Submitted:
29 January 2025
Posted:
30 January 2025
You are already at the latest version
Abstract
Despite advances in immunotherapy, non-small cell lung carcinoma (NSCLC) clinical success is limited, possibly due to substantial immunological alterations in advanced cancer pa-tients. This study examines the immunomodulatory effects of exosomes derived from lung adeno-carcinoma (ADC) and squamous cell carcinoma (SCC) on T cells. Methods: Exosomes were isolated from A549 (lung adenocarcinoma), SKMES1 (lung squamous cell carcinoma), and Jurkat-E6.1 (T cells). Exosome size and morphology were analysed by NTA and TEM, respectively, while western blotting confirmed exosome markers. Exosome quantity was measured by the BCA assay. Exosome uptake was assessed, followed by resazurin assay, RNA isolation, quantification, cDNA prepara-tion, RT-PCR, nano LC-MS, and bioinformatic analysis, before and after treating Jurkat-E6.1 cells with exosomes from A549 and SKMES1. Results: Cancer-derived exosomes were efficiently in-ternalized by immune cells, reducing T-cell viability. Real-time PCR showed increased expression of TGFB, GZMB, and BAX, alongside decreased IL2, indicating an immunosuppressive effect. IL10 was increased more in ADC-treated cells than in SCC-treated cells. Higher levels of KI67 and BCL2 suggested a compensatory T-cell response. Proteomic analysis revealed 39 differentially abundant proteins (DAPs) in ADC-treated T cells and 276 in SCC-treated T cells, with 19 shared DAPs. Gene Ontology (GO) analysis of these DAPs highlighted processes such as exosome biogenesis, metabolic pathways, and regulatory functions, with ADC exosomes influencing NAD metabolism, ECM binding, and oxidoreductase activity, while SCC exosomes affected mRNA stability, amino acid metabolism, and cadherin binding. Shared DAPs (19) were mostly linked to nucleic acid metabo-lism. The cytoplasmic colocalization suggested the presence of these proteins in the cellular and extracellular lumen, indicating further release of these proteins in the vesicles by T cells. Conclusion: Lung cancer-derived exosomes regulate T-cell activities through immunoregulatory signaling without cell-cell contacts. The molecular interactions between exosomes and immune cells can re-veal novel tumor immune regulatory mechanisms and therapeutic targets.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Adherent and Suspension Cell Culture
2.2. Isolation of Exosomes Using Precipitation Method
2.3. Nanoparticle Tracking Analysis
2.4. Transmission Electron Microscopy
2.5. Resazurin Cell Viability Assay
2.6. Exosome Quantification and Cross-Treatment
2.7. Labelling of Cancer-Derived Exosomes
2.8. Exosome Uptake and Cell Labelling
2.9. Microscopy for Image Capture
2.10. Western Blot
2.11. RNA Isolation, cDNA Preparation
2.12. Nucleic Acid Quality Control
2.13. Real Time PCR
2.14. Whole Protein Extraction Using Rapigest
2.15. Tryptic Digestion
2.16. Liquid Chromatography – Mass Spectrometry (nLC-MS)
2.17. Bioinformatics and Pathway Enrichment Analysis
2.18. Statistical Analysis
3. Results
3.1. Identification and Characterization of ADC and SCC-Derived Exosomes
3.2. Cancer-Derived Exosome Uptake by T Cells and Its Impact on Viability
3.3. Comparative Analysis of Protein Abundance in T Cells Treated with ADC and SCC-Derived Exosomes
3.4. Gene Ontology of DAP Between T Cells and T Cells Treated with ADC Exosomes
3.5. Gene Ontology of DAP of T Cells and T Cells Treated with SCC Exosomes
3.5. Commonly Expressed Proteins upon T Cell Treatment with ADC and SCC Derived Exosomes
3.6. Cytokine Regulation in T Cells by Cancer-Derived Exosomes
4. Discussion
5. Conclusions
6. Limitations and Future Prospectives
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| NSCLC | non-small cell lung carcinoma |
| ADC | lung adenocarcinoma |
| SCC | lung squamous cell carcinoma |
| DAP | differentially abundant proteins |
| GO | gene ontology |
| sEV | small extracellular vesicles |
| LC-MS | liquid chromatography-mass spectrometry |
| T_Sx | SKMES1-derived exosomes |
| T_Ax | A549-derived exosomes |
References
- Siegel, R.L.; Miller, K.D.; Fuchs, H.E.; Jemal, A. Cancer Statistics, 2021. CA Cancer J Clin 2021, 71, 7–33. [Google Scholar] [CrossRef] [PubMed]
- Oser, M.G.; Niederst, M.J.; Sequist, L. V.; Engelman, J.A. Transformation from Non-Small-Cell Lung Cancer to Small-Cell Lung Cancer: Molecular Drivers and Cells of Origin. Lancet Oncol 2015, 16, e165–e172. [Google Scholar] [CrossRef] [PubMed]
- Padinharayil, H.; Varghese, J.; John, M.C.; Rajanikant, G.K.; Wilson, C.M.; Al-Yozbaki, M.; Renu, K.; Dewanjee, S.; Sanyal, R.; Dey, A.; et al. Non-Small Cell Lung Carcinoma (NSCLC): Implications on Molecular Pathology and Advances in Early Diagnostics and Therapeutics. Genes Dis 2022. [Google Scholar] [CrossRef]
- Brinton, L.T.; Sloane, H.S.; Kester, M.; Kelly, K.A. Formation and Role of Exosomes in Cancer. Cellular and Molecular Life Sciences 2015, 72, 659–671. [Google Scholar] [CrossRef] [PubMed]
- Zebrowska, A.; Widlak, P.; Whiteside, T.; Pietrowska, M. Signaling of Tumor-Derived Sev Impacts Melanoma Progression. Int J Mol Sci 2020, 21, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Zebrowska, A.; Skowronek, A.; Wojakowska, A.; Widlak, P.; Pietrowska, M. Metabolome of Exosomes: Focus on Vesicles Released by Cancer Cells and Present in Human Body Fluids. Int J Mol Sci 2019, 20, 3461. [Google Scholar] [CrossRef] [PubMed]
- Padinharayil, H.; George, A. Small Extracellular Vesicles: Multi-Functional Aspects in Non-Small Cell Lung Carcinoma. Crit Rev Oncol Hematol 2024, 198. [Google Scholar] [CrossRef] [PubMed]
- Padinharayil, H.; Varghese, J.; Wilson, C.; George, A. Mesenchymal Stem Cell-Derived Exosomes: Characteristics and Applications in Disease Pathology and Management. Life Sci 2024, 342. [Google Scholar] [CrossRef]
- Welsh, J.A.; Goberdhan, D.C.I.; O’Driscoll, L.; Buzas, E.I.; Blenkiron, C.; Bussolati, B.; Cai, H.; Di Vizio, D.; Driedonks, T.A.P.; Erdbrügger, U.; et al. Minimal Information for Studies of Extracellular Vesicles (MISEV2023): From Basic to Advanced Approaches. J Extracell Vesicles 2024, 13, e12404. [Google Scholar] [CrossRef] [PubMed]
- Whiteside, T.L. Tumor-Derived Exosomes and Their Role in Cancer Progression. Adv Clin Chem 2016, 74, 103–141. [Google Scholar] [CrossRef]
- Kok, V.C.; Yu, C.C. Cancer-Derived Exosomes: Their Role in Cancer Biology and Biomarker Development. Int J Nanomedicine 2020, 15, 8019–8036. [Google Scholar] [CrossRef] [PubMed]
- Théry, C.; Zitvogel, L.; Amigorena, S. Exosomes: Composition, Biogenesis and Function. Nature Reviews Immunology 2002 2:8 2002, 2, 569–579. [Google Scholar] [CrossRef] [PubMed]
- Whiteside, T.L. The Effect of Tumor-Derived Exosomes on Immune Regulation and Cancer Immunotherapy. Future Oncology 2017, 13, 2583–2592. [Google Scholar] [CrossRef] [PubMed]
- Azambuja, J.H.; Ludwig, N.; Yerneni, S.S.; Braganhol, E.; Whiteside, T.L. Arginase-1+ Exosomes from Reprogrammed Macrophages Promote Glioblastoma Progression. Int J Mol Sci 2020, 21, 3990. [Google Scholar] [CrossRef]
- Zhao, Y.; Liu, L.; Sun, R.; Cui, G.; Guo, S.; Han, S.; Li, Z.; Bai, T.; Teng, L. Exosomes in Cancer Immunoediting and Immunotherapy. Asian J Pharm Sci 2022, 17, 193–205. [Google Scholar] [CrossRef] [PubMed]
- Soltész, B.; Buglyó, G.; Németh, N.; Szilágyi, M.; Pös, O.; Szemes, T.; Balogh, I.; Nagy, B. The Role of Exosomes in Cancer Progression. Int J Mol Sci 2021, 23, 8. [Google Scholar] [CrossRef] [PubMed]
- Whiteside, T.L.; Mandapathil, M.; Szczepanski, M.; Szajnik, M. Mechanisms of Tumor Escape from the Immune System: Adenosine-Producing Treg, Exosomes and Tumor-Associated TLRs. Bull Cancer 2011, 98. [Google Scholar] [CrossRef]
- Whiteside, T.L. Immune Suppression in Cancer: Effects on Immune Cells, Mechanisms and Future Therapeutic Intervention. Semin Cancer Biol 2006, 16, 3–15. [Google Scholar] [CrossRef] [PubMed]
- Jeong, W.K.; Wieckowski, E.; Taylor, D.D.; Reichert, T.E.; Watkins, S.; Whiteside, T.L. Fas Ligand-Positive Membranous Vesicles Isolated from Sera of Patients with Oral Cancer Induce Apoptosis of Activated T Lymphocytes. Clinical Cancer Research 2005, 11, 1010–1020. [Google Scholar] [CrossRef]
- Taylor, D.D.; Gerçel-Taylor, C. Tumour-Derived Exosomes and Their Role in Cancer-Associated T-Cell Signalling Defects. Br J Cancer 2005, 92, 305–311. [Google Scholar] [CrossRef] [PubMed]
- Clayton, A.; Mitchell, J.P.; Court, J.; Mason, M.D.; Tabi, Z. Human Tumor-Derived Exosomes Selectively Impair Lymphocyte Responses to Interleukin-2. Cancer Res 2007, 67, 7458–7466. [Google Scholar] [CrossRef] [PubMed]
- Po, A.; Eyers, C.E. Top-Down Proteomics and the Challenges of True Proteoform Characterization. J Proteome Res 2023, 22, 3663–3675. [Google Scholar] [CrossRef]
- Schaffer, L. V.; Millikin, R.J.; Shortreed, M.R.; Scalf, M.; Smith, L.M. Improving Proteoform Identifications in Complex Systems Through Integration of Bottom-Up and Top-Down Data. J Proteome Res 2020, 19, 3510. [Google Scholar] [CrossRef]









| Sl No. | Target mRNA | Annealing Temperature | Primer_Forward (5’-3’) | Primer_Reverse (5’-3’) |
| 1 | TGFB1 | 65 | TACCTGAACCCGTGTTGCTCTC | GTTGCTGAGGTATCGCCAGGAA |
| 2 | BAX | 64.4 | TCAGGATGCGTCCACCAAGAAG | TGTGTCCACGGCGGCAATCATC |
| 3 | TNFA | 64.4 | CTCTTCTGCCTGCTGCACTTTG | ATGGGCTACAGGCTTGTCACTC |
| 4 | IL10 | 63 | TCTCCGAGATGCCTTCAGCAGA | TCAGACAAGGCTTGGCAACCCA |
| 5 | IL6 | 63 | AGACAGCCACTCACCTCTTCAG | TTCTGCCAGTGCCTCTTTGCTG |
| 6 | GZMB | 63 | CGACAGTACCATTGAGTTGTGCG | TTCGTCCATAGGAGACAATGCCC |
| 7 | IL2 | 62.4 | AGAACTCAAACCTCTGGAGGAAG | GCTGTCTCATCAGCATATTCACAC |
| 8 | GAPDH | 60 | GTCTCCTCTGACTTCAACAGCG | ACCACCCTGTTGCTGTAGCCAA |
| 9 | BCL2 | 55.7 | ATCGCCCTGTGGATGACTGAGT | GCCAGGAGAAATCAAACAGAGGC |
| 10 | KI67 | 53.9 | GGGCCAATCCTGTCGCTTAAT | GTTATGCGCTTGCGAACCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).