Submitted:
30 December 2024
Posted:
31 December 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Transformation
2.2. Construction of Gene Fusions
2.3. Chromosomal Integration
2.4. Preparation of Spores
2.5. Extraction of Spore Coat Proteins
2.6. Western and Dot Blotting Analyses
3. Results
3.1. In Silico Analysis of the CotX Structure
3.2. Construction and Spore Coat Analysis of Strains with Truncated Anchor CotX Proteins


3.3. Detection of mCherry-CotX Fusions Overproduced in B. subtilis Cells
4. Discussion
Author Contributions
Acknowledgments
Conflicts of Interest
References
- Mahmoodi, A.; Farinas, E.T. Applications of Bacillus subtilis Protein Display for Medicine, Catalysis, Environmental Remediation, and Protein Engineering. Microorganisms. 2024, 12, 97. [Google Scholar] [CrossRef]
- Stülke, J.; Grüppen, A.; Bramkamp, M.; Pelzer, S. Bacillus subtilis, a Swiss Army Knife in Science and Biotechnology. J Bacteriol. 2023, 205, e0010223. [Google Scholar] [CrossRef] [PubMed]
- Isticato, R.; Cangiano, G.; Tran, H.T.; Ciabattini, A.; Medaglini, D.; Oggioni, M.R.; De Felice, M.; Pozzi, G.; Ricca, E. Surface display of recombinant proteins on Bacillus subtilis spores. J Bacteriol. 2001, 183, 6294–301. [Google Scholar] [CrossRef]
- Isticato, R. Bacterial Spore-Based Delivery System: 20 Years of a Versatile Approach for Innovative Vaccines. Biomolecules. 2023, 13, 947. [Google Scholar] [CrossRef]
- Tan, I.S.; Ramamurthi, K.S. Spore formation in Bacillus subtilis. Environ Microbiol Rep. 2014, 6, 212–25. [Google Scholar] [CrossRef]
- Setlow, P. Spores of Bacillus subtilis: their resistance to and killing by radiation, heat and chemicals. J Appl Microbiol. 2006, 101, 514–25. [Google Scholar] [CrossRef]
- Khanna, K.; Lopez-Garrido, J.; Pogliano, K. Shaping an Endospore: Architectural Transformations During Bacillus subtilis Sporulation. Annu Rev Microbiol. 2020, 74, 361–386. [Google Scholar] [CrossRef]
- Christie, G.; Setlow, P. Bacillus spore germination: Knowns, unknowns and what we need to learn. Cell Signal. 2020, 74, 109729. [Google Scholar] [CrossRef]
- Zhang, X.; Al-Dossary, A.; Hussain, M.; Setlow, P.; Li, J. Applications of Bacillus subtilis Spores in Biotechnology and Advanced Materials. Appl Environ Microbiol. 2020, 86, e01096–20. [Google Scholar] [CrossRef]
- Mauriello, E.M.; Duc le, H.; Isticato, R.; Cangiano, G.; Hong, H.A.; De Felice, M.; Ricca, E.; Cutting, S.M. Display of heterologous antigens on the Bacillus subtilis spore coat using CotC as a fusion partner. Vaccine. 2004, 22, 1177–87. [Google Scholar] [CrossRef]
- Kim, J.H.; Lee, C.S.; Kim, B.G. Spore-displayed streptavidin: a live diagnostic tool in biotechnology. Biochem Biophys Res Commun. 2005, 331, 210–4. [Google Scholar] [CrossRef] [PubMed]
- Hwang, B.Y.; Pan, J.G.; Kim, B.G.; Kim, J.H. Functional display of active tetrameric beta-galactosidase using Bacillus subtilis spore display system. J Nanosci Nanotechnol. 2013, 13, 2313–9. [Google Scholar] [CrossRef]
- Hinc, K.; Iwanicki, A.; Obuchowski, M. New stable anchor protein and peptide linker suitable for successful spore surface display in B. subtilis. Microb Cell Fact. 2013, 12, 22. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Yang, R.; Hua, X.; Zhang, W.; Zhao, W. An Approach for Lactulose Production Using the CotX-Mediated Spore-Displayed β-Galactosidase as a Biocatalyst. J Microbiol Biotechnol. 2016, 26, 1267–77. [Google Scholar] [CrossRef]
- McKenney, P.T.; Driks, A.; Eskandarian, H.A.; Grabowski, P.; Guberman, J.; Wang, K.H.; Gitai, Z.; Eichenberger, P. A distance-weighted interaction map reveals a previously uncharacterized layer of the Bacillus subtilis spore coat. Curr Biol. 2010, 20, 934–8. [Google Scholar] [CrossRef]
- Zhang, J.; Fitz-James, P.C.; Aronson, A.I. Cloning and characterization of a cluster of genes encoding polypeptides present in the insoluble fraction of the spore coat of Bacillus subtilis. J Bacteriol. 1993, 175, 3757–66. [Google Scholar] [CrossRef]
- Bartels, J.; Blüher, A.; López Castellanos, S.; Richter, M.; Günther, M.; Mascher, T. The Bacillus subtilis endospore crust: protein interaction network, architecture and glycosylation state of a potential glycoprotein layer. Mol Microbiol. 2019, 112, 1576–1592. [Google Scholar] [CrossRef]
- Shuster, B.; Khemmani, M.; Abe, K.; Huang, X.; Nakaya, Y.; Maryn, N.; Buttar, S.; Gonzalez, A.N.; Driks, A.; Sato, T.; Eichenberger, P. Contributions of crust proteins to spore surface properties in Bacillus subtilis. Mol Microbiol. 2019, 111, 825–843. [Google Scholar] [CrossRef]
- Shaner, N.C.; Campbell, R.E.; Steinbach, P.A.; Giepmans, B.N.; Palmer, A.E.; Tsien, R.Y. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004, 22, 1567–72. [Google Scholar] [CrossRef]
- Hinc, K.; Ghandili, S.; Karbalaee, G.; Shali, A.; Noghabi, K.A.; Ricca, E.; Ahmadian, G. Efficient binding of nickel ions to recombinant Bacillus subtilis spores. Res Microbiol. 2010, 161, 757–64. [Google Scholar] [CrossRef]
- Hinc, K.; Isticato, R.; Dembek, M.; Karczewska, J.; Iwanicki, A.; Peszyńska-Sularz, G.; De Felice, M.; Obuchowski, M.; Ricca, E. Expression and display of UreA of Helicobacter acinonychis on the surface of Bacillus subtilis spores. Microb Cell Fact. 2010, 9, 2. [Google Scholar] [CrossRef]
- Negri, A.; Potocki, W.; Iwanicki, A.; Obuchowski, M.; Hinc, K. Expression and display of Clostridium difficile protein FliD on the surface of Bacillus subtilis spores. J Med Microbiol. 2013, 62, 1379–1385. [Google Scholar] [CrossRef] [PubMed]
- Gao, C.; Xu, X.; Zhang, X.; Che, B.; Ma, C.; Qiu, J.; Tao, F.; Xu, P. Chemoenzymatic synthesis of N-acetyl-D-neuraminic acid from N-acetyl-D-glucosamine by using the spore surface-displayed N-acetyl-D-neuraminic acid aldolase. Appl Environ Microbiol. 2011, 77, 7080–3. [Google Scholar] [CrossRef] [PubMed]
- Chen, H.; Tian, R.; Ni, Z.; Zhang, Q.; Zhang, T.; Chen, Z.; Chen, K.; Yang, S. Surface display of the thermophilic lipase Tm1350 on the spore of Bacillus subtilis by the CotB anchor protein. Extremophiles. 2015, 19, 799–808. [Google Scholar] [CrossRef]
- Chen, H.; Zhang, T.; Jia, J.; Vastermark, A.; Tian, R.; Ni, Z.; Chen, Z.; Chen, K.; Yang, S. Expression and display of a novel thermostable esterase from Clostridium thermocellum on the surface of Bacillus subtilis using the CotB anchor protein. J Ind Microbiol Biotechnol. 2015, 42, 1439–48. [Google Scholar] [CrossRef] [PubMed]
- Tavassoli, S.; Hinc, K.; Iwanicki, A.; Obuchowski, M.; Ahmadian, G. Investigation of spore coat display of Bacillus subtilis β-galactosidase for developing of whole cell biocatalyst. Arch Microbiol. 2013, 195, 197–202. [Google Scholar] [CrossRef] [PubMed]
- Yuan, Y.; Feng, F.; Chen, L.; et al. Surface display of Acetobacter pasteurianus AdhA on Bacillus subtilis spores to enhance ethanol tolerance for liquor industrial potential. Eur Food Res Technol 2014, 238, 285–293. [Google Scholar] [CrossRef]
- Chan, B.C.; Li, P.; Tsang, M.S.; Sung, J.C.; Kwong, K.W.; Zheng, T.; Hon, S.S.; Lau, C.P.; Cheng, W.; Chen, F.; Lau, C.B.; Leung, P.C.; Wong, C.K. Creating a Vaccine-like Supplement against Respiratory Infection Using Recombinant Bacillus subtilis Spores Expressing SARS-CoV-2 Spike Protein with Natural Products. Molecules. 2023, 28, 4996. [Google Scholar] [CrossRef]
- He, W.; Jiang, B.; Mu, W.; Zhang, T. Production of d-Allulose with d-Psicose 3-Epimerase Expressed and Displayed on the Surface of Bacillus subtilis Spores. J Agric Food Chem. 2016, 64, 7201–7. [Google Scholar] [CrossRef]
- Vetráková, A.; Chovanová, R.K.; Rechtoríková, R.; Krajčíková, D.; Barák, I. Bacillus subtilis spores displaying RBD domain of SARS-CoV-2 spike protein. Comput Struct Biotechnol J. 2023, 21, 1550–1556. [Google Scholar] [CrossRef] [PubMed]
- Imamura, D.; Kuwana, R.; Takamatsu, H.; Watabe, K. Proteins involved in formation of the outermost layer of Bacillus subtilis spores. J Bacteriol. 2011, 193, 4075–80. [Google Scholar] [CrossRef]
- Abe, K.; Kawano, Y.; Iwamoto, K.; Arai, K.; Maruyama, Y.; Eichenberger, P.; Sato, T. Developmentally-regulated excision of the SPβ prophage reconstitutes a gene required for spore envelope maturation in Bacillus subtilis. PLoS Genet. 2014, 10, e1004636. [Google Scholar] [CrossRef] [PubMed]
- Sambrook, J.; Fritsch, E.F. ; Maniatis, T Molecular cloning: a laboratory manual. 4th edition. Cold Spring Harbor, N.Y: Cold Spring Harbor Laboratory Press, USA. 2012.
- Julkowska, D.; Obuchowski, M.; Holland, I.B.; Séror, S.J. Comparative analysis of the development of swarming communities of Bacillus subtilis 168 and a natural wild type: critical effects of surfactin and the composition of the medium. J Bacteriol. 2005, 187, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Anagnostopoulos, C.; Spizizen, J. Requirements for transformation in Bacillus subtilis. J Bacteriol. 1961, 81, 741–746. [Google Scholar] [CrossRef]
- Isticato, R.; Cangiano, G.; De Felice, M.; Ricca, E. Display of Molecules on the Spore Surface. In Bacterial Spore Formers. Edited by Ricca, E.; Henriques, A.O.; Cutting, S.M. Norfolk, UK: Horizon Biosience. 2004, 193–200.
- Nicholson, W.L.; Setlow, P. Sporulation, germination and outgrowth. In Molecular biological methods for Bacillus. Edited by Harwood C, Cutting S. Chichester, United Kingdom: Wiley, 1990:391–450.


| Strain | Relevant genotype | Source |
| 168 | trpC2 | [6] |
| BWP 46 | 168 pWP02 (cotX-mCherry) | this work |
| BWP 48 | 168 pWP04 (cotX ΔH-mCherry) | this work |
| BWP 50 | 168 pWP06 (cotX ΔSH -mCherry) | this work |
| BWP 52 | 168 pWP08 (cotX ΔHSH -mCherry) | this work |
| BWP 54 | 168 pWP010 (cotX ΔHHSH -mCherry) | this work |
| BWP 56 | 168 pWP012 (cotX ΔSHHSH -mCherry) | this work |
| BWP 58 | 168 pWP014 (cotX ΔHSHHSH -mCherry) | this work |
| BWP 53 | 168 amyE:: cotX-mCherry CmR | this work |
| BWP 55 | 168 amyE:: cotX ΔSH-mCherry CmR | this work |
| BWP 57 | 168 amyE:: cotX ΔHHSH-mCherry CmR | this work |
| BWP59 | 168 amyE:: cotX ΔHSHHSH-mCherry CmR | this work |
| Plasmid | ||
| pHT08 | IPTG inducible expression vector | MoBitec (Germany) |
| pDL | shuttle vector | Bacillus Genetic Stock Center |
| pWP01 | pDL, cotX-mCherry | this work |
| pWP02 | pHT08, cotX-mCherry | this work |
| pWP04 | pHT08, cotX ΔH-mCherry | this work |
| pWP05 | pDL, cotX ΔSH -mCherry | this work |
| pWP06 | pHT08, cotX ΔSH -mCherry | this work |
| pWP08 | pHT08, cotX ΔHSH -mCherry | this work |
| pWP09 | pDL, cotX ΔHHSH -mCherry | this work |
| pWP010 | pHT08, cotX ΔHHSH -mCherry | this work |
| pWP012 | pHT08, cotX ΔSHHSH -mCherry | this work |
| pWP013 | pDL, cotX ΔHSHHSH -mCherry | this work |
| pWP014 | pHT08, cotX ΔHSHHSH -mCherry | this work |
| Forward primer | |
| Full-length CotX | 5' CAGCGGCCGCAATCACGTGGGTGGAGGAG 3' |
| mCherry | 5' CGGATCCATGGTTTCAAAAGGCG 3' |
| Reverse primers | |
| Full-length CotX | 5' CTATCTAGATTAGAGGACAAGAGTGATAAC 3' |
| CotX dH | 5' CTATCTAGATTATACTGTTGTGACGTTTAC 3' |
| CotX dSH | 5' CTATCTAGATTAGCGGTTTACTTGTTTGTT 3' |
| CotX dHSH | 5' CTATCTAGATTAGTCTGCAATTGATGTCAG 3' |
| CotX dHHSH | 5' CTATCTAGATTAGTCTGTAGATGTAACATTG 3' |
| CotX dSHHSH | 5' CTATCTAGATTATGAAACTTGTTTGTTGAG 3' |
| CotX dHSHHSH | 5' CTATCTAGATTAGAAGGCGTTGTCGTTGCC 3' |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).