Submitted:
26 May 2025
Posted:
27 May 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Effect of Exogenous JA on U. maydis Mycelial Growth and Maize Disease Resistance
2.2. Alterations in Defense-Related Enzyme Activities Induced by Exogenous JA in Maize Resistance Against U. maydis
2.3. Cytological Analysis of Exogenous JA-Induced Resistance to U. maydis in Maize
2.4. Transcriptomic Analysis of Exogenous JA-Induced Maize Resistance to U. maydis
2.5. Validation of DEGs by qRT-PCR Analysis
2.6. Construction of Weighted Gene Co-Expression Network and Visualization Network
2.7. Candidate Gene Prediction
3. Discussion
4. Conclusion
5. Materials and Methods
5.1. Experimental Materials
5.2. Treatment Methods with JA and IBU
5.3. Determination of Maize Defense-Related Enzyme Activity
5.4. Cytological Analysis of Maize Leaves
5.5. Total RNA Extraction and RNA-seq
5.6. Quantitative Real-Time PCR (qRT-PCR) Analysis
5.7. Data Processing and Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sun, H.M. Investigation on the Occurrence of Corn Smut and Study on Chemical Control. Agric. Dev. Equip. 2021, 3, 163–164. [Google Scholar]
- Redkar, A.; Hoser, R. ; Schilling L; Zechmann, B.; Krzymowska, M.; Walbot, V.; Doehlemann, G. A Secreted effector protein of Ustilago maydis guides maize leaf cells to form tumors. Plant Cell. [CrossRef]
- Meng, Y.; Chen, G.; Tan, H. Main Pests and Diseases of Maize and Their Control Techniques. Mod. Agric. 2007, 29, 43–45. [Google Scholar] [CrossRef]
- Lu, J.H. Occurrence Patterns and Control Measures of Corn Head Smut. Rural Sci. Technol. 2020, 37, 42–43. [Google Scholar] [CrossRef]
- Zhang, J.Q.; Zhang, H.J.; Liu, S.S.; Guo, N.; Jin, G.; Shi, J. Establishment and Application of Indoor Rapid Screening Method for Controlling Ustilago maydis. J. Pestic. Sci. 2020, 22(4), 711–715. [Google Scholar] [CrossRef]
- Ee, W.D.; Wang, Z.H.; Zhang, L.G.; Zhang, L.; Wang, X.; Sun, G.Q. The Advances in the Research of Common Smut in Maize . Maize Sci. 2006, 14, 153–157. [Google Scholar]
- Li, A.M. Discussion on High-Yield Maize Cultivation Techniques and Pest and Disease Control Strategies. Seed Sci. Technol. 2023, 2023 41, 47–49. [Google Scholar] [CrossRef]
- Zhang, W.J.; Ren, C.Y. Causes and Control Strategies of Corn Smut Disease. Seed Sci. Technol. 2021, 39, 83–84. [Google Scholar] [CrossRef]
- Yang, K.Z.; Ma, J.H.; Ren, B.C. Efficacy Test of Seed Coating against Ustilago maydis. Pesticides 2016, 55, 764–766. [Google Scholar] [CrossRef]
- Peng, W.; Li, K.T.; Zeng, Y.J. Advances in Microbial Control of Rice Diseases. J. Jiangxi Agric. Univ. 2015, 37, 625–631. [Google Scholar] [CrossRef]
- Pan, L.Y.; Zhao, X.Y.; Chen, M.; Fu, Y.Q.; Xiang, M.L.; Chen, J.Y. Methyl Jasmonate Regulates Defense Enzyme Activity to Induce Postharvest Soft Rot Resistance in Kiwifruit Fruits. Plant Prot. 2019, 45, 75–80. [Google Scholar] [CrossRef]
- Ivica, D.; Tamara, J.; Marija, P.; Giuliano, D.; Djordje, F. Plant-Associated Bacillus and Pseudomonas Antimicrobial Activities in Plant Disease Suppression via Biological Control Mechanisms - A Review. Physiol. Mol. Plant Pathol. 2021, 117, 101754. [Google Scholar] [CrossRef]
- Walters, D.R. , Ratsep, J., Havis, N.D. Controlling Crop Diseases using Induced Resistance: Challenges for the Future. J. Exp. Bot. 2013, 64, 1263–1280. [Google Scholar] [CrossRef] [PubMed]
- Yu, C.G.; Li, T.L.; Du, Y.Y.; Zhou, D.; Wei, S. Plant-Induced Disease Resistance Signal Transduction Pathways. Plant Prot. 2008, 34, 1–4. [Google Scholar]
- Robert-Seilaniantz, A.; Grant, M.; Jones, J. D.G. Hormone Crosstalk in Plant Disease and Defense: More Than Just Jasmonate-Salicylate Antagonism. Annu. Rev. Phytopathol. 2011, 49, 317–343. [Google Scholar] [CrossRef]
- Zheng, X.L.; Zheng, J.L.; Xi, J.G.; et al. Preliminary Report on the Sensitivity of Colletotrichum gloeosporioides to Ethephon in Rubber Trees. Acta Agric. Australas. Sin. 2017, 48, 82–86. [Google Scholar]
- Liu, L. Study on the Regulation Mechanism of Plant Hormones on Rice Seed Germination and Seedling Root Growth Under Salt Stress. Ph.D. Dissertation, Huazhong Agricultural University, Wuhan, China, 2018. [Google Scholar]
- Bari, R.; Jones, J. D. Role of Plant Hormones in Plant Defence Responses. Plant Mol. Biol. 2009, 69, 473–488. [Google Scholar] [CrossRef]
- Li, Y. Exploration of the Mechanism of Action of Hormones in the Interaction Between Rice and Pathogens, and Functional Analysis of the Disease Resistance-Related Gene OsDR10. Master’s Thesis, Huazhong Agricultural University, Wuhan, China, 2016. [Google Scholar]
- Lv, S. Study on the Disease Resistance Mechanism of Rice Induced by Protein Elicitor Mo Hrip1. Master’s Thesis, Chinese Acad. Agric. Sci. 2016.
- Zou, Z.; Wang, Z. Study on the Induction of Resistance to Rice Blast by JA in Rice Seedlings. Acta Phytopathol. Sin. 2006, 36, 432–438. [Google Scholar] [CrossRef]
- Li, M.; Yan, X.F. JA, the Environmental Signal Molecule of Plants, and Its Biological Functions. Acta Ecol. Sin. 2014, 34, 6779–6788. [Google Scholar] [CrossRef]
- Zhang, H. Cell Wall Degrading Enzymes of Rhizoctonia solani and Their Role in Pathogenesis. Master’s Thesis, Yangzhou University, Yangzhou, China, 2004. [Google Scholar]
- Chen, Z.Y.; Xu, Z.G; Lu, F.; Liu, Y.F. Induction of Resistance in Rice Plants by Antagonistic Bacterium B-916. Acta Agric. Agrolog. Sin. 2001, 17, 44–48. [Google Scholar] [CrossRef]
- Wang, Y.; Yang, L. , Chen, X., Ye, T., Zhong, B., Liu, R., Wu, Y., Chan, Z. Salicylic Acid Inhibits Pathogen Growth in Plants Through Direct Antimicrobial Activity and Defense Induction. Plant Physiol. 2015, 167, 1254–1266. [Google Scholar] [CrossRef]
- Navarro, L.; Dunoyer, P. , Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., Jones, J.D.G. A Plant miRNA Contributes to Antibacterial Resistance by Repressing Auxin Signaling. Science 2006, 312, 436–439. [Google Scholar] [CrossRef] [PubMed]
- Thaler, J. S.; Humphrey, P.T. , Whiteman, N.K. Jasmonate-Deficient Plants Have Reduced Direct and Indirect Defenses Against Herbivores. Ecol. Lett. 2012, 15, 224–232. [Google Scholar] [CrossRef]
- He, Y. Study on the Mechanism of JA Pathway Inhibiting Brassinosteroid Regulation of Rice Immunity Against Rice Black-Streaked Dwarf Virus. Ph.D. Dissertation, Zhejiang University, Hangzhou, China, 2017. [Google Scholar]
- Su, Y.; Zheng, Q.; Ma, X.; Li, J.; Wu, B.; Hu, L.; Fan, R. Study on Physiological and Biochemical Changes in Pepper Resistance to Blight Induced by JA and Salicylic Acid. J. Southwest Agric. Univ. 2021, 34, 1630–1636. [Google Scholar] [CrossRef]
- Wen, S.H.; Yang, J.W.; Wang, Y.; Li, G.J.; Wen, J.F.; Duan, C.X.; Jia, X.; Wang, J.J. Progress in Maize Anti-Fungal Disease Gene Mining and Molecular Breeding Utilization Research. Crop J. 2023, 11, 1–11. [Google Scholar] [CrossRef]
- Wasternack, C.; Strnad, M. Jasmonate Signaling in Plant Stress Responses and Development-Active and Inactive Compounds. New Biotechnol. 2016, 33, 604–613. [Google Scholar] [CrossRef]
- Yang, J.; Duan, G. H.; Li, C. Q.; Liu, L.; Han, G. G.; Zhang, Y. L.; Wang, C. M. The Crosstalks Between JA and Other Plant Hormone Signalings Highlight the Involvement of JA as a Core Component in Plant Response to Biotic and Abiotic Stresses. Front. Plant Sci. 2019, 13, 1349. [Google Scholar] [CrossRef]
- Liu, L.; Sun, L.; Zhang, Z.; An, M.; Chen, K.; Wang, X. Induction Resistance and Defense Enzyme Activity by Extraneous Factors to Fusarium oxysporum f.sp.melonisin Melon. North. Hortic. 2016, 40, 122–126. [Google Scholar]
- Gao, Q. Physiological Mechanism of Salicylic Acid-Induced Resistance to Clubroot Disease in Non-Heading Chinese Cabbage. Master's Thesis, Nanjing Agricultural University, Nanjing, China, 2016. [Google Scholar]
- Wang, C. Study on the Mechanism of StLTP10 Regulating Potato Resistance to Late Blight. Master's Thesis, Shandong Agricultural University, Taian, China, 2020. [Google Scholar]
- Pu, X. Physiological and Molecular Mechanisms of Resistance to Powdery Mildew in Trifolium pratense and Cloning and Genetic Transformation of the Disease Resistance Gene TpGDSL. Ph.D. Dissertation, Gansu Agricultural University, Lanzhou, China, 2021. [Google Scholar]
- Ghareeb, H.; Becker, A.; Iven, T.; Feussner, I.; Schirawski, J. Sporisorium reilianum Infection Changes Inflorescence and Branching Architectures of Maize. Plant Physiol. 2011, 156, 2037–2052. [Google Scholar] [CrossRef]
- Wu, X.Y.; Li, T. A Casein Kinase II Phosphorylation Site in AtYY1 Affects Its Activity, Stability, and Function in the ABA Response. Front. Plant Sci. 2017, 11, 323. [Google Scholar] [CrossRef]
- Chu, M.; Chen, P.; Meng, S.; Zhang, X. , Liang, Z., Guo, Q., Wang, Y. The Arabidopsis Phosphatase PP2C49 Negatively Regulates Salt Tolerance Through Inhibition of AtHKT1;1. J. Integr. Plant Biol. 2021, 63, 528–542. [Google Scholar] [CrossRef]
- Hirayama, T.; Umezawa, T. The PP2C-SnRK2 Complex: The Central Regulator of an Abscisic Acid Signaling Pathway. Plant Signal. Behav. 2010, 5, 160–163. [Google Scholar] [CrossRef] [PubMed]
- Chisholm, S.T.; Coaker, G.; Day, B.; Staskawicz, B.J. Host-Microbe Interactions: Shaping the Evolution of Plant Immune Responses. Cell 2006, 124, 803–814. [Google Scholar] [CrossRef] [PubMed]
- Song, T. Functional and Mechanistic Studies on Three Effectors of Phytophthora sojae Regulating Plant Immune Response. Ph.D. Dissertation, Nanjing Agricultural University, Nanjing, China, 2015. [Google Scholar]
- Yu, Y.C.; Qiao, M.; Liu, Z.H.; Xiang, F.Y. Diversification function of WRKY transcription factor. Life Sci. 2010, 22, 345–351. [Google Scholar] [CrossRef]
- Jones, J. D. G.; Dangl, J. L. The Plant Immune System. Nature 2006, 444, 323–329. [Google Scholar] [CrossRef]
- Wang, J. Functional Analysis of Cytokinin N-Glycosyltransferase Gene in Arabidopsis thaliana. Master's Thesis, Shandong University, Jinan, China, 2011. [Google Scholar]
- Argueso, C.T.; Ferreira, F.J.; Epple, P.; To, J.P.; Hutchison, C.E.; Schaller, G.E.; Dangl, J.L.; Kieber, J.J. Two-Component Elements Mediate Interactions Between Cytokinin and Salicylic Acid in Plant Immunity. PLoS Genet. 2012, 8, e1002448. [Google Scholar] [CrossRef]
- Awolade, P.; Cele, N.; Kerru, N.; Gummidi, L.; Oluwakemi, E.; Singh, P. Therapeutic Significance of β-Glucuronidase Activity and Its Inhibitors: A Review. Eur. J. Med. Chem. 2020, 187, 111921. [Google Scholar] [CrossRef]
- Wan, J.; He, M.; Hou, Q.; Zou, L.; Yang, Y.; Wei, Y.; Chen, X. Plant Cell Wall-Associated Immunity. Journal Abbrev. 2021, 1, 3. [Google Scholar] [CrossRef]
- Han, G.; Qiao, Z.; Li, Y.; Yang, Z.; Wang, C.; Zhang, Y.; Liu, L.; Wang, B. RING Zinc Finger Proteins in Plant Abiotic Stress Tolerance. Front. Plant Sci. 2022, 13, 877011. [Google Scholar] [CrossRef] [PubMed]
- Zander, M.; Lewsey, M.G.; Clark, N.M.; Yin, L.; Bartlett, A.; Saldierna Guzmán, J.P.; Hann, E.; Langford, A.E.; Jow, B.; Wise, A.; Nery, J.R.; Chen, H.; Bar-Joseph, Z.; Walley, J.W.; Solano, R.; Ecker, J.R. Integrated Multi-Omics Framework of the Plant Response to Jasmonic Acid. Nat. Plants 2020, 6, 290–302. [Google Scholar] [CrossRef]
- Heo, W.D.; Lee, S.H.; Kim, M.C.; Kim, J.C. , Chung, W.S., Chun, H.J., Park, C.Y., Park, H.C., Choi, J.Y., Cho, M.J. Involvement of Specific Calmodulin Isoforms in Salicylic Acid-Independent Activation of Plant Disease Resistance Responses. Proc. Natl. Acad. Sci. USA. 1999, 96, 766–771. [Google Scholar] [CrossRef]
- Creelman, R.A.; Mullet, J.E. Biosynthesis and Action of Jasmonates in Plants. Annu. Rev. Plant Biol. 1997, 48, 355–381. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.H.; Nie, Y.F.; He, L.; Li, Y.F.; Wang, Z.Z. Resistance-related defense enzymes and endogenous salicylic acid induced by exogenous methyl jasmonate in rice against blast disease. Acta Phytopathol. Sin. 2010, 40, 395–403. [Google Scholar] [CrossRef]
- Wang, W. Study on Genetic Characteristics and Biochemical Properties of Resistance to Ustilago maydis. Ph.D. Dissertation, Gansu Agricultural University, Lanzhou, China, 2010. [Google Scholar]
- Robert-Seilaniantz, A.; Grant, M.; Jones, J. D. G. Hormone Crosstalk in Plant Disease and Defense: More Than Just Jasmonate-Salicylate Antagonism. Annu. Rev. Phytopathol. 2011, 49, 317–343. [Google Scholar] [CrossRef] [PubMed]
- Kibinza, S.; Vinel, D.; Côme, D.; Bailly, C.; Corbineau, F. Sunflower Seed Deterioration as Related to Moisture Content During Ageing, Energy Metabolism and Active Oxygen Species Scavenging. Physiol. Plant. 2006, 128, 496–506. [Google Scholar] [CrossRef]
- Jing, X. QTL Analysis of Peroxidase Activity in Wheat Grains and Cloning of Related Genes and Development of Functional Markers. Master’s Thesis, Chinese Academy of Agricultural Sciences, Beijing, China, 2015. [Google Scholar]
- Hu, Z.H.; Zhang, W.; Shen, Y.B.; Shen, Y.B.; Wang, N.N. Activities of Lipoxygenase and Phenylalanine Ammonia-Lyase in Polar Leaves Induced by Insect Herbivory and Volatiles. J. For. Res. 2009, 20, 372–376. [Google Scholar] [CrossRef]
- Hu, Z.H.; Shen, Y.B.; Wang, N.N.; Wang, J.F.; Zhou, Y.C.; Zhang, Z.Y. The Activities of Polyphenol Oxidase in Populus simonii × P. pyramidalis ‘Opera8277’ Leaves in Response to Insect Herbivory and Volatiles Exposure. Acta Ecol. Sin. 2009, 29, 5265–5270. [Google Scholar]
- Chen, G. Study on the Induction of Resistance to Rust Disease in Safflower by Exogenous Chemicals. Master’s Thesis, Sichuan Agricultural University, Chengdu, China, 2009. [Google Scholar]
- Paraffin Sides Experiment Report. Available online: https://www.servicebio.cn/data-detail?id=3588&code=RSSYBG (accessed on 23 April 2022).










| Gene ID | Gene Name | Gene Annotation |
| Zm00001d009620 | PP2C | Protein phosphatase 2C |
| Zm00001d043062 | WRKY | transcription factor |
| Zm00001d052209 | CGT | Cytokinin-O-glucosyltransferase |
| Zm00001d040047 | GLCAT | β-glucuronosyltransferase |
| Zm00001d051460 | RING zinc finger protein | RING zinc finger protein |
| Zm00001d047618 | CaM | calmodulin |
| Gene | Forward primer (5'-3') | Reverse primer (5'-3') |
| Actin | TGAAACCTTCGAATGCCCAG | GATTGGAACCGTGTGGCTCA |
| Zm00001d032854 | CTATGGAGTCCTCTTTAGCG | ACTTCTGAATGATGGAGTCG |
| Zm00001d007753 | GGATTCACCACTTTCCTCAA | AATACACGGCAGTACAAGTT |
| Zm00001d013610 | GAGCTACGAGATCACCTTCT | TATACGTACGCAAACACGAG |
| Zm00001d028303 | ACCGTGTATAGCTAGTGGTA | CTCCGGCCGTAGCCA |
| Zm00001d006117 | TGTGCAAAGACACCTTATGA | TATTTCCACAGTTCCACCAG |
| Zm00001d047618 | GTGCGGAGTACTGTATTCTT | GCCATCATGCGAACTTTTTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).