Submitted:
19 April 2025
Posted:
21 April 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and DNA Extraction
2.2. Primers and Probes
2.3. Multienzyme Isothermal Rapid Amplification (MIRA) and Lateral-Flow Dipstick (LFD)
2.4. Optimization of MIRA-LFD Assay
2.5. Sensitivity and Specificity of MIRA-LFD Assay
2.6. Multiplex PCR
2.7. Statistical Analysis
3. Results and Discussion
3.1. Validation of Primers and Probes
3.2. Optimization of MIRA-LFD
3.3. Sensitivity and Specificity of MIRA-LFD Assay
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, R.; Zhong, Y.; Gu, X.; Yuan, J.; Saeed, A.F.; Wang, S. The pathogenesis, detection, and prevention of Vibrio parahaemolyticus. Frontiers in microbiology 2015, 6, 144. [Google Scholar] [CrossRef] [PubMed]
- Baker-Austin, C.; Trinanes, J.; Gonzalez-Escalona, N.; Martinez-Urtaza, J. Non-cholera vibrios: the microbial barometer of climate change. Trends in microbiology 2017, 25, 76–84. [Google Scholar] [CrossRef] [PubMed]
- DePaola, A.; Nordstrom, J.L.; Bowers, J.C.; Wells, J.G.; Cook, D.W. Seasonal abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters. Applied and environmental microbiology 2003, 69, 1521–1526. [Google Scholar] [CrossRef]
- Froelich, B.A.; Noble, R.T. Vibrio bacteria in raw oysters: managing risks to human health. Philosophical Transactions of the Royal Society B: Biological Sciences 2016, 371, 20150209. [Google Scholar] [CrossRef]
- Martinez-Urtaza, J.; Baker-Austin, C.; Jones, J.L.; Newton, A.E.; Gonzalez-Aviles, G.D.; DePaola, A. Spread of Pacific northwest Vibrio parahaemolyticus strain. New England Journal of Medicine 2013, 369, 1573–1574. [Google Scholar] [CrossRef]
- Newton, A.E.; Garrett, N.; Stroika, S.G.; Halpin, J.L.; Turnsek, M.; Mody, R.K. Notes from the field: increase in Vibrio parahaemolyticus infections associated with consumption of atlantic coast shellfish-2013. MMWR Morb Mortal Wkly Rep 2014, 63, 335–336. [Google Scholar]
- DePaola, A. Managing Vibrio Risk in Oysters. Food Protection Trends 2019, 39, 338–347. [Google Scholar]
- Gutierrez West, C.K.; Klein, S.L.; Lovell, C.R. High frequency of virulence factor genes tdh, trh, and tlh in Vibrio parahaemolyticus strains isolated from a pristine estuary. Applied and environmental microbiology 2013, 79, 2247–2252. [Google Scholar] [CrossRef]
- Li, L.; Meng, H.; Gu, D.; Li, Y.; Jia, M. Molecular mechanisms of Vibrio parahaemolyticus pathogenesis. Microbiological Research 2019, 222, 43–51. [Google Scholar] [CrossRef]
- Liu, J.; Tong, J.; Wu, Q.; Liu, J.; Yuan, M.; Tian, C.; Xu, H.; Malakar, P.K.; Pan, Y.; Zhao, Y. Natural inhibitors targeting the localization of lipoprotein system in Vibrio parahaemolyticus. International Journal of Molecular Sciences 2022, 23, 14352. [Google Scholar] [CrossRef]
- Park, K.S.; Ono, T.; Rokuda, M.; Jang, M.H.; Okada, K.; Iida, T.; Honda, T. Functional characterization of two type III secretion systems of Vibrio parahaemolyticus. Infection and immunity 2004, 72, 6659–6665. [Google Scholar] [CrossRef] [PubMed]
- Shirai, H.; Ito, H.; Hirayama, T.; Nakamoto, Y.; Nakabayashi, N.; Kumagai, K.; Takeda, Y.; Nishibuchi, M. Molecular epidemiologic evidence for association of thermostable direct hemolysin (TDH) and TDH-related hemolysin of Vibrio parahaemolyticus with gastroenteritis. Infection and immunity 1990, 58, 3568–3573. [Google Scholar] [CrossRef] [PubMed]
- Broberg, C.A.; Calder, T.J.; Orth, K. Vibrio parahaemolyticus cell biology and pathogenicity determinants. Microbes and infection 2011, 13, 992–1001. [Google Scholar] [CrossRef] [PubMed]
- Honda, T.; Iida, T. The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct haemolysin and related haemolysins. Reviews and Research in Medical Microbiology 1993, 4, 106–113. [Google Scholar] [CrossRef]
- Hongping, W.; Jilun, Z.; Ting, J.; Yixi, B.; Xiaoming, Z. Insufficiency of the Kanagawa hemolytic test for detecting pathogenic Vibrio parahaemolyticus in Shanghai, China. Diagnostic microbiology and infectious disease 2011, 69, 7–11. [Google Scholar] [CrossRef]
- Vieira, R.H.; Costa, R.A.; Menezes, F.G.; Silva, G.C.; Theophilo, G.N.; Rodrigues, D.P.; Maggioni, R. Kanagawa-negative, tdh-and trh-positive Vibrio parahaemolyticus isolated from fresh oysters marketed in Fortaleza, Brazil. Current microbiology 2011, 63, 126–130. [Google Scholar] [CrossRef]
- Thongjun, J.; Mittraparp-Arthorn, P.; Yingkajorn, M.; Kongreung, J.; Nishibuchi, M.; Vuddhakul, V. The trend of Vibrio parahaemolyticus infections in Southern Thailand from 2006 to 2010. Tropical medicine and health 2013, 41, 151–156. [Google Scholar] [CrossRef]
- Ohnishi, K.; Nakahira, K.; Unzai, S.; Mayanagi, K.; Hashimoto, H.; Shiraki, K.; Honda, T.; Yanagihara, I. Relationship between heat-induced fibrillogenicity and hemolytic activity of thermostable direct hemolysin and a related hemolysin of Vibrio parahaemolyticus. FEMS microbiology letters 2011, 318, 10–17. [Google Scholar] [CrossRef]
- Bej, A.K.; Patterson, D.P.; Brasher, C.W.; Vickery, M.C.; Jones, D.D.; Kaysner, C.A. Detection of total and hemolysin-producing Vibrio parahaemolyticus in shellfish using multiplex PCR amplification of tl, tdh and trh. Journal of microbiological methods 1999, 36, 215–225. [Google Scholar] [CrossRef]
- Kaysner, C.A.; DePaola, A.; Jones, J. Bacteriological analytical manual chapter 9: Vibrio. Food and Drug Administration, Maryland.[https://www. fda. gov/food/laboratory-methods-food/bam-chapter-9-vibrio]. Reviewed: December 2004, 19, 2019. [Google Scholar]
- Nordstrom, J.L.; Vickery, M.C.; Blackstone, G.M.; Murray, S.L.; DePaola, A. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of total and pathogenic Vibrio parahaemolyticus bacteria in oysters. Applied and Environmental Microbiology 2007, 73, 5840–5847. [Google Scholar] [CrossRef] [PubMed]
- Park, S.B.; Zhang, Y. Development of multienzyme isothermal rapid amplification (MIRA) combined with lateral-flow dipstick (LFD) assay to detect species-specific tlh and pathogenic trh and tdh genes of Vibrio parahaemolyticus. Pathogens 2024, 13, 57. [Google Scholar] [CrossRef] [PubMed]
- Guo, Y.; Zhang, L.; Yang, Y.; Li, J.; Luan, X.; Gong, S.; Ma, Y.; Gu, W.; Du, J.; Meng, Q. Development and application of the MIRA and MIRA-LFD detection methods of Spiroplasma eriocheiris. J Invertebr Pathol 2023, 108017. [Google Scholar] [CrossRef] [PubMed]
- Ji, C.; Feng, Y.; Sun, R.; Gu, Q.; Zhang, Y.; Ma, J.; Pan, Z.; Yao, H. Development of a multienzyme isothermal rapid amplification and lateral flow dipstick combination assay for bovine coronavirus detection. Front Vet Sci 2022, 9, 1059934. [Google Scholar] [CrossRef]
- Glover, W.A. Laboratory Method for Vibrio parahaemolyticus (V.p.) Enumeration and detection through MPN and real-time PCR in proceedings of the interstate shellfish sanitation conference (ISSC) Columbia, SC 29223-1740 2015.
- Rizvi, A.V.; Bej, A.K. Multiplexed real-time PCR amplification of tlh, tdh and trh genes in Vibrio parahaemolyticus and its rapid detection in shellfish and Gulf of Mexico water. Antonie Van Leeuwenhoek 2010, 98, 279–290. [Google Scholar] [CrossRef]
- Park, S.B.; Zhang, Y. Innovative multiplex PCR assay for detection of tlh, trh, and tdh genes in Vibrio parahaemolyticus with reference to the US FDA’s Bacteriological Analytical Manual (BAM). Pathogens 2024, 13, 774. [Google Scholar] [CrossRef]
- Nordstrom, J.; Kaysner, C.; Blackstone, G.; Vickery, M.; Bowers, J.; DePaola, A. Effect of intertidal exposure on Vibrio parahaemolyticus levels in Pacific Northwest oysters. Journal of food protection 2004, 67, 2178–2182. [Google Scholar] [CrossRef]
- National Shellfish Sanitation Program (NSSP)—Guide for the Control of Molluscan Shellfish 2023 Revision. Available online: https://www.fda.gov/food/federal-state-local-tribal-and-territorial-cooperative-human-food-programs/national-shellfish-sanitation-program-nssp (accessed on 19 May 2024).
- Daher, R.K.; Stewart, G.; Boissinot, M.; Bergeron, M.G. Recombinase polymerase amplification for diagnostic applications. Clinical chemistry 2016, 62, 947–958. [Google Scholar] [CrossRef]
- Crannell, Z.A.; Rohrman, B.; Richards-Kortum, R. Equipment-free incubation of recombinase polymerase amplification reactions using body heat. PloS one 2014, 9, e112146. [Google Scholar] [CrossRef]
- Kim, J.Y.; Lee, J.L. Development of a multiplex real-time recombinase polymerase amplification (RPA) assay for rapid quantitative detection of Campylobacter coli and jejuni from eggs and chicken products. Food control 2017, 73, 1247–1255. [Google Scholar] [CrossRef]
- Larrea-Sarmiento, A.; Stack, J.P.; Alvarez, A.M.; Arif, M. Multiplex recombinase polymerase amplification assay developed using unique genomic regions for rapid on-site detection of genus Clavibacter and C. nebraskensis. Scientific reports 2021, 11, 12017. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.B.; Du, X.J.; Zang, Y.X.; Li, P.; Wang, S. SERS-based lateral flow strip biosensor for simultaneous detection of Listeria monocytogenes and Salmonella enterica serotype enteritidis. Journal of agricultural and food chemistry 2017, 65, 10290–10299. [Google Scholar] [CrossRef] [PubMed]
- Ma, B.; Li, J.; Chen, K.; Yu, X.; Sun, C.; Zhang, M. Multiplex recombinase polymerase amplification assay for the simultaneous detection of three foodborne pathogens in seafood. Foods 2020, 9, 278. [Google Scholar] [CrossRef] [PubMed]
- Tan, M.; Liao, C.; Liang, L.; Yi, X.; Zhou, Z.; Wei, G. Recent advances in recombinase polymerase amplification: Principle, advantages, disadvantages and applications. Frontiers in Cellular and Infection Microbiology 2022, 12, 1744. [Google Scholar] [CrossRef]
- Ahsan, H. Monoplex and multiplex immunoassays: approval, advancements, and alternatives. Comparative clinical pathology 2022, 31, 333–345. [Google Scholar] [CrossRef]
- Ali, M.E.; Razzak, M.A.; Hamid, S.B.A. Multiplex PCR in species authentication: probability and prospects—a review. Food Analytical Methods 2014, 7, 1933–1949. [Google Scholar] [CrossRef]
- Becherer, L.; Borst, N.; Bakheit, M.; Frischmann, S.; Zengerle, R.; von Stetten, F. Loop-mediated isothermal amplification (LAMP)–review and classification of methods for sequence-specific detection. Analytical Methods 2020, 12, 717–746. [Google Scholar] [CrossRef]
- Kreitmann, L.; Miglietta, L.; Xu, K.; Malpartida-Cardenas, K.; D'Souza, G.; Kaforou, M.; Brengel-Pesce, K.; Drazek, L.; Holmes, A.; Rodriguez-Manzano, J. Next-generation molecular diagnostics: Leveraging digital technologies to enhance multiplexing in real-time PCR. TrAC Trends in Analytical Chemistry 2023, 160, 116963. [Google Scholar] [CrossRef]
- Hu, W.W.; He, J.W.; Guo, S.L.; Li, J. Development and evaluation of a rapid and sensitive multienzyme isothermal rapid amplification with a lateral flow dipstick assay for detection of Acinetobacter baumannii in spiked blood specimens. Frontiers in Cellular and Infection Microbiology 2022, 1473. [Google Scholar] [CrossRef]
- Drake, S.L.; DePaola, A.; Jaykus, L.A. An overview of Vibrio vulnificus and Vibrio parahaemolyticus. Comprehensive reviews in food science and food safety 2007, 6, 120–144. [Google Scholar] [CrossRef]
- Saetang, J.; Sukkapat, P.; Palamae, S.; Singh, P.; Senathipathi, D.N.; Buatong, J.; Benjakul, S. Multiplex PCR-Lateral Flow Dipstick Method for Detection of Thermostable Direct Hemolysin (TDH) Producing V. parahaemolyticus. Biosensors 2023, 13, 698. [Google Scholar] [CrossRef] [PubMed]
- Heng, P.; Liu, J.; Song, Z.; Wu, C.; Yu, X.; He, Y. Rapid detection of Staphylococcus aureus using a novel multienzyme isothermal rapid amplification technique. Frontiers in Microbiology 2022, 13, 1027785. [Google Scholar] [CrossRef] [PubMed]
- Ma, Q.; Yao, J.; Yuan, S.; Liu, H.; Wei, N.; Zhang, J.; Shan, W. Development of a lateral flow recombinase polymerase amplification assay for rapid and visual detection of Cryptococcus neoformans/C. gattii in cerebral spinal fluid. BMC infectious diseases 2019, 19, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Niu, J.; Sun, M.; Li, Z.; Wang, X.; He, Y.; Qi, J. Rapid and sensitive detection of Streptococcus iniae in Trachinotus ovatus based on multienzyme isothermal rapid amplification. International Journal of Molecular Sciences 2023, 24, 7733. [Google Scholar] [CrossRef]
- Zhu, L.; Gong, F.; Liu, X.; Sun, X.; Yu, Y.; Shu, J.; Pan, Z. Integrating filter paper extraction, isothermal amplification, and lateral flow dipstick methods to detect Streptococcus agalactiae in milk within 15 min. Frontiers in Veterinary Science 2023, 10, 1100246. [Google Scholar] [CrossRef]
- Zhan, Z.; He, S.; Cui, Y.; Yang, J.; Shi, X. Development of a multiplex recombinase polymerase amplification coupled with lateral flow dipsticks for the simultaneous rapid detection of Salmonella spp., Salmonella Typhimurium and Salmonella Enteritidis. Food Quality and Safety 2024, 8, fyad059. [Google Scholar] [CrossRef]
- Moon, Y.J.; Lee, S.Y.; Oh, S.W. A review of isothermal amplification methods and food-origin inhibitors against detecting food-borne pathogens. Foods 2022, 11, 322. [Google Scholar] [CrossRef]
- Hossain, M.T.; Kim, Y.O.; Kong, I.S. Multiplex PCR for the detection and differentiation of Vibrio parahaemolyticus strains using the groEL, tdh and trh genes. Molecular and cellular probes 2013, 27, 171–175. [Google Scholar] [CrossRef]
- Izumiya, H.; Matsumoto, K.; Yahiro, S.; Lee, J.; Morita, M.; Yamamoto, S.; Arakawa, E.; Ohnishi, M. Multiplex PCR assay for identification of three major pathogenic Vibrio spp., Vibrio cholerae, Vibrio parahaemolyticus, and Vibrio vulnificus. Molecular and cellular probes 2011, 25, 174–176. [Google Scholar] [CrossRef]
- Nishibuchi, M.; Janda, J.M.; Ezaki, T. The thermostable direct hemolysin gene (tdh) of Vibrio hollisae is dissimilar in prevalence to and phylogenetically distant from the tdh genes of other vibrios implications in the horizontal transfer of the tdh gene. Microbiology and immunology 1996, 40, 59–65. [Google Scholar] [CrossRef]
- Wong, H.C.; You, W.Y.; Chen, S.Y. Detection of toxigenic Vibrio cholerae, V. parahaemolyticus and V. vulnificus in oyster by multiplex-PCR with internal amplification control. Journal of Food and Drug Analysis 2012, 20, 11. [Google Scholar] [CrossRef]



| Gene | Name | Sequence (5' - 3') | amplicon size (bp) |
| TDH | VP_TDH_F1 | CTGTGAACATTAATGATAAAGACTATACAA | 145 |
| VP_TDH_Probe | /56-FAM/AGCTTCAACATTCCTATGATTCTGTAGCTA/idSp/CTTTGTTGGTGAAGA/3SpC3/ | ||
| VP_TDH_R1_Dig | Digoxigenin-ATTACCAATATATTACCACTACCACTCTCATA | ||
| VP_TDH_R1_Bio | Biotin-ATTACCAATATATTACCACTACCACTCTCATA | ||
| TRH | VP_TRH_F1 | ACTCTACTTTGCCTTCAGTTTGCTATTGGCTTC | 141 |
| VP_TRH_Probe | /56-FAM/TGAGCTACTATTTGTCGTTAGAAATACAAC/idSp/ATAAAAACTGAATCA/3SpC3/ | ||
| VP_TRH_R1_Bio | Biotin-GAAGTCGTGAAAATAGATTGACCGTGAACGCT | ||
| VP_TRH_R1_Dig | Digoxigenin-GAAGTCGTGAAAATAGATTGACCGTGAACGCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).