Submitted:
15 May 2025
Posted:
16 May 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Isolation and Identification of Bacterial Isolates
2.2. Antimicrobial Susceptibility Profile
2.3. Detection of Carbapenemases Production
3. Discussion
4. Materials and Methods
4.1. Study Area and Sampling
4.2. Processing and Isolation of Antibiotic-Resistant Bacteria (ARB)
4.3. Antibiotic Susceptibility Testing
4.4. Phenotypic and Genotypic Detection of Carbapenemases
Author Contributions
Funding
Conflicts of Interest
Abbreviations
| AMR | Antimicrobial Resistance |
| ARG | Antimicrobial-Resistance Gene |
| ARB | Antimicrobial-Resistant Bacteria |
| CAZ | Ceftazidime |
| CIP | Ciprofloxacin |
| MDR | Multidrug-resistant |
References
- Salam, M.A.; Al-Amin, M.Y.; Salam, M.T.; Pawar, J.S.; Akhter, N.; Rabaan, A.A.; Alqumber, M.A.A. Antimicrobial Resistance: A Growing Serious Threat for Global Public Health. Healthcare. 2023, 11, 1946. [Google Scholar] [CrossRef] [PubMed]
- Naghavi, M.; Vollset, S.E.; Ikuta, K.S.; Swetschinski, L.R.; Gray, A.P.; Wool, E.E.; Aguilar, G.R.; Mestrovic, T.; Smith, G.; Han, C.; et al. Global Burden of Bacterial Antimicrobial Resistance 1990–2021: A Systematic Analysis with Forecasts to 2050. The Lancet 2024, 404, 1199–1226. [Google Scholar] [CrossRef]
- Mancuso, G.; Midiri, A.; Gerace, E.; Biondo, C. Bacterial Antibiotic Resistance: The Most Critical Pathogens. Pathogens 2021, 10, 1310. [Google Scholar] [CrossRef] [PubMed]
- Lesho, E.P.; Laguio-Vila, M. The Slow-Motion Catastrophe of Antimicrobial Resistance and Practical Interventions for All Prescribers. Mayo Clin Proc 2019, 94, 1040–1047. [Google Scholar] [CrossRef]
- Davies, S.C.; Oxlade, C. Innovate to Secure the Future: The Future of Modern Medicine. Future Healthc J 2021, 8, e251–e256. [Google Scholar] [CrossRef]
- Martínez, J.L. Antibiotics and Antibiotic Resistance Genes in Natural Environments. Science. 2008, 321, 365–367. [Google Scholar] [CrossRef]
- Baquero, F.; Martínez, J.L.; Cantón, R.; Martinez, J.L.; Canton, R. Antibiotics and Antibiotic Resistance in Water Environments. Curr Opin Biotechnol. 2008, 19, 260–265. [Google Scholar] [CrossRef] [PubMed]
- Fajardo, A.; Martinez, J.L. Antibiotics as Signals That Trigger Specific Bacterial Responses. Curr Opin Microbiol 2008, 11, 161–167. [Google Scholar] [CrossRef]
- Wu, Y.; Gong, Z.; Wang, S.; Song, L. Occurrence and Prevalence of Antibiotic Resistance Genes and Pathogens in an Industrial Park Wastewater Treatment Plant. Sci Total Environ 2023, 880, 163278. [Google Scholar] [CrossRef]
- Singh, A.; Pratap, S.G.; Raj, A. Occurrence and Dissemination of Antibiotics and Antibiotic Resistance in Aquatic Environment and Its Ecological Implications: A Review. Environ Sci Pollut Res Int. 2024, 31, 47505–47529. [Google Scholar] [CrossRef]
- Sousa, M.; Machado, I.; Simões, L.C.; Simões, M. Biocides as Drivers of Antibiotic Resistance: A Critical Review of Environmental Implications and Public Health Risks. Environ Sci Ecotechnol 2025, 25, 100557. [Google Scholar] [CrossRef]
- Checcucci, A.; Buscaroli, E.; Modesto, M.; Luise, D.; Blasioli, S.; Scarafile, D.; Di Vito, M.; Bugli, F.; Trevisi, P.; Braschi, I.; et al. The Swine Waste Resistome: Spreading and Transfer of Antibiotic Resistance Genes in Escherichia coli Strains and the Associated Microbial Communities. Ecotoxicol Environ Saf. 2024, 283, 116774. [Google Scholar] [CrossRef] [PubMed]
- Samreen; Ahmad, I.; Malak, H.A.; Abulreesh, H.H. Environmental Antimicrobial Resistance and Its Drivers: A Potential Threat to Public Health. J Glob Antimicrob Resist. 2021, 27, 101–111. [CrossRef] [PubMed]
- Skandalis, N.; Maeusli, M.; Papafotis, D.; Miller, S.; Lee, B.; Theologidis, I.; Luna, B. Environmental Spread of Antibiotic Resistance. Antibiotics. 2021, 10, 640. [Google Scholar] [CrossRef] [PubMed]
- Ajayi, A.O.; Odeyemi, A.T.; Akinjogunla, O.J.; Adeyeye, A.B.; Ayo-ajayi, I. Review of Antibiotic-Resistant Bacteria and Antibiotic Resistance Genes within the One Health Framework. Infect Ecol Epidemiol 2024, 14, 2312953. [Google Scholar] [CrossRef]
- Wang, X.; Zhang, H.; Yu, S.; Li, D.; Gillings, M.R.; Ren, H.; Mao, D.; Guo, J.; Luo, Y. Inter-Plasmid Transfer of Antibiotic Resistance Genes Accelerates Antibiotic Resistance in Bacterial Pathogens. ISME J 2024, 18, wrad032. [Google Scholar] [CrossRef] [PubMed]
- Maeusli, M.; Lee, B.; Miller, S.; Reyna, Z.; Lu, P.; Yan, J.; Ulhaq, A.; Skandalis, N.; Spellberg, B.; Luna, B. Horizontal Gene Transfer of Antibiotic Resistance from Acinetobacter baylyi to Escherichia coli on Lettuce and Subsequent Antibiotic Resistance Transmission to the Gut Microbiome. mSphere 2020, 5, 110–1128. [Google Scholar] [CrossRef]
- FRAM Case Study: Aconcagua River in Chile - the Polluted Drinking Water Supplier | University of Gothenburg. Available online: https://www.gu.se/en/research/fram-case-study-aconcagua-river-in-chile-the-polluted-drinking-water-supplier (accessed on 30 April 2025).
- Inostroza, P.A.; Jessen, G.L.; Li, F.; Zhang, X.; Brack, W.; Backhaus, T. Multi-Compartment Impact of Micropollutants and Particularly Antibiotics on Bacterial Communities Using Environmental DNA at River Basin-Level. Environ Pollut 2025, 366, 125487. [Google Scholar] [CrossRef]
- Gaete, H.; Aránguiz, F.; Cienfuegos, G.; Tejos, M. Heavy Metals and Toxicity of Waters of the Aconcagua River in Chile. Quim Nova 2007, 30, 885–891. [Google Scholar] [CrossRef]
- Hernando-Amado, S.; Coque, T.M.; Baquero, F.; Martínez, J.L. Defining and Combating Antibiotic Resistance from One Health and Global Health Perspectives. Nat Microbiol 2019, 4, 1432–1442. [Google Scholar] [CrossRef]
- Holmes, A.H.; Moore, L.S.P.; Sundsfjord, A.; Steinbakk, M.; Regmi, S.; Karkey, A.; Guerin, P.J.; Piddock, L.J.V. Understanding the Mechanisms and Drivers of Antimicrobial Resistance. The Lancet 2016, 387, 176–187. [Google Scholar] [CrossRef]
- Calero-Cáceres, W.; Marti, E.; Olivares-Pacheco, J.; Rodriguez-Rubio, L. Editorial: Antimicrobial Resistance in Aquatic Environments. Front Microbiol 2022, 13, 866268. [Google Scholar] [CrossRef] [PubMed]
- Olivares-Pacheco, J.; Marti, E.; Rodríguez-Rubio, L.; Calero-Cáceres, W. Editorial: Antimicrobial Resistance in Aquatic Environments, Volume II. Front Microbiol 2023, 14, 1211464. [Google Scholar] [CrossRef]
- Liu, X.; Lu, S.; Guo, W.; Xi, B.; Wang, W. Antibiotics in the Aquatic Environments: A Review of Lakes, China. Sci Total Environ 2018, 627, 1195–1208. [Google Scholar] [CrossRef] [PubMed]
- Kümmerer, K. Antibiotics in the Aquatic Environment--a Review--Part II. Chemosphere 2009, 75, 435–441. [Google Scholar] [CrossRef] [PubMed]
- Manaia, C.M.; Macedo, G.; Fatta-Kassinos, D.; Nunes, O.C. Antibiotic Resistance in Urban Aquatic Environments: Can It Be Controlled? Appl Microbiol Biotechnol 2016, 100, 1543–1557. [Google Scholar] [CrossRef]
- Ashfaq, M.Y.; Da’na, D.A.; Al-Ghouti, M.A. Application of MALDI-TOF MS for Identification of Environmental Bacteria: A Review. J Environ Manage 2022, 305, 114359. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, M.; Kimothi, A.; Sharma, A.; Pandey, A. Cold Adapted Pseudomonas: Ecology to Biotechnology. Front Microbiol 2023, 14, 1218708. [Google Scholar] [CrossRef]
- Silby, M.W.; Winstanley, C.; Godfrey, S.A.C.; Levy, S.B.; Jackson, R.W. Pseudomonas Genomes: Diverse and Adaptable. FEMS Microbiol Rev 2011, 35, 652–680. [Google Scholar] [CrossRef] [PubMed]
- Horváth, A.; Dobay, O.; Kardos, S.; Ghidán, Á.; Tóth, Á.; Pászti, J.; Ungvári, E.; Horváth, P.; Nagy, K.; Zissman, S.; et al. Varying Fitness Cost Associated with Resistance to Fluoroquinolones Governs Clonal Dynamic of Methicillin-Resistant Staphylococcus aureus. Eur J Clin Microbiol Infect Dis 2012, 31, 2029–2036. [Google Scholar] [CrossRef]
- Tóth, Á.; Kocsis, B.; Damjanova, I.; Kristóf, K.; Jánvári, L.; Pászti, J.; Csercsik, R.; Topf, J.; Szabó, D.; Hamar, P.; et al. Fitness Cost Associated with Resistance to Fluoroquinolones is Diverse across Clones of Klebsiella pneumoniae and May Select for CTX-M-15 Type Extended-Spectrum β-Lactamase. Eur J Clin Microbiol Infect Dis. 2014, 33, 837–843. [Google Scholar] [CrossRef]
- Sun, H.; Zeng, J.; Li, S.; Liang, P.; Zheng, C.; Liu, Y.; Luo, T.; Rastogi, N.; Sun, Q. Interaction between rpsL and gyrA Mutations Affects the Fitness and Dual Resistance of Mycobacterium tuberculosis Clinical Isolates against Streptomycin and Fluoroquinolones. Infect Drug Resist 2018, 11, 431–440. [Google Scholar] [CrossRef]
- Papp-Wallace, K.M.; Endimiani, A.; Taracila, M.A.; Bonomo, R.A. Carbapenems: Past, Present, and Future. Antimicrob Agents Chemother 2011, 55, 4943–4960. [Google Scholar] [CrossRef] [PubMed]
- Halat, D.H.; Moubareck, C.A. The Intriguing Carbapenemases of Pseudomonas aeruginosa: Current Status, Genetic Profile, and Global Epidemiology. Yale J Biol Med 2022, 95, 507. [Google Scholar]
- Poirel, L.; Pitout, J.D.; Nordmann, P. Carbapenemases: Molecular Diversity and Clinical Consequences. Future Microbiol 2007, 2, 501–512. [Google Scholar] [CrossRef]
- Hong, D.J.; Bae, I.K.; Jang, I.H.; Jeong, S.H.; Kang, H.K.; Lee, K. Epidemiology and Characteristics of Metallo-ß-Lactamase-Producing Pseudomonas aeruginosa. Infect Chemother 2015, 47, 81–97. [Google Scholar] [CrossRef] [PubMed]
- Catho, G.; Martischang, R.; Boroli, F.; Chraïti, M.N.; Martin, Y.; Koyluk Tomsuk, Z.; Renzi, G.; Schrenzel, J.; Pugin, J.; Nordmann, P.; et al. Outbreak of Pseudomonas aeruginosa Producing VIM Carbapenemase in an Intensive Care Unit and Its Termination by Implementation of Waterless Patient Care. Crit Care 2021, 25, 1–10. [Google Scholar] [CrossRef]
- Manaia, C.M.; Macedo, G.; Fatta-Kassinos, D.; Nunes, O.C. Antibiotic Resistance in Urban Aquatic Environments: Can it be Controlled? Appl Microbiol Biotechnol 2016, 100, 1543–1557. [Google Scholar] [CrossRef]
- Rodriguez-Mozaz, S.; Chamorro, S.; Marti, E.; Huerta, B.; Gros, M.; Sànchez-Melsió, A.; Borrego, C.M.; Barceló, D.; Balcázar, J.L. Occurrence of Antibiotics and Antibiotic Resistance Genes in Hospital and Urban Wastewaters and Their Impact on the Receiving River. Water Res 2015, 69, 234–242. [Google Scholar] [CrossRef]
- Basiry, D.; Entezari Heravi, N.; Uluseker, C.; Kaster, K.M.; Kommedal, R.; Pala-Ozkok, I. The Effect of Disinfectants and Antiseptics on Co- and Cross-Selection of Resistance to Antibiotics in Aquatic Environments and Wastewater Treatment Plants. Front Microbiol 2022, 13, 1050558. [Google Scholar] [CrossRef]
- Uluseker, C.; Kaster, K.M.; Thorsen, K.; Basiry, D.; Shobana, S.; Jain, M.; Kumar, G.; Kommedal, R.; Pala-Ozkok, I. A Review on Occurrence and Spread of Antibiotic Resistance in Wastewaters and in Wastewater Treatment Plants: Mechanisms and Perspectives. Front Microbiol 2021, 12, 717809. [Google Scholar] [CrossRef] [PubMed]
- Díaz-Gavidia, C.; Barría, C.; Rivas, L.; García, P.; Alvarez, F.P.; González-Rocha, G.; Opazo-Capurro, A.; Araos, R.; Munita, J.M.; Cortes, S.; et al. Isolation of Ciprofloxacin and Ceftazidime-Resistant Enterobacterales from Vegetables and River Water is Strongly Associated with the Season and the Sample Type. Front Microbiol 2021, 2554. [Google Scholar] [CrossRef] [PubMed]
- Trick, W.E. Decision Making During Healthcare-Associated Infection Surveillance: A Rationale for Automation. Clinl Infect Dis 2013, 57, 434–440. [Google Scholar] [CrossRef] [PubMed]
- Bizzini, A.; Greub, G. Matrix-Assisted Laser Desorption Ionization Time-of-Flight Mass Spectrometry, a Revolution in Clinical Microbial Identification. Clin Microbiol and Infect 2010, 16, 1614–1619. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute Performance Standards for Antimicrobial Susceptibility Testing. Manual M100; 33rd ed.; Clinical and Laboratory Standards Institute, 2023.
- Clinical and Laboratory Standards Institute Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria. Manual M45; 3rd ed.; Clinical and Laboratory Standards Institute, 2016.
- Magiorakos, A.-P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B. Multidrug-Resistant, Extensively Drug-Resistant and Pandrug-Resistant Bacteria: An International Expert Proposal for Interim Standard Definitions for Acquired Resistance. Clin Microbiol infect 2012, 18, 268–281. [Google Scholar] [CrossRef]
- Maccari, L.; Ceriana, P.; Granchetti, H.N.; Pezzaniti, A.V.; Lucero, C.; Rapoport, M.; Menocal, A.; Corso, A.; Pasteran, F. Improved Blue Carba Test and Carba NP Test for Detection and Classification of Major Class A and B Carbapenemases, Including Dual Producers, among Gram-Negative Bacilli. J Clin Microbiol 2024, 62, e01255–23. [Google Scholar] [CrossRef]
- Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for Detection of Acquired Carbapenemase Genes. Diagn Microbiol Infect Dis 2011, 70, 119–123. [Google Scholar] [CrossRef]
- Wolter, D.J.; Khalaf, N.; Robledo, I.E.; Vázquez, J.G.; Santé, I.M.; Aquino, E.E.; Goering, R. V.; Hanson, N.D. Surveillance of Carbapenem-Resistant Pseudomonas aeruginosa Isolates from Puerto Rican Medical Center Hospitals: Dissemination of KPC and IMP-18 β-Lactamases. Antimicrob Agents Chemother 2009, 53, 1660–1664. [Google Scholar] [CrossRef]
- Ellington, M.J.; Kistler, J.; Livermore, D.M.; Woodford, N. Multiplex PCR for Rapid Detection of Genes Encoding Acquired Metallo-β-Lactamases. J Antimicrob Chemother 2007, 59, 321–322. [Google Scholar] [CrossRef]




| Gene | Primer Sequences (5'-3') | Amplicon Size (bp) | PCR conditions | Ref | ||
| blaKPC | F: CGTCTAGTTCTGCTGTCTTG R: CTTGTCATCCTTGTTAGGCG | 798 | 95 ºC | 10 min | 30 cycles | [50] |
| 95 ºC | 30 sec | |||||
| 55 ºC | 30 sec | |||||
| 72 ºC | 1 min | |||||
| 72 ºC | 10 min | |||||
| blaVIM | F: GGTGTTTGGTCGCATATCGC R: CCATTCAGCCAGATCGGCATC | 504 | 95 ºC | 10 min | 30 cycles | [51] |
| 95 ºC | 30 sec | |||||
| 60 ºC | 30 sec | |||||
| 72 ºC | 30 sec | |||||
| 72 ºC | 10 min | |||||
| blaNDM | F: GGTTTGGCGATCTGGTTTTC R: CGGTGATATTGTCACTGGTGTGG | 452 | 95 ºC | 10 min | 30 cycles | [50] |
| 95 ºC | 30 sec | |||||
| 60 ºC | 30 sec | |||||
| 72 ºC | 30 sec | |||||
| 72 ºC | 10 min | |||||
| blaIMP | F: GGAATAGAGTGGCTTAAYTCT R: CCAACYACTASGTTATCT | 188 | 95 ºC | 10 min | 30 cycles | [52] |
| 95 ºC | 30 sec | |||||
| 55 ºC | 30 sec | |||||
| 72 ºC | 15 min | |||||
| 72 ºC | 10 min | |||||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).