Google Scholar] [CrossRef]
- Pascuali, N.; Scotti, L.; Oubina, G.; de Zuniga, I.; Gomez Pena, M.; Pomilio, C.; Saravia, F.; Tesone, M.; Abramovich, D.; Parborell, F. Platelet-derived growth factor B restores vascular barrier integrity and diminishes permeability in ovarian hyperstimulation syndrome. Mol Hum Reprod 2020, 26, 585–600. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Song, Y.; Huang, X.; Wang, D.; Wang, H. The expression of platelet-derived growth factor, epidermal growth factor, and insulin-like growth factor-II in patients with polycystic ovary syndrome and its correlation with pregnancy outcomes. Ann Palliat Med 2021, 10, 5671–5678. [Google Scholar] [CrossRef]
- Ha, S.E.; Lee, M.Y.; Kurahashi, M.; Wei, L.; Jorgensen, B.G.; Park, C.; Park, P.J.; Redelman, D.; Sasse, K.C.; Becker, L.S.; et al. Transcriptome analysis of PDGFRalpha+ cells identifies T-type Ca2+ channel CACNA1G as a new pathological marker for PDGFRalpha+ cell hyperplasia. PLoS One 2017, 12, e0182265. [Google Scholar] [CrossRef]
- Kim, D.; Cavanaugh, E.J.; Kim, I.; Carroll, J.L. Heteromeric TASK-1/TASK-3 is the major oxygen-sensitive background K+ channel in rat carotid body glomus cells. J Physiol 2009, 587, 2963–2975. [Google Scholar] [CrossRef]
- Talley, E.M.; Lei, Q.; Sirois, J.E.; Bayliss, D.A. TASK-1, a two-pore domain K+ channel, is modulated by multiple neurotransmitters in motoneurons. Neuron 2000, 25, 399–410. [Google Scholar] [CrossRef]
- Woo, M.S.; Kim, E.-J.; Lee, D.K.; Lee, C.E.; Ko, E.-A.; Kang, D. Analysis of platelet-derived growth factor receptor alpha expression in adult mouse testis. J Anim Reprod Biotechnol 2024, 39, 81–87. [Google Scholar] [CrossRef]
- Woo, M.S.; Kim, E.-J.; Prayoga, A.H.; Kim, Y.; Kang, D. Expression of TASK-1 channel in mouse Leydig cells. J Anim Reprod Biotechnol 2023, 38, 291–299. [Google Scholar] [CrossRef]
- Siregar, A.S.; Nyiramana, M.M.; Kim, E.-J.; Shin, E.-J.; Kim, C.-W.; Lee, D.; Hong, S.-G.; Han, J.; Kang, D. TRPV1 Is Associated with Testicular Apoptosis in Mice. J Anim Reprod Biotechnol 2019, 34, 7. [Google Scholar] [CrossRef]
- Abedel-Majed, M.A.; Romereim, S.M.; Davis, J.S.; Cupp, A.S. Perturbations in Lineage Specification of Granulosa and Theca Cells May Alter Corpus Luteum Formation and Function. Front Endocrinol (Lausanne) 2019, 10, 832. [Google Scholar] [CrossRef] [PubMed]
- Aoyama, M.; Shiraishi, A.; Matsubara, S.; Horie, K.; Osugi, T.; Kawada, T.; Yasuda, K.; Satake, H. Identification of a New Theca/Interstitial Cell-Specific Gene and Its Biological Role in Growth of Mouse Ovarian Follicles at the Gonadotropin-Independent Stage. Front Endocrinol (Lausanne) 2019, 10, 553. [Google Scholar] [CrossRef]
- Young, J.M.; McNeilly, A.S. Theca: the forgotten cell of the ovarian follicle. Reproduction 2010, 140, 489–504. [Google Scholar] [CrossRef]
- Wen, X.; Wang, J.; Qin, M.; Wang, H.; Xu, J.; Guan, X.; Shan, D.; Chen, P.; Xie, J.; Shao, J.; et al. Characterization of ovarian progenitor cells for their potential to generate steroidogenic theca cells in vitro. Reproduction 2024, 168. [Google Scholar] [CrossRef]
- Sanders, K.M.; Ward, S.M.; Koh, S.D. Interstitial cells: regulators of smooth muscle function. Physiol Rev 2014, 94, 859–907. [Google Scholar] [CrossRef]
- Solinc, J.; Ribot, J.; Soubrier, F.; Pavoine, C.; Dierick, F.; Nadaud, S. The Platelet-Derived Growth Factor Pathway in Pulmonary Arterial Hypertension: Still an Interesting Target? Life (Basel) 2022, 12. [Google Scholar] [CrossRef]
- Strell, C.; Rodriguez-Tomas, E.; Ostman, A. Functional and clinical roles of stromal PDGF receptors in tumor biology. Cancer Metastasis Rev 2024. [Google Scholar] [CrossRef]



| Gene Name | Species | GenBank Accession Numbers |
Primer Sequences (5′–3′) | Expected size (bp) |
|---|---|---|---|---|
| Pdgfra | Mouse | BC053036.1 | F: TGCGGGTGGACTCTGATAATGC R: GTGGAACTACTGGAACCTGTCTCG |
235 |
| KCNK3 | Mouse | NM_001083316.2 | F: TCCTTCTACTTCGCCATCACC R: AGGCTCTGGAACATGACTAGTGT |
137 |
| Gapdh | Mouse | GU214026.1 | F: AC CAGAAGACTGTGGATGG R: CACATTGGGGGTAGGAACAC |
171 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).