Submitted:
31 March 2025
Posted:
01 April 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Fungal Strains and Macroscopic Characterisation
2.2. Soil Sample
2.3. Microscopic Characterisation
2.4. MALDI-TOF MS Identification
2.5. Antifungal Susceptibility Tests
2.6. BiologTM Phenotypic Microarray Analysis
2.7. DNA Extraction, PCR Amplification, and Sanger Sequencing
2.8. Phylogenetic Analysis
3. Results
3.1. Macroscopic Characterisation
3.2. Microscopic Characteristion
3.3. MALDI-TOF MS Identification
3.4. Physiological/Phenotypic Analysis with the BiologTM System
3.5. Antifungal Susceptibility Testing
3.6. DNA Sequence-Based Identification
3.7. Phylogenetic Analyses
3.8. Taxonomy
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- H. Bonorden, Handbuch der allgemeinen Mykologie als Anleitung zum Studium derselben, nebst speziellen Beiträgen zur Vervollkommung dieses Zweiges der. 1851.
- T. Gräfenhan, H. J. Schroers, H. I. Nirenberg, and K. A. Seifert, “An overview of the taxonomy, phylogeny, and typification of nectriaceous fungi in Cosmospora, Acremonium, Fusarium, Stilbella, and Volutella,” Stud. Mycol., vol. 68, pp. 79–113, Mar. 2011. [CrossRef]
- C. Lechat and A. Rossman, “A new species of Fusicolla (Hypocreales), F. ossicola, from Belgium,” 2017. [CrossRef]
- E. B. G. Jones et al., “Phylogeny of new marine Dothideomycetes and Sordariomycetes from mangroves and deep-sea sediments,” Bot. Mar., vol. 63, no. 2, pp. 155–181, Apr. 2020. [CrossRef]
- K. D. Hyde, D. Mc, J. Ebg, M. Ssn, S. Vv, and H. Kd, “Morpho-molecular characterization of microfungi associated with marine based habitats,”. [CrossRef]
- Y. Jeong Jeon, J. Goh, and H. Yeon Mun, “The Korean Journal of Mycology 국내 기수역 환경의 균류 다양성 Diversity of Fungi in Brackish Water in Korea,” Korean J. Mycol., vol. 48, no. 4, pp. 457–473, 2020. [CrossRef]
- Singh, P. N. Singh, and G. Nath, “Article in Doga,” Turk. J. Botany, 2021. [CrossRef]
- C. Liu, W. Y. Zhuang, Z. H. Yu, and Z. Q. Zeng, “Two new species of Fusicolla (Hypocreales) from China,” Phytotaxa, vol. 536, no. 2, pp. 165–174, Feb. 2022. [CrossRef]
- Z. Q. Zeng and W. Y. Zhuang, “Three New Species of Fusicolla (Hypocreales) from China,” J. Fungi 2023, Vol. 9, Page 572, vol. 9, no. 5, p. 572, May 2023. [CrossRef]
- L. Lombard, N. A. van der Merwe, J. Z. Groenewald, and P. W. Crous, “Generic concepts in Nectriaceae,” Stud. Mycol., vol. 80, p. 189, 2015. [CrossRef]
- V. Robert et al., “MycoBank gearing up for new horizons,” IMA Fungus, vol. 4, no. 2, pp. 371–379, Dec. 2013. [CrossRef]
- C. Cassagne, A. C. Normand, C. L’Ollivier, S. Ranque, and R. Piarroux, “Performance of MALDI-TOF MS platforms for fungal identification,” Mycoses, vol. 59, no. 11, pp. 678–690, Nov. 2016. [CrossRef]
- K. Tamura, G. Stecher, and S. Kumar, “MEGA11: Molecular Evolutionary Genetics Analysis Version 11,” Mol. Biol. Evol., vol. 38, no. 7, pp. 3022–3027, Jun. 2021. [CrossRef]
- J. C. Lagier et al., “Microbial culturomics: Paradigm shift in the human gut microbiome study,” Clin. Microbiol. Infect., vol. 18, no. 12, pp. 1185–1193, Dec. 2012. [CrossRef]
- F. Bittar, F. Gouriet, S. Khelaifia, D. Raoult, and S. Ranque, “FastFung: A novel medium for the culture and isolation of fastidious fungal species from clinical samples,” J. Microbiol. Methods, vol. 180, Jan. 2021. [CrossRef]
- E. Menu, Q. Filori, J. C. Dufour, S. Ranque, and C. L’Ollivier, “A Repertoire of Clinical Non-Dermatophytes Moulds,” J. fungi (Basel, Switzerland), vol. 9, no. 4, Apr. 2023. [CrossRef]
- T. J. White, T. Bruns, S. Lee, and J. Taylor, “AMPLIFICATION AND DIRECT SEQUENCING OF FUNGAL RIBOSOMAL RNA GENES FOR PHYLOGENETICS,” PCR Protoc., pp. 315–322, 1990. [CrossRef]
- N. L. Glass and G. C. Donaldson, “Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes,” Appl. Environ. Microbiol., vol. 61, no. 4, pp. 1323–1330, 1995. [CrossRef]
- Carbone and L. M. Kohn, “A method for designing primer sets for speciation studies in filamentous ascomycetes,” Mycologia, vol. 91, no. 3, pp. 553–556, May 1999. [CrossRef]
- “(PDF) Atlas of clinical fungi (2nd edn). G.S. de Hoog, J. Guarro, J. Gené, M.J. Figueras.” https://www.researchgate.net/publication/41903192_Atlas_of_clinical_fungi_2nd_edn_GS_de_Hoog_J_Guarro_J_Gene_MJ_Figueras (accessed Apr. 08, 2024).




| Primers | Sequences | Targeted Regions | References |
|---|---|---|---|
| ITS1 | TCCGTAGGTGAACCTGCGG | 18S-5.8S | [17] |
| ITS2 | GCTGCGTTCTTCATCGATGC | 18S-5.8S | [17] |
| ITS3 | GCATCGATGAAGAACGCAGC | 5.8S-28S | [17] |
| ITS4 | TCCTCCGCTTATTGATATGC | 5.8S-28S | [17] |
| ITS1 | TCCGTAGGTGAACCTGCGG | 18S-5.8S, 5.8S-28S | [17] |
| ITS4 | TCCTCCGCTTATTGATATGC | 18S-5.8S, 5.8S-28S | [17] |
| Bt-2a | CATCGAGAAGTTCGAGAAGG | B-tub2 | [18] |
| Bt-2b | TACTTGAAGGAACCCTTACC | B-tub2 | [18] |
| EF1-728F | GGTAACCAAATCGGTGCTGCTTTC | TEF1 | [19] |
| EF1-986R | ACCCTCAGTGTAGTGACCCTTGGC | TEF1 | [19] |
| D1 | AACTTAAGCATATCAATAAGCGGAGGA | 28S | [20] |
| D2 | GGTCCGTGTTTCAAGACGG | 28S | [20] |
| fRPB2-5F | GAYGAYMGWGATCAYTTYGG | RNA polymerase II gene | [2] |
| fRPB2-7cr | CCCATRGCTTGTYYRCCCAT | RNA polymerase II gene | [2] |
| Species | Herbarium/Strain Numbers | Genbank Accession Numbers | |||
|---|---|---|---|---|---|
| ITS | LSU | Btub2 | RPB2 | ||
| F. acetilerea | BBA:63789T | HQ897790.1 | U88108.1 | - | HQ897701.1 |
| F. aeria | CGMCC:3.24908T | OQ128334.1 | OQ128338.1 | OQ134100.1 | OQ134111.1 |
| F. aquaeductuum | CBS:837.85T | NR_173406.1 | NG_076686.1 | KM232094.1 | HQ897744.1 |
| F. betae | BBA:64317T | OW983080.1* | - | - | HQ897781.1 |
| F. bharatavarshae | NFCCI:4423T | MK152510.1 | MK152511.1 | MK376462.1 | MK157022.1 |
| F. cassiae-fistulae | MFLUCC:19-0318T | NR_171299.1 | NG_073862.1 | - | - |
| F. coralloidea | CGMCC:3.24907T | OQ128333.1 | OQ128337.1 | OQ134099.1 | OQ134110.1 |
| F. elongata | CBS:148934T | ON763203.1 | ON763200.1 | ON745628.1 | ON759297.1 |
| F. epistroma | BBA:62201T | OP179099.1* | AF228352.1 | - | HQ897765.1 |
| F. filiformis | CGMCC:3.24910T | OQ128332.1 | OQ128336.1 | OQ134098.1 | OQ134109.1 |
| F. gigantispora | MFLU:16-1206T | MN047104.1 | MN017869.1 | - | - |
| F. gigas | CGMCC:3.20680T | OK465362.1 | OK465449.1 | OQ134102.1* | OQ134113.1* |
| F. guangxiensis | CGMCC:3.20679T | OK465363.1 | OK465450.1 | - | OQ134114.1 |
| F. hughesii | NFCCI:4234T | MG779450.1 | MG779452.1 | - | - |
| F. matuoi | CBS:581.78T | KM231822.1 | KM231698.1 | KM232093.1 | HQ897720.1 |
| F. melogrammae | CBS:141092T | NR_155096.1 | NG_058275.1 | MW834305.1 | - |
| F. meniscoidea | CBS:110189T | MW827613.1 | MW827654.1 | MW834306.1 | MW834010.1 |
| F. merismoides | CBS:186.34T | MH855482.1 | MH866963.1 | - | - |
| F. ossicola | CBS:140161T | NR_161034.1 | MF628021.1 | MW834307.1 | MW834011.1 |
| F. quarantenae | URM:8367T | MW553789.1 | MW553788.1 | MW556624.1 | MW556626.1 |
| F. reyesiana | PAD:S00015T | MT554915.1MT554892.1 | - | - | - |
| F. septimanifiniscientiae | CBS:144935T | MK069422.1 | MK069418.1 | MK069408.1 | - |
| F. siamensis | MFLUCC:17-2577T | NR_171300.1 | NG_073863.1 | - | - |
| F. sporellula | CBS:110191T | MW827614.1 | MW827655.1 | MW834308.1 | MW834012.1 |
| F. violacea | CBS:634.76T | KM231824.1 | KM231700.1 | KM232095.1 | HQ897696.1 |
| Corallomycetella repens | CBS:358.49T | MH856551.1 | KM231708.1 | KC479784.1 | KM232391.1 |
| Stylonectria applanata | CBS:125489T | HQ897805.1 | KM231689.1 | KM232083.1 | HQ897739.1 |
| Stylonectria wegeliniana | CBS:125490T | KM231817.1 | KM231690.1 | KM232084.1 | KM232240.1 |
| Clonostachys rosea | CBS:154.27T | MH854911.1 | MH866405.1 | AF358160.1 | OQ927866.1 |
| MIC * (mg/L) Read at 48 h | |||||
|---|---|---|---|---|---|
| AMB | ITC | POS | VOR | IVU ** | |
| Fusicolla sp. nov. Fo821 | 0.94 | > 32 | > 32 | > 32 | > 32 |
| S | R | R | R | R | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).