Submitted:
10 March 2025
Posted:
11 March 2025
You are already at the latest version
Abstract
Introduction: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus has undergone significant mutations since its emergence, resulting in a variety of antigenic variants. One of these variants is Omicron. Methods: In this study, the blood samples from 98 patients with acute coronavirus disease-19 (COVID-19) who were hospitalized during the initial SARS-CoV2 wave and the onset of Omicron infection in 2021 were analyzed. We used high-resolution melting (HRM) of PCR products to analyze RNA extracted from two clinical samples collected in July and November of 2021 from patients infected with the SARS-COV-2 virus. Results: HRM-analysis detected a characteristic deletion in the N-protein RNA of the virus isolated from November 2021 that is associated with the Omicron variant. Elevated levels of C-reactive protein (CRP), neutrophil-lymphocyte ratio (NLR), and interleukin-6 (IL-6) were observed in patients during both initial wave of COVID-19 and 2021 hospitalization. Additionally, complement levels were more frequently detected at the start of hospitalization during the second wave. IgG and IgM antibodies to SARS-CoV-2 were detected more often at the beginning of hospitalization during the second wave of COVID-19. During both outbreaks, an increase in hemagglutinin-inhibiting (HI) antibodies against Influenza A and B was observed in paired blood specimens from moderate to severe COVID-19 patients. Conclusions: Patients admitted during both waves of COVID-19 showed a significant rise in several inflammatory markers, suggesting that Omicron triggers significant inflammatory responses. The rapid formation of IgM and IgG in Omicron patients may indicate a faster immune response due to memory B cell formation after previous infections or vaccinations. Seasonal flu may negatively impact the clinical course of coronavirus infections. Further research is needed to determine if clinical presentation and laboratory parameters change in response to variations in the SARS-CoV virus in breakthrough cases and in patients with post-COVID syndrome.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Participants and Samples
2.3. Molecular Genetic Analysis
2.4. Laboratory Data
2.5. Hemagglutination Inhibition Test (HI)
2.6. Statistical Analysis
3. Results
3.1. Molecular Genetic Analysis of the N Protein Gene of SARS-CoV-2 Antigenic Variants
3.2. The Main Data on the Observed Patient Cohorts
3.3. The Levels of Inflammatory Markers and Cytokines in the Serum Samples of Patients Examined
3.4. Antibodies to SARS-CoV-2 Analyzed Patient Cohorts
3.5. Increases in Serum HI Antibodies to Influenza Viruses in Paired Blood Sera
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| COVID-19 | coronavirus disease-19 |
| CRP | C-reactive protein |
| HI | Hemagglutination Inhibition |
| HRM | High-Resolution Melting |
| IFN-α | Interferon 1 alpha |
| IL-6 | Interleukin-6 |
| Me | Medians |
| M-MulV RT | Moloney Murine Leukemia Virus Reverse Transcriptase |
| NLR | NLR neutrophil/lymphocyte ratio |
| Q1; Q3 | Lower and upper quartiles |
| RBCs | Red Blood Cells |
| SARS-CoV-2 | Severe acute respiratory syndrome coronavirus 2 () |
| TNF-α | Tumor Necrosis Factor alpha |
References
- Kawamura, S.; Yamaguchi, F.; Kusakado, R.; Go, Y.; Nohmi, S.; Yoshizaki, C.; Yoshida, Y.; Izumizaki, K.; Saito, Y.; Kobayashi, H.; et al. Changes in Clinical Features and Severity of COVID-19 with the Emergence of Omicron Variants: A Shift Towards a Common Disease. Infect. Drug Resist. 2024, ume 17, 5595–5603. [CrossRef]
- Akimkin V., et al. COVID-19 epidemic process and evolution of SARS-CoV-2 genetic variants in the Russian Federation // Microbiology Research. – 2024. – Т. 15, № 1. – С. 213–224.
- Meo, S.A.; Meo, A.S.; Al-Jassir, F.F.; Klonoff, D.C. Omicron SARS-CoV-2 new variant: global prevalence and biological and clinical characteristics. European Review for Medical & Pharmacological Sciences 2021, 25, 8012–8018. [CrossRef]
- Long, B.; Carius, B.M.; Chavez, S.; Liang, S.Y.; Brady, W.J.; Koyfman, A.; Gottlieb, M. Clinical update on COVID-19 for the emergency clinician: Presentation and evaluation. Am. J. Emerg. Med. 2022, 54, 46–57. [CrossRef]
- Akimkin, V.G.; Popova, A.Y.; Khafizov, K.F.; Dubodelov, D.V.; Ugleva, S.V.; Semenenko, T.A.; Ploskireva, A.A.; Gorelov, A.V.; Pshenichnaya, N.Y.; Yezhlova, E.; et al. COVID-19: evolution of the pandemic in Russia. Report II: dynamics of the circulation of SARS-CoV-2 genetic variants. J. Microbiol. epidemiology Immunobiol. 2022, 99, 381–396. [CrossRef]
- Park, S.W.; Sun, K.; Abbott, S.; Sender, R.; Bar-On, Y.M.; Weitz, J.S.; Funk, S.; Grenfell, B.T.; Backer, J.A.; Wallinga, J.; et al. Inferring the differences in incubation-period and generation-interval distributions of the Delta and Omicron variants of SARS-CoV-2. Proc. Natl. Acad. Sci. 2023, 120. [CrossRef]
- Hui, K.P.Y.; Ho, J.C.W.; Cheung, M.-C.; Ng, K.-C.; Ching, R.H.H.; Lai, K.-L.; Kam, T.T.; Gu, H.; Sit, K.-Y.; Hsin, M.K.Y.; et al. SARS-CoV-2 Omicron variant replication in human bronchus and lung ex vivo. Nature 2022, 603, 715–720. [CrossRef]
- Ren, S. Y., Wang, W. B., Gao, R. D., & Zhou, A. M. (2022). Omicron variant (B. 1.1. 529) of SARS-CoV-2: Mutation, infectivity, transmission, and vaccine resistance. World journal of clinical cases, 10(1), 1.
- Xia, S.; Wang, L.; Zhu, Y.; Lu, L.; Jiang, S. Origin, virological features, immune evasion and intervention of SARS-CoV-2 Omicron sublineages. Signal Transduct. Target. Ther. 2022, 7, 1–7. [CrossRef]
- Liu, Y.; Huang, X.; Li, P.; Wang, D.; Yin, H.; Wang, N.; Luo, Y.; Li, H.; Sun, S. Clinical Profile and Outcome Analysis of Ear-Nose-Throat Symptoms in SARS-CoV-2 Omicron Subvariant Infections. Int. J. Public Heal. 2023, 68, 1606403. [CrossRef]
- Chemaitelly, H.; Ayoub, H.H.; Coyle, P.; Tang, P.; Hasan, M.R.; Yassine, H.M.; Al Thani, A.A.; Al-Kanaani, Z.; Al-Kuwari, E.; Jeremijenko, A.; et al. Differential protection against SARS-CoV-2 reinfection pre- and post-Omicron. Nature 2025, 639, 1–8. [CrossRef]
- Ao, D., Lan, T., He, X., Liu, J., Chen, L., Baptista-Hon, D. T., ... & Wei, X. (2022). SARS-CoV-2 Omicron variant: immune escape and vaccine development. MedComm, 3(1), e126.
- Chatterjee, S.; Bhattacharya, M.; Nag, S.; Dhama, K.; Chakraborty, C. A Detailed Overview of SARS-CoV-2 Omicron: Its Sub-Variants, Mutations and Pathophysiology, Clinical Characteristics, Immunological Landscape, Immune Escape, and Therapies. Viruses 2023, 15, 167. [CrossRef]
- M Hussein, A., Majeed, H. A., Majeed, N. R., Ali, N. H., Saeed, D. A., & Ali, N. A. (2024). An Overview of Signs and Symptoms to Determine Coronavirus and Omicron Patients in Primary Care and Hospitals. Cihan University-Erbil Scientific Journal, 8(1), 8-17.
- Hansen, P.R. Relative contagiousness of emerging virus variants: An analysis of the Alpha, Delta, and Omicron SARS-CoV-2 variants. Econ. J. 2022, 25, 739–761. [CrossRef]
- Malik, Y.A. Covid-19 variants: Impact on transmissibility and virulence. The Malaysian journal of pathology 2022, 44, 387–396.
- Zabidi, N.Z.; Liew, H.L.; Farouk, I.A.; Puniyamurti, A.; Yip, A.J.W.; Wijesinghe, V.N.; Low, Z.Y.; Tang, J.W.; Chow, V.T.K.; Lal, S.K. Evolution of SARS-CoV-2 Variants: Implications on Immune Escape, Vaccination, Therapeutic and Diagnostic Strategies. Viruses 2023, 15, 944. [CrossRef]
- Fan, H.; Tian, M.; Liu, S.; Ye, C.; Li, Z.; Wu, K.; Zhu, C. Strategies Used by SARS-CoV-2 to Evade the Innate Immune System in an Evolutionary Perspective. Pathogens 2024, 13, 1117. [CrossRef]
- Afridonova, Z.E.; Toptygina, A.P.; Mikhaylov, I.S. Humoral and Cellular Immune Response to SARS-CoV-2 S and N Proteins. Biochem. (Moscow) 2024, 89, 872–882. [CrossRef]
- El-Maradny, Y.A.; Badawy, M.A.; Mohamed, K.I.; Ragab, R.F.; Moharm, H.M.; Abdallah, N.A.; Elgammal, E.M.; Rubio-Casillas, A.; Uversky, V.N.; Redwan, E.M. Unraveling the role of the nucleocapsid protein in SARS-CoV-2 pathogenesis: From viral life cycle to vaccine development. Int. J. Biol. Macromol. 2024, 279, 135201. [CrossRef]
- Rahman, M.S.; Islam, M.R.; Alam, A.S.M.R.U.; Islam, I.; Hoque, M.N.; Akter, S.; Rahaman, M.; Sultana, M.; Hossain, M.A. Evolutionary dynamics of SARS-CoV-2 nucleocapsid protein and its consequences. J. Med Virol. 2020, 93, 2177–2195. [CrossRef]
- Alosaimi, B.; Naeem, A.; Hamed, M.E.; Alkadi, H.S.; Alanazi, T.; Al Rehily, S.S.; Almutairi, A.Z.; Zafar, A. Influenza co-infection associated with severity and mortality in COVID-19 patients. Virol. J. 2021, 18, 1–9. [CrossRef]
- Wu, X.; Cai, Y.; Huang, X.; Yu, X.; Zhao, L.; Wang, F.; Li, Q.; Gu, S.; Xu, T.; Li, Y.; et al. Co-infection with SARS-CoV-2 and Influenza A Virus in Patient with Pneumonia, China. Emerg. Infect. Dis. 2020, 26, 1324–1326. [CrossRef]
- Cuadrado-Payán, E., Montagud-Marrahi, E., Torres-Elorza, M., Bodro, M., Blasco, M., Poch, E., ... & Piñeiro, G. J. (2020). SARS-CoV-2 and influenza virus co-infection. Lancet (London, England), 395(10236), e84.
- Shvedova, T.N.; Kopteva, O.S.; Kudar, P.A.; Lerner, A.A.; Desheva, Y.A. The role of coinfection with influenza viruses in the pathogenesis of severe infection in patients with COVID-19. Med Acad. J. 2021, 21, 159–164. [CrossRef]
- Dhanasekaran, V.; Sullivan, S.; Edwards, K.M.; Xie, R.; Khvorov, A.; Valkenburg, S.A.; Cowling, B.J.; Barr, I.G. Human seasonal influenza under COVID-19 and the potential consequences of influenza lineage elimination. Nat. Commun. 2022, 13, 1–11. [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [CrossRef]
- Desheva, Y.A.; Smolonogina, T.A.; Landgraf, G.O.; Rudenko, L.G. Development of the A/H6N1 influenza vaccine candidate based on A/Leningrad/134/17/57 (H2N2) master donor virus and the genome composition analysis using high resolution melting (HRM). Microbiol. Indep. Res. J. 2016, 3. [CrossRef]
- Katz, J.M.; Hancock, K.; Xu, X. Serologic assays for influenza surveillance, diagnosis and vaccine evaluation. Expert Rev. Anti-infective Ther. 2011, 9, 669–683. [CrossRef]
- Sharma, R., & Dubey, S. K. (2020). Computational Management of Alignment of Multiple Protein Sequences Using ClustalW. In First International Conference on Sustainable Technologies for Computational Intelligence: Proceedings of ICTSCI 2019 (pp. 177-186). Springer Singapore.
- O’toole, Á.; Pybus, O.G.; Abram, M.E.; Kelly, E.J.; Rambaut, A. Pango lineage designation and assignment using SARS-CoV-2 spike gene nucleotide sequences. BMC Genom. 2022, 23, 1–13. [CrossRef]
- Liang, F. Quantitative Mutation Analysis of Genes and Proteins of Major SARS-CoV-2 Variants of Concern and Interest. Viruses 2023, 15, 1193. PMID: 37243278; PMCID: PMC10222255. [CrossRef]
- Sui, J.; Noubouossie, D.F.; Gandotra, S.; Cao, L. Elevated Plasma Fibrinogen Is Associated With Excessive Inflammation and Disease Severity in COVID-19 Patients. Front. Cell. Infect. Microbiol. 2021, 11, 734005. [CrossRef]
- Xiao, M.T.; Ellsworth, C.R.; Qin, X. Emerging role of complement in COVID-19 and other respiratory virus diseases. Cell. Mol. Life Sci. 2024, 81, 1–18. [CrossRef]
- Mellors, J.; Dhaliwal, R.; Longet, S.; Tipton, T.; Barnes, E.; Dunachie, S.J.; Klenerman, P.; Hiscox, J.; Carroll, M. Complement-mediated enhancement of SARS-CoV-2 antibody neutralisation potency in vaccinated individuals. Nat. Commun. 2025, 16, 1–15. [CrossRef]
- Ellsworth, C.R.; Chen, Z.; Xiao, M.T.; Qian, C.; Wang, C.; Khatun, M.S.; Liu, S.; Islamuddin, M.; Maness, N.J.; Halperin, J.A.; et al. Enhanced complement activation and MAC formation accelerates severe COVID-19. Cell. Mol. Life Sci. 2024, 81, 1–14. [CrossRef]
- Detsika, M.G.; Palamaris, K.; Dimopoulou, I.; Kotanidou, A.; Orfanos, S.E. The complement cascade in lung injury and disease. Respir. Res. 2024, 25, 1–16. [CrossRef]
- Dumitrescu, G.; Antovic, J.; Soutari, N.; Gran, C.; Antovic, A.; Al-Abani, K.; Grip, J.; Rooyackers, O.; Taxiarchis, A. The role of complement and extracellular vesicles in the development of pulmonary embolism in severe COVID-19 cases. PLOS ONE 2024, 19, e0309112. [CrossRef]
- Yatsyshina, S.B.; Artamonova, A.A.; Elkina, M.A.; Valdokhina, A.V.; Bulanenko, V.P.; Berseneva, A.A.; Akimkin, V.G. Genetic characteristics of influenza A and B viruses circulating in Russia in 2019–2023. J. Microbiol. epidemiology Immunobiol. 2024, 101, 719–734. [CrossRef]
- Pawlowski, C.; Silvert, E.; O'Horo, J.C.; Lenehan, P.J.; Challener, D.; Gnass, E.; Murugadoss, K.; Ross, J.; Speicher, L.; Geyer, H.; et al. SARS-CoV-2 and influenza coinfection throughout the COVID-19 pandemic: an assessment of coinfection rates, cohort characteristics, and clinical outcomes. PNAS Nexus 2022, 1, pgac071. [CrossRef]
- Varshney, K.; Pillay, P.; Mustafa, A.D.; Shen, D.; Adalbert, J.R.; Mahmood, M.Q. A systematic review of the clinical characteristics of influenza-COVID-19 co-infection. Clin. Exp. Med. 2023, 23, 3265–3275. [CrossRef]
- Debisarun, P.A.; Gössling, K.L.; Bulut, O.; Kilic, G.; Zoodsma, M.; Liu, Z.; Oldenburg, M.; Rüchel, N.; Zhang, B.; Xu, C.-J.; et al. Induction of trained immunity by influenza vaccination - impact on COVID-19. PLOS Pathog. 2021, 17, e1009928. [CrossRef]







| Position in the nucleotide chain | Nucleotide sequence (5’ -3’) | Length of fragment, bp | T annealing, °C |
|---|---|---|---|
| F58 | CCCTCAGATTCAACTGGCAGT | 112 | 55 |
| R169 | TGAAGAGCGGTGAACCAAGAC |
| Characteristic | 1st cohort (2020), n=45 | 2nd cohort (2021), n=53 | P= |
|---|---|---|---|
| Age, Me (Q1;Q3) | 62.00 (55.00;70.00) | 67.00 (56.50; 76.00) | 0.15 |
| Males | 22 (48.9%) | 28 (52.8%) | 0.5 |
| Females | 23 (51.1%) | 25 (47.2%) | 0.5 |
| < 65 years old | 28 (62.2%) | 23 (43.4%) | 0.43 |
| ≥65 years old | 17 (37.8%) | 30 (56.6%) | 0.43 |
| Mild COVID-19 | 16 (35.6%) | 19 (35.8%) | 0.57 |
| Medium severe+severe COVID-19 | 29 (64.4%) | 34 (64.2%) | 0.57 |
| Days from onset of illness, Me (Q1;Q3) |
7.00 (5.00; 9.00) | 4.00 (3.00;5.00) | <0.0001 |
| Positive PCR test for SARS-Cov-2 on the day of hospitalization | 22 (48.9%) | 53 (100%) | <0.001 |
| Viremia (positive serum PCR-test) | 12 (26.7%) | 0 (0%) | <0.0001 |
| SARS-Cov-2 vaccination | 0 (0%) | 37 (69.8%) | <0.001 |
| Comorbidities: Cardiovascular Diabetes chronic pulmonary disorders |
31 (68.8%) 9 (20%) 5 (11.1%) |
31 (58.5%) 6 (11.3%) 3 (5.6%) |
0.2 0.17 0.27 |
| Bacterial coinfections | 18 (40.0%) | 22 (41.5%) | 0.52 |
| Lethal outcome | 13 (24.1%) | 0 (0%) | <0.001 |
| Positive for IgG | 15 (33.3%) | 31 (58.5) | 0.01 |
| Positive for IgM | 15 (33.3%) | 40 (45.5%) | <0.0001 |
| Influenza seroconversions among paired samples | 9 out of 28 (32.2%) | 5 out of 14 (35.7%) | 0.12 |
| Characteristic | 1 cohort (2020) | 2nd cohort (2021) | P = |
|---|---|---|---|
| Number of patients | 28 | 14 | |
| Mild | 9 (32.1%) | 5 (35.7%) | 0.54 |
| Medium severe + severe | 19 (67.9%) | 9 (64%) | 0.54 |
| Average period between 1st and 2nd serum | 4 (3.0; 4.0) | 4 (3.0; 5.0) | 0.18 |
| Seroconversion to influenza in mild COVID-19 | 0 (0%) | 0 (0%) | n/a |
| Seroconversion to influenza in medium severe+severe COVID-19 | 9 (47.4%)1 | 4 (44.4%) | 0.69 |
| Seroconversion to influenza viruses (HI) | |||
| A/H1N1pdm09 | 6 (21.4%) | 1 (7.1%) | 0.19 |
| A/H3N2 | 1 (3.6 %) | 1 (7.1%) | 0.67 |
| B/Victoria | 2 (7.1%) | 4 (28.6%) | 0.08 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).