Submitted:
29 May 2025
Posted:
03 June 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Material and Methods
2.1. Biological Material
2.2. Inoculation and Experimental Setup in Calcareous Soil
- Plants grown in previously sterilized calcareous soil.
- Plants grown in non-sterilized calcareous soil.
- Plants inoculated by root immersion and grown in sterilized calcareous soil.
- Plants inoculated by root immersion and grown in non-sterilized calcareous soil.
- Plants inoculated by surface irrigation and grown in sterilized calcareous soil.
- Plants inoculated by surface irrigation and grown in non-sterilized calcareous soil.
2.2.1. Root Inoculation
2.2.2. Irrigation Inoculation
2.3. Inoculation in Hydroponic System
- Plants grown in complete nutrient solution.
- Plants grown in complete nutrient solution plus inoculum.
- Plants grown in P-deficient nutrient solution.
- Plants grown in P-deficient nutrient solution plus inoculum.
2.4. Chlorophyll Content (SPAD)
2.5. Growth Promotion and Yield Production
2.6. Elemental Analysis of Leaves
2.7. Acid Phosphatase Determination
2.8. Gene Expression Analysis by qRT-PCR
2.9. Statistical Analysis
3. Results
3.1. Effect of Debaryomyces hansenii Inoculation on SPAD Index
3.2. Effect of Debaryomyces hansenii on Dry Matter Content, Plant Height, and Grain Yield
3.3. Effect of Debaryomyces hansenii on Leaf Content of Cu, Fe, Zn, Mn, and P in Rice Plants
3.4. Effect of Debaryomyces hansenii on the Physiological Mechanism of Acid Phosphatase Activity in Rice Plants
3.5. Effect of Debaryomyces hansenii on the Expression of Genes Related to Acid Phosphatase Activity and Phosphorus Transport
4. Discussion
5. Conclusions
References
- Moreno-Jiménez, E.; Plaza, C.; Saiz, H.; Manzano, R.; Flagmeier, M.; Maestre, F.T. Aridity and Reduced Soil Micronutrient Availability in Global Drylands. Nat. Sustain. 2019, 2, 371–377. [CrossRef]
- Abel, S.; Ticconi, C.A.; Delatorre, C.A. Phosphate Sensing in Higher Plants. Physiologia Plantarum 2002, 115, 1–8. [CrossRef]
- López-Garrido, R.; Parras-Acántara, L.; Lozano-Garcia, B.; Giráldez, J. Los suelos calizos en la península ibérica. Avances en la investigación sobre suelos y desarrollo sostenible. Universidad de Granada, 2014, 49-70.
- García-Ruiz, R.; Morugan-Coronado, A.; Lavee, H. Suelos calizos en ambientes semiáridos y áridos. Suelos y Desarrollo Sostenible. Universidad de Granada 2014, 327-354.
- Lucena, C.; Porras, R.; Romera, F.J.; Alcántara, E.; García, M.J.; Pérez-Vicente, R. Similarities and Differences in the Acquisition of Fe and P by Dicot Plants. Agronomy 2018, 8, 148. [CrossRef]
- Lucena, C.; Alcalá-Jiménez, M.T.; Romera, F.J.; Ramos, J. Several Yeast Species Induce Iron Deficiency Responses in Cucumber Plants (Cucumis Sativus L.). Microorganisms 2021, 9, 2603. [CrossRef]
- Sevillano-Cano, J.; García, M.J.; Córdoba-Galván, C.; Luque-Cruz, C.; Agustí-Brisach, C.; Lucena, C.; Ramos, J.; Pérez-Vicente, R.; Romera, F.J. Exploring the Role of Debaryomyces hansenii as Biofertilizer in Iron-Deficient Environments to Enhance Plant Nutrition and Crop Production Sustainability. Int. J. Mol. Sci. 2024, 25, 5729. [CrossRef]
- Matar, A.; Torrent, J.; Ryan, J. Soil and Fertilizer Phosphorus and Crop Responses in the Dryland Mediterranean Zone. In Soil Restoration; Lal, R., Stewart, B.A., Eds.; Advances in Soil Science; Springer New York: New York, NY, 1992; Vol. 17, pp. 81–146 ISBN 978-1-4612-7684-5.
- Hirsch, J.; Marin, E.; Floriani, M.; Chiarenza, S.; Richaud, P.; Nussaume, L.; Thibaud, M.C. Phosphate Deficiency Promotes Modification of Iron Distribution in Arabidopsis Plants. Biochimie 2006, 88, 1767–1771. [CrossRef]
- Mori, S. Iron Acquisition by Plants. Curr. Opin. Plant Biol. 1999, 2, 250–253. [CrossRef]
- Marschner, H. Mineral Nutrition of Higher Plants; 2nd edition.; Academic Press: London San Diego, 1995; ISBN 978-0-12-473542-2.
- Kabata-Pendias, A.; Mukherjee, A.B. Trace Elements from Soil to Human; Springer: Berlin New York, 2007; ISBN 978-3-540-32714-1.
- Mori, S.; Nishizawa, N.; Hayashi, H.; Chino, M.; Yoshimura, E.; Ishihara, J. Why Are Young Rice Plants Highly Susceptible to Iron Deficiency? In Iron Nutrition and Interactions in Plants; Chen, Y., Hadar, Y., Eds.; Springer Netherlands: Dordrecht, 1991; pp. 175–188 ISBN 978-94-010-5455-3.
- Takagi, S. Naturally Occurring Iron-Chelating Compounds in Oat- and Rice-Root Washings: I. Activity Measurement and Preliminary Characterization. Soil Sci. Plant Nutr. 1976, 22, 423–433. [CrossRef]
- Marschner, H.; Romheld, V.; Kissel, M. Different Strategies in Higher Plants in Mobilization and Uptake of Iron. J. Plant Nutr. 1986, 9, 695–713. [CrossRef]
- Nimsi, K.A.; Manjusha, K.; Kathiresan, K.; Arya, H. Plant Growth-Promoting Yeasts (PGPY), the Latest Entrant for Use in Sustainable Agriculture: A Review. Journal of Applied Microbiology 2023, 134, lxac088. [CrossRef]
- Mukherjee, S.; Sen, S.K. Exploration of Novel Rhizospheric Yeast Isolate as Fertilizing Soil Inoculant for Improvement of Maize Cultivation. J. Sci. Food Agric. 2015, 95, 1491–1499. [CrossRef]
- Kaur, J.; Anand, V.; Srivastava, S.; Bist, V.; Tripathi, P.; Naseem, M.; Nand, S.; Anshu; Khare, P.; Srivastava, P.K.; et al. Yeast Strain Debaryomyces Hansenii for Amelioration of Arsenic Stress in Rice. Ecotoxicol. Environ. Saf. 2020, 195, 110480. [CrossRef]
- Mundra, S.; Arora, R.; Stobdan, T. Solubilization of Insoluble Inorganic Phosphates by a Novel Temperature-, pH-, and Salt-Tolerant Yeast, Rhodotorula Sp. PS4, Isolated from Seabuckthorn Rhizosphere, Growing in Cold Desert of Ladakh, India. World J. Microbiol. Biotechnol. 2011, 27, 2387–2396. [CrossRef]
- Hesham, A.E.-L. Molecular Genetic Identification of Yeast Strains Isolated from Egyptian Soils for Solubilization of Inorganic Phosphates and Growth Promotion of Corn Plants. J. Microbiol. Biotechnol. 2011, 21, 55–61. [CrossRef]
- Fu, S.-F.; Sun, P.-F.; Lu, H.-Y.; Wei, J.-Y.; Xiao, H.-S.; Fang, W.-T.; Cheng, B.-Y.; Chou, J.-Y. Plant Growth-Promoting Traits of Yeasts Isolated from the Phyllosphere and Rhizosphere of Drosera Spatulata Lab. Fungal Biology 2016, 120, 433–448. [CrossRef]
- Rosa-Magri, M.M.; Avansini, S.H.; Lopes-Assad, M.L.; Tauk-Tornisielo, S.M.; Ceccato-Antonini, S.R. Release of Potassium from Rock Powder by the Yeast Torulaspora Globosa. Braz. arch. biol. technol. 2012, 55, 577–582. [CrossRef]
- Mohamed, H.M.; El-Homosy, R.F.; Abd-Ellatef, A.-E.H.; Salh, F.M.; Hussein, M.Y. Identification of Yeast Strains Isolated from Agricultural Soils for Releasing Potassium-Bearing Minerals. Geomicrobiology Journal 2017, 34, 261–266. [CrossRef]
- Nutaratat, P.; Amsri, W.; Srisuk, N.; Arunrattiyakorn, P.; Limtong, S. Indole-3-Acetic Acid Production by Newly Isolated Red Yeast Rhodosporidium Paludigenum. J. Gen. Appl. Microbiol. 2015, 61, 1–9. [CrossRef]
- Arnesen, J.A.; Kildegaard, K.R.; Cernuda Pastor, M.; Jayachandran, S.; Kristensen, M.; Borodina, I. Yarrowia Lipolytica Strains Engineered for the Production of Terpenoids. Front. Bioeng. Biotechnol. 2020, 8, 945. [CrossRef]
- Aparicio, M.A.; Lucena, C.; García, M.J.; Ruiz-Castilla, F.J.; Jiménez-Adrián, P.; López-Berges, M.S.; Prieto, P.; Alcántara, E.; Pérez-Vicente, R.; Ramos, J.; et al. The Nonpathogenic Strain of Fusarium Oxysporum FO12 Induces Fe Deficiency Responses in Cucumber (Cucumis Sativus L.) Plants. Planta 2023, 257, 50. [CrossRef]
- Römheld, V.; Marschner, H. Iron Deficiency Stress Induced Morphological and Physiological Changes in Root Tips of Sunflower. Physiologia Plantarum 1981, 53, 354–360. [CrossRef]
- Sherman, F. Getting Started with Yeast. In Methods in Enzymology; Elsevier, 1991; Vol. 194, pp. 3–21 ISBN 978-0-12-182095-4.
- Navarro-Velasco, G.Y.; Prados-Rosales, R.C.; Ortíz-Urquiza, A.; Quesada-Moraga, E.; Di Pietro, A. Galleria Mellonella as Model Host for the Trans-Kingdom Pathogen Fusarium Oxysporum. Fungal Genet. Biol. 2011, 48, 1124–1129. [CrossRef]
- Zakhleniuk, O.V.; Raines, C.A.; Lloyd, J.C. Pho3 : A Phosphorus-Deficient Mutant of Arabidopsis Thaliana (L.) Heynh. Planta 2001, 212, 529–534. [CrossRef]
- Alloway, B.J. Zinc in Soils and Crop Nutrition; International Zinc Association (IZA), 2008.
- Brady, N.C.; Weil, R.R. The Nature and Properties of Soils; 14th ed.; Pearson Prentice Hall, 2008.
- Yoshida, S. Fundamentals of Rice Crop Science; Int. Rice Res. Inst., 1981.
- Juliano, B.O. Criteria and Tests for Rice Grain Qualities. In: Rice Chemistry and Technology, 2nd Edition, American Association of Cereal Chemists, 1985, pp. 443-524.
- Savary, S. Direct and Indirect Effects of Nitrogen Supply and Disease Source Structure on Rice Sheath Blight Spread. Phytopathology 1995, 85, 959. [CrossRef]
- Pingali, P.L. From Subsistence to Commercial Production Systems: The Transformation of Asian Agriculture. American J. Agri. Economics 1997, 79, 628–634. [CrossRef]
- Smith, S.E.; Read, D. Mycorrhizal Symbiosis; Elsevier, 2008; ISBN 978-0-12-370526-6.
- Sharma, A.; Johri, B.N.; Sharma, A.K.; Glick, B.R. Plant Growth-Promoting Bacterium Pseudomonas Sp. Strain GRP3 Influences Iron Acquisition in Mung Bean (Vigna Radiata L. Wilzeck). Soil Biol. Bioch. 2003, 35, 887–894. [CrossRef]
- Rousk, J.; Bååth, E.; Brookes, P.C.; Lauber, C.L.; Lozupone, C.; Caporaso, J.G.; Knight, R.; Fierer, N. Soil Bacterial and Fungal Communities across a pH Gradient in an Arable Soil. The ISME Journal 2010, 4, 1340–1351. [CrossRef]
- Zamioudis, C.; Korteland, J.; Van Pelt, J.A.; Van Hamersveld, M.; Dombrowski, N.; Bai, Y.; Hanson, J.; Van Verk, M.C.; Ling, H.; Schulze-Lefert, P.; et al. Rhizobacterial Volatiles and Photosynthesis-related Signals Coordinate MYB 72 Expression in Arabidopsis Roots during Onset of Induced Systemic Resistance and Iron-deficiency Responses. The Plant Journal 2015, 84, 309–322. [CrossRef]
- Romera, F.J.; García, M.J.; Lucena, C.; Martínez-Medina, A.; Aparicio, M.A.; Ramos, J.; Alcántara, E.; Angulo, M.; Pérez-Vicente, R. Induced Systemic Resistance (ISR) and Fe Deficiency Responses in Dicot Plants. Front. Plant Sci. 2019, 10, 287. [CrossRef]
- Streletskii, R.A.; Kachalkin, A.V.; Glushakova, A.M.; Yurkov, A.M.; Demin, V.V. Yeasts Producing Zeatin. PeerJ 2019, 7, e6474. [CrossRef]
- Kushner, D. Microbial Life in Extreme Environments; Acad. Pr: London, 1978; ISBN 978-0-12-430250-1.
- Prista, C.; Michán, C.; Miranda, I.M.; Ramos, J. The Halotolerant Debaryomyces Hansenii , the Cinderella of Non-conventional Yeasts. Yeast 2016, 33, 523–533. [CrossRef]
- Liu, J.; Tang, L.; Gao, H.; Zhang, M.; Guo, C. Enhancement of Alfalfa Yield and Quality by Plant Growth-promoting Rhizobacteria under Saline-alkali Conditions. J. Sci. Food Agric. 2019, 99, 281–289. [CrossRef]
- Ipek, M.; Pirlak, L.; Esitken, A.; Figen Dönmez, M.; Turan, M.; Sahin, F. Plant Growth-Promoting Rhizobacteria (Pgpr) Increase Yield, Growth And Nutrition Of Strawberry Under High-Calcareous Soil Conditions. J. Plant Nutr. 2014, 37, 990–1001. [CrossRef]
- Tarafdar, J.C.; Marschner, H. Phosphatase Activity in the Rhizosphere and Hyphosphere of VA Mycorrhizal Wheat Supplied with Inorganic and Organic Phosphorus. Soil Biol. Bioch. 1994, 26, 387–395. [CrossRef]
- Khan, A.L.; Waqas, M.; Kang, S.-M.; Al-Harrasi, A.; Hussain, J.; Al-Rawahi, A.; Al-Khiziri, S.; Ullah, I.; Ali, L.; Jung, H.-Y.; et al. Bacterial Endophyte Sphingomonas Sp. LK11 Produces Gibberellins and IAA and Promotes Tomato Plant Growth. J Microbiol. 2014, 52, 689–695. [CrossRef]
- Zhang, Q.; Wang, C.; Tian, J.; Li, K.; Shou, H. Identification of Rice Purple Acid Phosphatases Related to Posphate Starvation Signalling. Plant Biol. 2011, 13, 7–15. [CrossRef]
- Yang, S.-Y.; Grønlund, M.; Jakobsen, I.; Grotemeyer, M.S.; Rentsch, D.; Miyao, A.; Hirochika, H.; Kumar, C.S.; Sundaresan, V.; Salamin, N.; et al. Nonredundant Regulation of Rice Arbuscular Mycorrhizal Symbiosis by Two Members of the PHOSPHATE TRANSPORTER1 Gene Family. Plant Cell 2012, 24, 4236–4251. [CrossRef]
- Sharma, S.B.; Sayyed, R.Z.; Trivedi, M.H.; Gobi, T.A. Phosphate Solubilizing Microbes: Sustainable Approach for Managing Phosphorus Deficiency in Agricultural Soils. SpringerPlus 2013, 2, 587. [CrossRef]






| Clay g kg−1 | Organic Carbon g kg−1 | CaCO3 g kg−1 | pH1:2.5 | EC1:5 dS m−1 | CEC cmol kg−1 | POlsen mg kg−1 | FeDTPA mg kg−1 |
|---|---|---|---|---|---|---|---|
| 370 | 9.3 | 338 | 7.9 | 1.5 | 31.3 | 13.4 | 4.3 |
| Gene | Forward (5′-3′) | Reverse (5′-3′) |
|---|---|---|
| OsPHT1;6 | CCGCCGCCTCACAAACTGTA | GAACTGGGCGGTTTTCCTGA |
| OsPAP9 | ACCTACGTAGAGACAACATCAGGC | CATATACGTGTTGCCGGTAGTGA |
| OsPAP3 | TCATACCATGAGGAGTGAGTGATG | GTCTTCGTTTTGTGAAAATGGC |
| OsACTIN | TGCATGTAGTACAGTGC CATCCAG | AATGAGTAACCACGCTCCGTCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).