Submitted:
02 January 2025
Posted:
04 January 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Cucumber Cultivar and NFB Strain
2.2. Cucumber Culture System
2.3. Treatments of Cucumber Seedlings
2.4. Library Preparation and Illumina HiSeq XTen/NovaSeq 6000 Sequencing
2.5. Read Mapping
2.6. Differential Expression Analysis and Functional Enrichment
2.7. Quantitative Real-Time PCR Analysis of Cucumber NRT Genes
2.8. Drought Treatment of Cucumber Seedlings
2.9. Determination of Rhizosphere Electrical Conductivity (EC)
2.10. Statistical Analysis
3. Results
3.1. Subclone of the Cucumber NRT Genes
3.2. Relative Transcriptional Levels of the NRT Genes in Cucumber Roots
3.3. Illumina RNA Sequencing (RNA-Seq) and Sequence Assembly
3.4. Expression Level Analysis of C. sativus Unigenes and Transcripts
3.5. Variation in Gene Expression Among Groups
3.6. GO Functional Classification of the DEGs
3.7. Functional Classification of C. sativus DEGs by COG
3.8. Functional Classification of C. sativus DEGs by KEGG
3.9. GO Enrichment Analysis of C. sativus DEGs
3.10. KEGG Enrichment Analysis of C. sativus DEGs
3.11. EC Evaluation
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Le, C.; Zha, Y.; Li, Y.; Sun, D.; Lu, H.; Yin, B. Eutrophication of lake waters in China: cost, causes, and control. Environ Manage 2010, 45: 662–668. [CrossRef]
- Davidson, E.A. The contribution of manure and fertilizer nitrogen to atmospheric nitrous oxide since 1860. Nat Geosci 2009, 2: 659–662. [CrossRef]
- Matsuyama, N.; Saigusa, M.; Sakaiya, E.; Tamakawa, K.; Oyamada, Z.; Kudo, K. Acidification and soil productivity of Allophanic andosols affected by heavy application of fertilizers. Soil Sci Plant Nutr 2005, 51:117–123. [CrossRef]
- Lee, R.B.; Drew, M.C. Nitrogen-13 studies of nitrate fluxes in barley roots. J Exp Bot 1986, 37: 1768–1779. [CrossRef]
- Orsel, M.; Krapp, A.; Daniel, V. F. Analysis of the NRT2 nitrate transporter family in Arabidopsis. Structure and gene expression. Plant Physiol 2002, 129: 886–896. [CrossRef]
- Okamoto, M.; Vidmar, J.J.; Glass, A.D.M. Regulation of NRT1 and NRT2 gene families of Arabidopsis thaliana: Responses to nitrate provision. Plant Cell Physiol 2003, 44: 304–317. [CrossRef]
- Matsumoto, H.; Wakiuchi, N.; Takahashi, E. Changes of sugar levels in cucumber leaves during ammonium toxicity. Physiol Plantarum 1968, 21: 1210–1216. [CrossRef]
- Kronzucker, H.J.; Britto, D.T.; Davenport, R.J.; Tester, M. Ammonium toxicity and the real cost of transport. Trends Plant Sci 2001, 6: 335–337. [CrossRef]
- Chen, F. Effects of application and ratio of nitrogen,phosphorus,and potassium on mineral nutrient absorption and yield of cucumber (Cucumis sativus L.). J Northwest A & F Univ (Nat Sci) 2015, 43: 174–180.
- Wu, T.; Qin, Z.W.; Fan, L.X.; Xue, C.B.; Zhou, X.Y.; Xin, M.; Du, Y.L. Involvement of CsNRT1.7 in nitrate recycling during senescence in cucumber. J Plant Nutr Soil Sci 2014, 177: 714-721.
- Zhao, W.; Yang, X.; Yu, H.; Jiang, W.; Sun, N.; Liu, X.; Liu, X.; Zhang, X.; Wang, Y.; Gu, X. RNA-seq-based transcriptome profiling of early nitrogen deficiency response in cucumber seedlings provides new insight into the putative nitrogen regulatory network. Plant and Cell Physiol 2014, 56: 455–467. [CrossRef]
- Sun, S.X.; Chen, Y.P.; Cheng, J.J.; Li, Q.J.; Zhang, Z.C.; Lan, Z.L. Isolation, characterization, genomic sequencing, and GFP-marked insertional mutagenesis of a high-performance nitrogen-fixing bacterium, Kosakonia radicincitans GXGL-4A and visualization of bacterial colonization on cucumber roots. Folia Microbiol 2018, 63: 789–802. [CrossRef]
- Feng, B.Y.; Zhang, M.T.; Su, G.X.; Bao, Y.Q.; Xu, Y.; Chen, Y.P. Siderophore Synthesis Ability of the Nitrogen-Fixing Bacterium (NFB) GXGL-4A is Regulated at the Transcriptional Level by a Transcriptional Factor (trX) and an Aminomethyltransferase Encoding Gene (amt). Curr Microbiol 2022, 79(12): 369-382. [CrossRef]
- Li, H.Z.; Cheng, Z.H. Hoagland nutrient solution promotes the growth of cucumber seedlings under light-emitting diode light. Acta Agriculturae Scandinavica, Sec B-Soil & Plant Sci 2015, 65(1): 74–82. [CrossRef]
- Vilain, S.; Luo, Y.; Hildreth, M.B.; Brözel, V.S. Analysis of the life cycle of the soil saprophyte Bacillus cereus in liquid soil extract and in soil. Appl Environ Microb 2006, 72(7): 4970–4977. [CrossRef]
- Kim, D.; Langmead, B.; Salzberg, S.L. HISAT: A fast spliced aligner with low memory requirements. Nat Methods 2015, 12: 357–362. [CrossRef]
- Pertea, M.; Pertea, G.M.; Antonescu, C.M.; Chang, T.C.; Mendell, J.T.; Salzberg, S.L. StringTie enables improved reconstruction of a transcriptome from RNA-seq reads. Nat Biotechnol 2015, 33: 290–295. [CrossRef]
- Li, B.; Dewey, C.N. RSEM: accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinformatics 2011, 12: 1–16. https://doi:10.1186/1471-2105-12-323.
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014, 15: 550.
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: a bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26: 139–140. [CrossRef]
- Xie, C.; Mao, X.; Huang, J.; Ding, Y.; Wu, J.; Dong, S.; Kong, L.; Gao, G.; Li, C.Y.; Wei, L. KOBAS 2.0: a web server for annotation and identification of enriched pathways and diseases. Nucleic Acids Res 2011, 39: 316–322. [CrossRef]
- Li, Q.; Li, H.; Wang, S.; Huang, W.; Ruan, J.; Huang, S.; Xu, Y.; Zhou, Q.; Zhang, Z. A chromosome-scale genome assembly of cucumber (Cucumis sativus L.). GigaScience 2019, 8: giz072. [CrossRef]
- Miller, C.O. Evidence for the natural occurrence of zeatin and derivatives: Compounds from maize which promote cell division. PNAS 1965, 54: 1052–1058. [CrossRef]
- Jiang, W.B.; Huang, H.Y.; Hu, Y.W.; Zhu, S.W.; Wang, Z.Y.; Lin, W.H. Brassinosteroid regulates seed size and shape in Arabidopsis. Plant Physiol 2013, 162: 1965–1977. [CrossRef]
- Yan, M.Y; Xie, D.L.; Cao, J.J.; Xia, X.J.; Shi, K.; Zhou, Y.H.; Zhou, J.; Foyer, C.H.; Yu, J.Q. Brassinosteroid-mediated reactive oxygen species are essential for tapetum degradation and pollen fertility in tomato. Plant J 2020, 102: 931–947. [CrossRef]
- Lu, W.; Deng, F.; Jia, J.; Chen, X.; Li, J.; Wen, Q.; Li, T.; Meng, Y.; Shan, W. The Arabidopsis thaliana gene AtERF019 negatively regulates plant resistance to Phytophthora parasitica by suppressing PAMP-triggered immunity. Mol Plant Pathol 2020, 21: 1179–1193. [CrossRef]
- Miller, C.O. Evidence for the natural occurrence of zeatin and derivatives: Compounds from maize which promote cell division. PNAS 1965, 54: 1052–1058. [CrossRef]
- Görschen, E.; Dunaeva, M.; Reeh, I.; Wasternack, C. Overexpression of the jasmonate-inducible 23 kDa protein (JIP 23) from barley in transgenic tobacco leads to the repression of leaf proteins. FEBS Lett 1997, 419: 58–62. [CrossRef]
- Becker, W.; Apel, K. Isolation and characterization of a cDNA clone encoding a novel jasmonate-induced protein of barley (Hordeum vulgare L.). Plant Mol Biol 1992, 19: 1065–1067. [CrossRef]
- Görschen, E.; Dunaeva, M.; Reeh, I.; Wasternack, C. Overexpression of the jasmonate-inducible 23 kDa protein (JIP 23) from barley in transgenic tobacco leads to the repression of leaf proteins. FEBS Lett 1997, 419: 58–62. [CrossRef]
- Kumar, D.; Klessig, D.F. High-affinity salicylic acid-binding protein 2 is required for plant innate immunity and has salicylic acid-stimulated lipase activity. PNAS 2003, 100(26): 16101–16106. [CrossRef]
- Li, W.; Deng, Y.; Ning, Y.; He, Z.; Wang, G. Exploiting broad-spectrum disease resistance in crops: From molecular dissection to breeding. Annu Rev Plant Biol 2020, 71: 575–603. [CrossRef]
- Balbi, V.; Devoto, A. Jasmonate signalling network in Arabidopsis thaliana: crucial regulatory nodes and new physiological scenarios. New Phytol 2007, 177: 301–318. [CrossRef]
- Guo, H.; Ecker, J.R. The ethylene signaling pathway: new insights. Curr Opin Plant Biol 2004, 7: 40–49. [CrossRef]
- Kunkel, B.N.; Brooks, D.M. Cross talk between signaling pathways in pathogen defense. Curr Opin Plant Biol 2002, 5: 325–331. [CrossRef]
- Lorenzo, O.; Piqueras, R.; Sánchez, S.J.J.; Solano, R. Ethylene response factor1 integrates signals from ethylene and jasmonate pathways in plant defense. Plant Cell 2002, 15: 165–178. [CrossRef]
- Spoel, S.H.; Koornneef, A.; Claessens, S.M.C.; Korzelius, J.P.; Pelt, J.A.V.; Mueller, M.J.; Buchala, A.J.; Métraux, J.P.; Brown, R.; Kazan, K.; Loon, L.C.V.; Dong, X.; Pieterse, C.M.J. NPR1 modulates cross-talk between salicylate-and jasmonate-dependent defense pathways through a novel function in the cytosol. Plant Cell 2003, 15: 760–770. [CrossRef]
- Leon, Reyes.A; Spoel, S.H.; Lange, E.D.; Hiroshi, Abe.M.K.; Tsuda, S.; Millenaar, F.F.; Welschen, R.A.M; Ritsema, T.; Pieterse, C.M.J. Ethylene modulates the role of nonexpressor of pathogenesis-related gene1 in cross talk between salicylate and jasmonate signaling. Plant Physiol 2009, 149: 1797–1809. [CrossRef]
- Jian, H.; Lu, K.; Yang, B.; Liu, L.; Qu, C.; Li, J. Genome-wide analysis and expression profiling of the SUC and SWEET Gene families of sucrose transporters in oilseed rape (Brassica napus L.). Front Plant Sci 2016, 7: 1464–1470. [CrossRef]
- Hu, L.P.; Zhang, F.; Song, S.H.; Tang, X.W.; Xu, H.; Liu, G.M.; Wang, Y.Q.; He, H.J. Genome-wide identification, characterization, and expression analysis of the SWEET gene family in cucumber. J Integr Agr 2017, 16: 1486–1501. [CrossRef]
- Zhou, S.J.; Jing, Z.; Shi, J.L. Genome-wide identification, characterization, and expression analysis of the MLO gene family in Cucumis sativus. Genet Mol Res 2013, 12: 6565–6578. [CrossRef]
- Li, F.; Guo, S.; Chong, K.; Zhao, Y.; Chen, D.; Xu, Y. Overexpression of a homopeptide repeat-containing bHLH protein gene (OrbHLH001) from Dongxiang Wild Rice confers freezing and salt tolerance in transgenic Arabidopsis. Plant Cell Rep 2010, 29: 977–986. [CrossRef]
- Singh, K.B.; Foley, R.C.; Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr Opin Plant Biol 2002, 5: 430–436. [CrossRef]
- Hu, H.; Dai, M.; Yao, J.; Xiao, B.; Li, X.; Zhang, Q.; Xiong, L. Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances drought resistance and salt tolerance in rice. PNAS 2006, 103: 12987–12992. [CrossRef]
- Tran, L.S.P.; Nakashima, K.; Sakuma, Y.; Simpson, S.D.; Fujita, Y.; Maruyama, K.; Fujita, M.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Isolation and functional analysis of Arabidopsis stress-inducible NAC transcription factors that bind to a drought-responsive cis-element in the early responsive to dehydration stress 1 promoter. Plant Cell 2004, 16: 2481–2498.
- La Camera, S.; Gouzerh, G.; Dhondt, S.; Hoffmann, L.; Frittig, B.; Legrand, M.; Heitz, T. Metabolic reprogramming in plant innate immunity: the contributions of phenylpropanoid and oxylipin pathways. Immunol Rev 2004, 198: 267–284. [CrossRef]
- Vogt, T. Phenylpropanoid biosynthesis. Mol Plant 2010, 3(1): 2–20.
- Sundaram, M.; Min, H. Differential regulation of the NO3- and NH4+ transporter genes AtNrt2.1 and AtAmt1.1 in Arabidopsis: relation with long-distance and local controls by N status of the plant. Plant J 2010, 26(2): 143–155.
- Okamoto, M.; Vidmar, J.J.; Glass, A.D.M. Regulation of NRT1 and NRT2 gene families of Arabidopsis thaliana: Responses to nitrate provision. Plant Cell Physiol 2003, 44: 304–317. [CrossRef]
- Migocka, M.; Warzybok, A.; Kłobus, G. The genomic organization and transcriptional pattern of genes encoding nitrate transporters 1 (NRT1) in cucumber. Plant Soil 2013, 364: 245–260. [CrossRef]
- Liu, K.H.; Tsay, Y.F. Switching between the two action modes of the dual-affinity nitrate transporter CHL1 by phosphorylation. EMBO J 2003, 22: 1005–1013. [CrossRef]
- Krouk, G.; Lacombe, B.; Bielach, A.; Perrine-Walker, F.; Malinska, K.; Mounier, E.; Hoyerova, K.; Tillard, P.; Leon, S.; Ljung, K.; Zazimalova, E.; Benkova, E.; Nacry, P.; Gojon, A. Nitrate-regulated auxin transport by NRT1.1 defines a mechanism for nutrient sensing in plants. Dev Cell 2010, 18: 927–937. [CrossRef]











| Primer name | Primer sequence (5′ to 3′) | Size ( bp ) | Purpose |
| Csa1G047430-F | TGGCTTCAAATGCCTTTCTC | 938 | PCR subclone |
| Csa1G047430-R | CCAAACCCTTCTTTTGCTCA | ||
| Csa3G027720-F | AACCCCCTTTCCTCTCTTCA | 998 | |
| Csa3G027720-R | GCAGTCATTTGGGCTCTCTC | ||
| Csa5G161290-F | CACAAGCCACAATGAAC | 798 | |
| Csa5G161290-R | CATGGGGATTTTCAATGGAC | ||
| Csa2G416080-F | GATTTTTGGGGAAACCCAGT | 772 | |
| Csa2G416080-R | CTGGGTGAGGCAGACTTCTC | ||
| qRT_ACT-F | TTCTGGTGATGGTGTGAGTC | 151 | qRT-PCR |
| qRT_ACT-R | GGCAGTGGTGGTGAACATG | ||
| qRT_Csa1G047430-F | GCATCGTGGAAAAGCAGTACA | 233 | |
| qRT_Csa1G047430-R | GAAGCAAGCGGAGGCAATA | ||
| qRT_Csa3G027720-F | GCCACATCGGAAAATCGTT | 158 | |
| qRT_Csa3G027720-R | AATTCGTTGTAATGGGGTAAGG | ||
| qRT_Csa5G161290-F | CTCCGACCGCCAAAATG | 240 | |
| qRT_Csa5G161290-R | TCCAAGTGACCCAATGCTAAT | ||
| qRT_Csa2G416080-F | AGTATCGGGTCGTTGTTTGC | 162 | |
| qRT_Csa2G416080-R | AGGGCTTCCTCTTGGCTTT |
| Category | Type | Functional description | Gene-Number |
| Information storage and processing Metabolism Cellular processes and signaling Metabolism Metabolism Metabolism Metabolism Metabolism Information storage and processing Information storage and processing Information storage and processing Cellular processes and signaling Cellular processes and signaling Metabolism Metabolism Poorly characterized Cellular processes and signaling Cellular processes and signaling Cellular processes and signaling |
A C D E F G H I J K L M O P Q S T U V |
RNA processing and modification Energy production and conversion Cell cycle control, cell division, chromosome partitioning Amino acid transport and metabolism Nucleotide transport and metabolism Carbohydrate transport and metabolism Coenzyme transport and metabolism Lipid transport and metabolism Translation, ribosomal structure and biogenesis Transcription Replication, recombination and repair Cell wall/membrane/envelope biogenesis Posttranslational modification, protein turnover, chaperones Inorganic ion transport and metabolism Secondary metabolites biosynthesis, transport and catabolism Function unknown Signal transduction mechanisms Intracellular trafficking, secretion, and vesicular transport Defense mechanisms |
3 5 1 5 4 14 5 9 6 23 4 4 20 6 6 195 7 8 1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).