Bta-let-7d Modulation of Potassium Permanganate Induced Oxidative Stress in Bovine Endometrial Cells via IGF1R/PI3K/AKT Signaling Pathway

1. Introduction

Oxidative stress plays a crucial role in the pathophysiology of various reproductive disorders in dairy cows, particularly in cases of postpartum uterine infections, such as endometritis. These infections are primarily caused by bacterial contaminants such as Escherichia coli and Staphylococcus aureus, which disrupt the normal function of the endometrium and create an unsuitable environment for embryo implantation, ultimately reducing the reproductive performance[1,2] The accumulation of reactive oxygen species(ROS) can lead to cellular damage and impaired lipid peroxidation health; therefore, studying the effects of oxidative stress on the health of the dairy cow endometrium is meaningful. [3].

Acute endometritis in dairy cows may be treated with potassium permanganate (KMnO₄), recognized for its antibacterial and anti-inflammatory properties. However, KMnO₄ is a strong oxidizing agent, and incomplete uterine washing can result in residual potassium permanganate within the body, potentially creating a prolonged oxidative environment that may lead to oxidative damage of the endometrium[4,5,6,7,8]. In the context of postpartum infections in dairy cows, KMnO₄ is utilized to cleanse the uterus, disinfect wounds, and treat hoof conditions. Additionally, it is employed in other animal species for wound debridement and the management of uterine adenomyosis in canines and felines. Nonetheless, potassium permanganate's potent oxidative properties raise concerns, as it has been shown to exhibit acute toxicity in rodent models. This study aims to investigate the potential for potassium permanganate to induce oxidative stress in the endometrium during therapeutic application[9,10,11].

IGF1R (Insulin-like Growth Factor 1 Receptor) is essential in oxidative stress [12]. It belongs to the receptor tyrosine kinase family. It can be activated by IGF1 or IGF2 [13], activating its downstream PI3K/AKT signaling pathway, which regulates cell growth, differentiation, and responses to oxidative stress[14]. IGF1R is significantly related to oxidative stress responses, particularly in the context of ischemia/reperfusion injury and mental disorders. Studies have shown that low concentrations of H₂O₂ during myocardial ischemia-reperfusion activate the IGF1R/PI3K/AKT signaling pathway to resist oxidative stress damage and prevent apoptosis.

MicroRNAs (miRNAs) are a class of small non-coding RNAs that regulate gene expression by binding to the 3' untranslated regions of mRNAs, leading to mRNA degradation or inhibition of translation[15]. The let-7 family is a group of conserved microRNAs that play roles in various biological processes, including cell proliferation, differentiation, and apoptosis. The let-7 family is highly expressed in mitochondria and acts by regulating antioxidant-related genes [16]. For example, let-7b and let-7c can indirectly regulate HMOX1 to alleviate oxidative damage in human hepatocytes [17]. Studies have shown that let-7 family member let-7a inhibits oxidative stress and cellular damage by targeting arginase 2 (ARG2)[18]. The let-7 family also plays a significant role in regulating cancer stem cells, participating in the maintenance of stem cell properties, promoting the proliferation of cancer cells, and resisting apoptosis [19].

This research aims to investigate the implications of potassium permanganate treatment on oxidative stress in the endometrium of dairy cows. By examining the interactions between oxidative stress, IGF1R signaling, and miRNA regulation in the context of reproductive health, this study seeks to provide insights into potential therapeutic strategies for managing oxidative stress-related reproductive disorders in dairy cows. Understanding these mechanisms may pave the way for improved reproductive outcomes and economic viability in the dairy industry.

2. Material and methods

2.1. Collection of Bovine Uterine Samples and SD Rat Model

Bovine uterine tissue samples were obtained from a slaughterhouse in Wuhan, China. Following collection, the tissues were immediately immersed in liquid nitrogen and transported to the laboratory within 30 minutes. All animal procedures adhered to protocols approved by the Hubei Province Laboratory Animal Research Center and the Animal Research Ethics Committee of Huazhong Agricultural University (HZAUMO-2015-12). Additionally, 4 to 6-week-old Sprague-Dawley (SD) rats were procured from the Experimental Animal Center. Both uterine horns of the rats were exposed and flushed with varying concentrations of potassium permanganate (KMnO₄) (C1: 0.01%, C2: 0.025%, C3: 0.05%, C4: 0.1%), while the control group received an equivalent volume of phosphate-buffered saline (PBS).

2.2. Histological Analysis

Tissue samples were fixed in 10% formalin, followed by washing with buffer (e.g., PBS), dehydration through a graded ethanol series, clearing with xylene, and embedding in molten paraffin. The embedded tissues were placed in molds and allowed to solidify at room temperature or in cold storage. The solidified blocks were sectioned into thin slices (4-6 μm) using a microtome, deparaffinized with xylene, and stained with hematoxylin for nuclei and eosin for cytoplasmic visualization.

2.3. Bovine Endometrial Epithelial Cell Culture

Bovine endometrial epithelial cells (BEECs) were cultured in a medium supplemented with 10% fetal bovine serum (from the United States) and 1% penicillin-streptomycin (Biosharp). The incubation environment was maintained at 5% CO₂ and 37°C, with medium changes every 6 hours. Upon reaching approximately 80% confluence, the cells were digested with trypsin, subcultured, and stored at -80°C or in liquid nitrogen. To investigate the role of let-7d and IGF1R in oxidative stress within the bovine endometrium, an in vitro oxidative stress model was established by treating the cells with 0.01% KMnO₄.

2.4. bEECs Cell Transfection

When cell cultures reached approximately 60% confluence, transfections were performed using the jetPRIME reagent with bta-let-7d mimics (5’-3': S: AGAGGUAGUAGGUUGCAUAGUU, AS: CUAUGCAACCUACUACCUCUUU), bta-let-7d inhibitor (5’-3': S: AACUAUGCAACCUACUACCUCU), and IGF1R siRNA (si-IGF1R, 5’-3': S: GCACAACUACUGCUCCAAATT, AS: UUUGGAGCAGUAGUUGUGCTT). RNA and protein were extracted 24 hours post-transfection.

2.5. RNA Extraction and RT-qPCR Analysis

Total RNA from tissues or cells was extracted using Trizol reagent according to the manufacturer's instructions. Complementary DNA (cDNA) synthesis was conducted using the Yeasen one-step reverse transcription kit, with miRNA reverse transcription achieved through tailing. Gene expression was quantified via real-time PCR, employing β-actin and U6 as reference genes. The relative gene expression levels were analyzed using the 2^(-^ΔΔCT) method. Primer sequences are provided in Table 1.

2.6. Western Blot Analysis

Following protein extraction from tissues and cells using RIPA buffer, protein concentrations in each group were quantified using a BCA assay. Samples underwent SDS-PAGE under constant voltage, followed by transfer to PVDF membranes using constant current. Membranes were blocked with ECL rapid blocking buffer for one hour and incubated overnight with primary antibodies at 4°C (16–18 hours). After three washes with TBST, membranes were incubated with secondary antibodies for two hours, rewashed thrice with TBST, and visualized. Results were analyzed using ImageJ software, with β-actin serving as an internal control.

2.7. miRNA Target Prediction

Potential miRNA targets for IGF1R were predicted using the TargetScan website, focusing on the top five candidates. These miRNAs were further assessed based on their expression in bovine endometrial tissue and previous studies regarding their functions. Ultimately, let-7d was selected due to its high expression in endometrial tissue and its significant role in mitochondrial function. Additional target predictions were conducted using miRDB (http://mirdb.org/), PicTar (https://pictar.mdc-berlin.de/), and miRcode (http://www.mircode.org/).

2.8. Dual-Luciferase Reporter Assay

Wild-type and mutant plasmids for IGF1R were constructed using the primGLO backbone based on predicted binding sites. These plasmids, along with bta-let-7d mimics, were co-transfected into 293T cells. Fluorescence intensity was measured using the Yeasen Dual-Luciferase Assay Kit (Cat. No. 11402ES60).

2.9. Detection of MDA, ROS, T-AOC, GPx, and SOD

After stimulation, cells from each group were washed with PBS and collected using a scraper in 500 μL PBS. Supernatants were obtained following centrifugation for 20 minutes, and protein concentrations were determined via BCA assay. Assays for MDA (Cat. No. S0131S), ROS (Cat. No. S0033S), total antioxidant capacity (T-AOC) (Cat. No. S0119), glutathione peroxidase (GPx) (Cat. No. S0056) from Beyotime, and total superoxide dismutase (T-SOD) (Cat. No. A001-1-2) from Nanjing Jiancheng were performed according to the respective kit instructions.

2.10. Immunofluorescence Staining

Following stimulation, cells were washed twice with PBS and fixed with 4% paraformaldehyde for 20 minutes. Cells were then permeabilized with Triton for 15 minutes, washed three times, and blocked with blocking buffer at room temperature for three hours. Primary antibodies were added and incubated overnight at 4°C in the dark. After three additional washes with PBS, secondary antibodies were added and incubated at room temperature for three hours. Nuclei were stained with DAPI at room temperature for 15 minutes. Cells were rewashed three times and visualized using a fluorescence microscope.

2.11. Statistical Analysis

All data were processed using GraphPad 9.4, with each experiment performed in triplicate. Data are presented as mean ± standard error of the mean (SEM). T-tests were employed for comparisons between two groups, while one-way ANOVA was utilized for comparisons among multiple groups. Statistical significance was defined as P < 0.05, with highly significant values indicated at P < 0.01.

3. Result

3.1. Differential Expression of IGF1R and bta-let-7d in Normal and Oxidative Stress-Affected Tissues

Analysis of normal versus oxidative stress-affected tissues revealed a significant reduction in both mRNA and protein levels of IGF1R in the oxidative stress group, alongside a marked increase in bta-let-7d expression. Histological examination of the oxidative stress group demonstrated considerable cellular damage and necrosis, correlating with the downregulation of IGF1R. In contrast, IGF1R levels were maintained in normal tissues, which exhibited preserved cellular architecture (Table 1, Figure 1A). Assays measuring malondialdehyde (MDA) and glutathione peroxidase (GPx) levels in normal and inflamed bovine uterine tissues indicated elevated MDA and reduced GPx levels in the oxidative stress group compared to normal tissues (Figure 1B, C). Quantitative PCR analysis further confirmed the significant reduction of IGF1R expression and the notable increase of bta-let-7d expression in oxidative stress tissues versus normal tissues (Figure 1D, E). Immunohistochemical staining illustrated nuclear localization (blue) and IGF1R expression in both normal and inflamed bovine uterine tissues (33) (Figure 1F). These findings suggest that oxidative stress markedly alters the expression of IGF1R and bta-let-7d in bovine uterine tissues.

3.2. Establishing a KMnO₄-Induced Oxidative Stress Model in Bovine Endometrial Epithelial Cells

To assess the oxidative stress induction by potassium permanganate (KMnO₄) in bovine endometrial epithelial cells, we analyzed oxidative and antioxidant marker changes across five KMnO₄ concentrations. Reactive oxygen species (ROS) intensity (Figure 2A, C) exhibited a concentration-dependent increase, indicating a positive correlation between ROS levels and KMnO₄ concentration. Cell viability, evaluated via the CCK-8 assay (Figure 2B), exhibited a decline in a concentration-dependent manner after 12 hours of exposure, reflecting the cytotoxic effects of elevated KMnO₄ concentrations. Lipid peroxidation, as indicated by MDA levels (Figure 2D), also significantly increased with rising KMnO₄ concentrations, further supporting oxidative stress induction. Levels of antioxidant enzymes, including total superoxide dismutase (SOD) (Figure 2E) and total antioxidant capacity (T-AOC) (Figure 2F), decreased significantly following KMnO₄ exposure, highlighting a compromised antioxidant defense against oxidative damage. Additionally, GPx levels (Figure 2G) similarly diminished with increasing KMnO₄ concentrations, indicating reduced cellular antioxidant capacity. These results confirm that KMnO₄ induces oxidative stress in bovine endometrial epithelial cells in a concentration-dependent manner.

3.3. Response Patterns of IGF1R and bta-let-7d in the Cell Model

Subsequent evaluation of the PI3K/AKT signaling pathway protein expression under KMnO₄ treatment revealed significantly reduced levels of phosphorylated PI3K and AKT with increasing KMnO₄ concentrations (Figs. A-G), suggesting that oxidative stress may impair cell survival by inhibiting the PI3K/AKT pathway. The expression of apoptosis-related proteins Bcl-2 and Bax was assessed, revealing an increase in Bax and a decrease in Bcl-2 expression with higher KMnO₄ concentrations. Western blot analyses confirmed the decline of IGF1R expression following KMnO₄ stimulation. Quantitative PCR data indicated significant reductions in GPx1 and CAT expression at KMnO₄ concentrations C1, C3, and C5, while SOD and Nrf2 levels were downregulated across all tested KMnO₄ concentrations. Pro-apoptotic proteins Bax, Caspase-8, and Caspase-3 were upregulated, whereas the expression of the anti-apoptotic protein Bcl-2 decreased. Immunofluorescence results demonstrated diminished IGF1R expression and phosphorylated mTOR levels under KMnO₄ stimulation. These findings suggest that KMnO₄-induced oxidative stress promotes apoptosis in bovine endometrial epithelial cells through the PI3K/AKT signaling pathway, with significant involvement from IGF1R and bta-let-7d.

3.4. Regulatory Role of bta-let-7d on Oxidative Stress Marker Expression

To elucidate the impact of bta-let-7d on oxidative stress markers, cells were transfected with bta-let-7d mimics and inhibitors, followed by measurement of SOD, GPx, MDA, and total antioxidant capacity. Results indicated that overexpression of bta-let-7d significantly elevated MDA levels while decreasing SOD, GPx, and total antioxidant capacity. Conversely, inhibition of bta-let-7d resulted in significantly reduced MDA levels and increased SOD, GPx, and total antioxidant capacity (Figure 4A-D). Further quantitative PCR analysis demonstrated that overexpression of bta-let-7d downregulated Bcl-2 and Caspase-6 while upregulating Bax; inhibition of bta-let-7d elicited the opposite effects. Additionally, bta-let-7d overexpression led to increased expression of oxidative stress-related genes CAT, NOS2, and PTGS2, while GPx1 levels remained unchanged. In contrast, bta-let-7d inhibition resulted in upregulation of GPx1 and NOS2 (Figure 4E-L). These results indicate that bta-let-7d upregulation exacerbates oxidative stress and apoptotic responses in bovine endometrial epithelial cells.

3.5. Interaction Between IGF1R and bta-let-7d in the Signaling Pathway

Western blot analysis showed that bta-let-7d negatively regulates IGF1R expression, thus inhibiting the PI3K/AKT signalling pathway. In cells overexpressing bta-let-7d, the levels of PI3K and phosphorylated AKT (p-AKT) were significantly reduced (Figure 5A-C), with downregulated IGF1R expression positively correlated with PI3K/AKT pathway inhibition. In contrast, IGF1R expression was upregulated upon bta-let-7d inhibition, enhancing PI3K/AKT pathway activation (Figure 5B, D). These results suggest that bta-let-7d suppresses the PI3K/AKT signalling pathway by targeting IGF1R, thereby weakening cell survival and antioxidant capacity.

Further analysis indicates that inhibition of the PI3K/AKT pathway correlates with an enhanced cellular stress response under oxidative conditions. Upregulation of IGF1R can activate the PI3K/AKT pathway, increasing cellular tolerance to oxidative stress, while overexpression of bta-let-7d weakens this protective mechanism, rendering cells more susceptible to oxidative damage.

3.6. IGF1R as a Target Gene of bta-let-7d

Bioinformatic analysis identified IGF1R as a potential target gene of bta-let-7d (Figure 6A-C). This conclusion was further validated by a dual-luciferase reporter assay (Figure 6D): the bta-let-7d mimic significantly inhibited luciferase activity of the IGF1R 3'UTR, with no significant change observed in the mutant vector (Figure 6I). Additionally, qPCR results demonstrated that IGF1R and bta-let-7d mRNA expression levels showed opposing trends under varying KMnO₄ concentrations (Figure 6E, F). These findings indicate that bta-let-7d directly regulates IGF1R expression by targeting its 3'UTR, playing a role in the oxidative stress response.

3.7. Negative Regulatory Role of IGF1R in the Oxidative Stress Response

To further investigate the role of IGF1R in the oxidative stress response, siRNA knockdown was performed at various IGF1R sites, with si-IGF1R-2009 demonstrating the most significant effect (Figure 7B). Knockdown of IGF1R resulted in a marked increase in MDA levels and a notable reduction in SOD, GPx, and total antioxidant capacity (Figure 7G). Furthermore, IGF1R knockdown inhibited the PI3K/AKT pathway (Figure 7A, F, G). Quantitative PCR analyses revealed downregulation of antioxidant marker genes GPx1, CAT, SOD, and Nrf2, reflecting diminished cellular antioxidant capacity (Figure 7H). Western blot results indicate an upregulation of pro-apoptotic proteins and a downregulation of anti-apoptotic proteins (Figure 7A, D, E). Concurrently, qPCR analysis showed increased expression of pro-apoptotic genes Bax, Caspase-8, and Caspase-3, and decreased expression of the anti-apoptotic gene Bcl-2 (Figure 7I). These findings suggest that IGF1R plays a critical negative regulatory role in the oxidative stress response, where its downregulation exacerbates oxidative stress and apoptotic responses.

3.8. Potassium Permanganate-Induced Uterine Damage and IGF1R Expression

Following uterine lavage in rats with varying concentrations of potassium permanganate, histological assessments indicated that the control group's endometrial structures remained intact, exhibiting no visible damage or inflammation, with normal basal layer arrangement. At concentrations of 0.025% and 0.01% potassium permanganate, slight edema and mild epithelial damage were observed, accompanied by localized inflammatory cell infiltration (Figure A). At a concentration of 0.05%, severe tissue damage, edema, and leukocyte infiltration were evident, indicating a pronounced inflammatory response at higher potassium permanganate concentrations. Histopathological scoring (Table 2) showed increased MDA levels correlating with potassium permanganate concentration, with groups C2 and C3 exhibiting significantly higher MDA levels than the control group (***, P < 0.0001), suggesting that elevated potassium permanganate concentrations induce severe oxidative stress. Immunofluorescence analyses revealed reduced IGF1R expression in endometrial epithelial cells following potassium permanganate exposure compared to controls (Figure 8B). These results indicate that potassium permanganate exposure leads to significant uterine damage and downregulation of IGF1R expression.

3.9. Schematic of IGF1R/PI3K/AKT Pathway Inhibition in Potassium Permanganate-Induced Endometrial Oxidative Stress

Figure 9. Schematic of IGF1R/PI3K/AKT Pathway Inhibition in Potassium Permanganate-Induced Endometrial Oxidative Stress.

Figure 9. Schematic of IGF1R/PI3K/AKT Pathway Inhibition in Potassium Permanganate-Induced Endometrial Oxidative Stress.

4. Discussion

The health status of the endometrium in dairy cows is crucial for embryo implantation and pregnancy maintenance[20,21] . The endometrium serves as a vital site for embryo implantation and development, and its health directly impacts successful implantation and pregnancy maintenance [22]. Oxidative stress is widely recognized as a key factor affecting endometrial function, where excessive reactive oxygen species (ROS) can lead to cellular damage, thereby impairing reproductive performance [23]. This study is the first to elucidate the mechanism by which bta-let-7d regulates oxidative stress in the bovine endometrium through targeting IGF1R, providing new insights into reproductive health.

In this study, potassium permanganate (KMnO₄) was utilized to induce oxidative stress in bovine endometrial epithelial cells (BEECs) [24]. The findings showed significant increases in ROS and MDA levels, while the activities of GPX and SOD decreased, alongside a decline in total antioxidant capacity. These results indicate that oxidative stress inhibits antioxidant enzyme activity, leading to ROS accumulation and increased lipid peroxidation, contributing to cellular damage. This underscores the importance of maintaining intracellular ROS balance and highlights the protective role of antioxidant enzymes during oxidative stress. Given the critical importance of endometrial health for embryo implantation and pregnancy maintenance in dairy cows, understanding and regulating the oxidative stress response is vital for enhancing reproductive performance[22]. Future investigations may explore modulating antioxidant enzyme activities to mitigate oxidative stress and improve reproductive efficiency in dairy herds.

Our study identified that the upregulation of bta-let-7d led to a significant decrease in IGF1R expression. IGF1R, a key receptor in the PI3K/AKT signaling pathway, is essential for regulating cellular proliferation, survival, and metabolism [25]. Previous research has associated abnormal IGF1R expression with various reproductive disorders[26,27]. This receptor plays a significant role in preparing the uterus for embryo implantation. Studies indicate that stromal IGF1 and embryonic IGF2 activate IGF1R, which is vital for epithelial differentiation and receptivity during implantation [28]. Therefore, by suppressing IGF1R expression, bta-let-7d may influence these physiological processes. IGF1R activation promotes cell proliferation and survival, while bta-let-7d inhibits this pathway, exacerbating oxidative stress-induced damage in endometrial cells.

Increased oxidative stress correlates with various diseases, including reproductive disorders[29] [30]. Our results demonstrated that ROS levels in endometrial cells significantly decreased following the downregulation of bta-let-7d, likely due to the subsequent increase in IGF1R levels. IGF1R activation can enhance the PI3K/AKT pathway, promoting the expression of antioxidant enzymes such as SOD and GPX. SOD scavenges superoxide radicals, and GPX removes hydrogen peroxide, working together to reduce MDA formation and alleviate oxidative stress while enhancing overall antioxidant capacity.

As understanding of miRNA functions in biology deepens, the potential of bta-let-7d as a regulatory factor becomes increasingly apparent[31]. Studies show that the let-7 family plays critical roles in various biological processes, including cell cycle regulation and stress response[32]. Thus, the regulatory mechanisms of bta-let-7d may extend beyond IGF1R to include other signaling pathways, such as MAPK and Wnt. influence endometrial cell responses to oxidative stress by regulating these pathways.

Thus, the Mechanism by which bta-let-7d regulates oxidative stress through IGF1R could provide a new strategy for enhancing reproductive efficiency in dairy cows. This finding provides a novel perspective on using molecular biology approaches to intervene in the reproductive health of dairy cows. Although this study provides new insights into the role of bta-let-7d and IGF1R in oxidative stress regulation, further research is needed on the following aspects: Mechanisms of bta-let-7d: Future studies could explore whether bta-let-7d influences oxidative stress through other target genes or pathways. Clinical application: Evaluating the practical application of bta-let-7d as a biomarker or therapeutic target in dairy cow reproductive management.

Overall, these findings provide valuable insights into the molecular mechanisms underlying oxidative stress in bovine endometrial tissues. The interplay between bta-let-7d and IGF1R is critical, and further exploration of these pathways may lead to novel strategies for improving reproductive health in dairy cows. Future research should investigate potential interventions to restore IGF1R levels and assess the therapeutic potential of modulating bta-let-7d expression to combat oxidative stress.