Submitted:
02 December 2024
Posted:
03 December 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Test Insects
2.2. Injection Experiment
2.3. Total RNA Extraction and Sequencing
2.4. Gene Expression Quantification and Differential Analysis
2.5. Identification and Analysis of Immune-Related Genes
2.6. qPCR Verification of S. frugiperda Immune Receptor Genes
3. Results
3.1. Transcriptome Sequencing Data Statistics and Analysis
3.2. Differentially Expressed Gene Analysis
3.3. GO Functional Enrichment Analysis
3.4. KEGG Pathway Enrichment Analysis
3.5. Screening of Immune-Related Genes
3.6. Analysis of Immune-Related Genes
3.6.1. Pattern Recognition Receptors
3.6.2. Immune Regulatory Factors

3.6.3. Signal Transduction Factors

3.6.4. Immune Effector Factors
3.7. Effects of Pathogenic Microbial Infection on the Expression of PGRP and βGRP Immune Genes in S. frugiperda
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix 1. Summary of main immune genes of S. frugiperda.
| Gene Functions | Gene | Encoded Protein | Protein Function | Number | |
|
Pattern Recognition Receptors |
Ubiquitin-conjugating enzyme | Ubiquitin-conjugating enzyme | Immune recognition | 20 | |
| DSCAM | Down syndrome cell adhesion molecule | Immune recognition,phagocytosis | 11 | ||
| βGRP | β-1,3-glucan recognition protein | Immune recognition | 3 | ||
| PGRP | Peptidoglycan recognition protein | Immune recognition | 9 | ||
| C-type lectin | C-type lectin | Immune recognition, phagocytosis, melanization | 2 | ||
| TEP | Thioester-containing protein | Immune recognition, phagocytosis | 1 | ||
| Galectin | Galectin | Immune recognition, phagocytosis | 8 | ||
| ApoLp | Apolipoprotein family member | Immune recognition, apoptosis, phagocytosis | 2 | ||
| SR | Scavenger receptor | Immune recognition, phagocytosis | 9 | ||
| Croquemort | Scavenger receptor | Immune recognition | 1 | ||
| Integrin | Integrin | Immune recognition, encapsulation, phagocytosis | 27 | ||
| Vitellogenin | Vitellogenin | Immune recognition, phagocytosis | 5 | ||
|
Signal Transduction and Regulation |
Regulators |
SP | Serine protease | Activates Toll signaling pathway, melanization | 61 |
| Serpin | Serine protease inhibitor | Regulates Toll signaling pathway, melanization | 20 | ||
| Trypsin | Trypsin | Melanization, activates Toll signaling pathway | 107 | ||
| Elastase | Elastase | Melanization, activates Toll signaling pathway | 5 | ||
|
Toll Signaling Pathway |
Spätzle | Spätzle-like protein | Activates Toll signaling pathway | 5 | |
| Toll | Toll protein | Activates Toll signaling pathway | 20 | ||
| MyD88 | Cytoplasmic protein | Activates NF-κB transcription factor | 1 | ||
| Pelle | Cytoplasmic protein | Activates NF-κB transcription factor | 1 | ||
| Cactus | Inhibitor | Synthesis of antimicrobial peptides | 1 | ||
| DorSAl | NF-κB transcription factor | Synthesis of antimicrobial peptides | 2 | ||
| Cactin | Regulator | Regulates Toll signaling pathway | 1 | ||
| Pellino | Regulator | Regulates Toll signaling pathway | 1 | ||
|
IMD Signaling Pathway |
TAK1 | TGF-βactivated kinase | Activates IMD and JNK signaling pathways | 1 | |
| IKK | Protein kinase | Activates NF-κB transcription factor | 2 | ||
| Sickie | Inhibitor | Regulates IMD signaling pathway | 1 | ||
| Akirin | Nuclear protein | Immune modulation | 1 | ||
| Cullin | SCF complex subunit | Regulates IMD signaling pathway | 6 | ||
|
JAK-STAT Signaling Pathway |
SOCS | Suppressor of cytokine signaling | Regulates JAK-STAT signaling pathway | 3 | |
| Hop | JAK tyrosine kinase signaling molecule | Activates JAK-STAT signaling pathway | 1 | ||
| PIAS | Protein inhibitors of activated STATs | Synthesis of antimicrobial peptides | 1 | ||
| STAT | Signal transducer and activator of transcription | Synthesis of antimicrobial peptides | 2 | ||
|
MAPK-JNK -p38 Signaling Pathway |
activating protein | Transcription factor complex | Switch for initiating gene transcription | 39 | |
| MKK4 | MAPKK4 kinase | Activates JNK pathway | 1 | ||
| Eiger | Receptor protein | Activates JNK pathway | 1 | ||
| Wengen | Receptor protein | Activates JNK pathway | 1 | ||
| RNA Interference |
Vig | Argonaut homolog gene | Forms RISC complex | 1 | |
| Ago-2 | RNA-binding protein | Participates in RNA interference, antiviral response | 3 | ||
|
Autophagy |
PI3K | Phosphoinositide 3-kinase | Autophagy signal transduction | 2 | |
| TOR | Target of rapamycin | Regulates autophagy | 1 | ||
| Dronc | Caspase | Initiates apoptosis | 1 | ||
|
Immune Effectors |
Lysozyme | Lysozyme | Degrades peptidoglycan, antimicrobial | 7 | |
| Attacin | Antimicrobial peptide | Pathogen inhibition | 5 | ||
| Defense | Defensin | Pathogen inhibition | 2 | ||
| Cecropin | Cecropin | Pathogen inhibition | 1 | ||
| Holotricin | Antimicrobial peptide | Pathogen inhibition | 1 | ||
| Anionic antimicrobial peptide | Anionic antimicrobial peptide | Pathogen inhibition | 2 | ||
| Chitinase | Chitinase | Degrades chitin, antimicrobial | 11 | ||
| Heat Shock Protein | Heat Shock Protein | Stress response, antiviral reaction | 18 | ||
| Actin | Actin | Stress response, antiviral reaction | 39 | ||
| phenoloxidase | Phenoloxidase | Melanization | 15 | ||
| Hexamerin | Hexamerin | Melanization | 3 | ||
| Arylphorin | Arylphorin | Melanization | 2 | ||
| Nitric Oxide Synthase | Nitric Oxide Synthase | Generates free radicals | 4 | ||
| NADPH oxidase | NADPH Oxidase | Generates free radicals | 2 | ||
| Peroxidase | Peroxidase | Generates free radicals | 18 | ||
| Glutathione S-transferase | Glutathione S-transferase | Regulates free radicals | 24 | ||
| SOD | Superoxide Dismutase (SOD) | Regulates free radicals | 6 | ||
| Catalase | Catalase | Regulates free radicals | 20 | ||
| Thioredoxin | Thioredoxin | Regulates free radicals | 17 | ||
| gloverin | Gloverin | Inhibits pathogens | 2 | ||
| lebocin | Antimicrobial Peptide | Inhibits pathogens | 2 | ||
| cadherin | Cadherin | Signal transmission | 15 | ||
| Lysine | Lysozyme | Degrades peptidoglycan, antimicrobial | 48 | ||
References
- Wang, L.; Chen, K.H.; Zhong, G.H. Progress for occurrence and management and the strategy of the fall armyworm Spodoptera frugiperda (Smith). Journal of Environmental Entomology,2019, 41(3): 479-487.
- Rebeca G. M., David M. S., Blanco C. A. Field-Evolved Resistance of the Fall Armyworm (Lepidoptera: Noctuidae) to Synthetic Insecticides in Puerto Rico and Mexico. Journal of Economic Entomology, 2019(2): 792-802.
- Hu, F.; Xu, T.T.; Su, X.Y. Control Efficacy of Bacillus thuringiensis Tiny Microgranules on Maize Lepidopteran Pests. Chinese Journal of Biological Control, 2022, Doi: 10.16409/j.cnki.2095-039x.
- Xu, Y.D.; Wei, H.S.; Shi, J.W. Comparison of virulence of three Beauveria bassiana strains against fall armyworm Spodoptera frugiperda. Journal of Plant Protection, 2020, 47(4): 867-874.
- Hu, F.; Xu, T.T.; Hu, B.J. Control Efficacy of Biopesticide Bacillus thuringiensis G033A Combined with Reduced Low Dose Chemical Pesticides on Spodoptera frugiperda. Chinese Journal of Biological Control,2021, 37(6): 1103-1110.
- Alaka, S.; Shasank, S.S.; Behera, A. Antimicrobial Peptides Derived from Insects Offer a Novel Therapeutic Option to Combat Biofilm: A Review[J]. Frontiers in Microbiology, 2021, 12.
- Yi, H.Y.; Chowdhury, M.; Huang, Y.D. Insect antimicrobial peptides and their applications. Applied Microbiology and Biotechnology, 2014, 98(13): 5807-5822.
- Bai, Y.Y.; Sun, J.Q. Immunological and stress responses of fall armyworm Spodoptera frugiperda larvae to injecting Escherichia coli. Journal of Plant Protection,2020, 47(4): 859-866.
- Li, E.T.; Lu, Q.H.; Zhang, D.F. Effects of infection of the entomopathogenic nematode Steinernema carpocapsae All on the innate immune response in Spodoptera frugiperda (Lepidoptera: Noctuidae) larvae. Acta Entomologica Sinica, 2022, 65(12):1623-1635. DOI: 10.16380/j.kcxb.2022.12.008.
- Sun, J.Q.; Bai, Y.Y. Predator-induced stress influences fall army-worm immune response to inoculating bacteria. Journal of Inver-tebrate Pathology, 2020, 172: 107352.
- Shu, B.S.; Huang, Y.T.; Yu, X.Y. Expression Stability of Reference Genes in Larvae of Spodoptera frugipferda Under Azadirachtin Stress by Real-Time Quantitative PCR Analysis. Guangdong Agricultural Sciences, 2024, 51(8): 21-30..
- Wu, T.Y.; Zhao, Y.; Wang, Z.Y.; Song, Q.S.; Wang, Z.X.; Xu, Q.W.; Wang, Y.; Wang, L.; Zhang, Y.; Feng, C. β-1,3-glucan recognition protein 3 activates the prophenoloxidase system in response to bacterial infection in Ostrinia furnacalis guenée. Dev. Comp. Immunol. 2018, 79,31-43..
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR. Methods 2002, 25,402–408.
- Dziarski, R.; Gupta, D. The peptidoglycan recognition proteins (PGRPs) [J]. Genome Biology, 2006, 7(8): 232.
- Werner, T.; Liu, G.; Kang, D. A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proceedings of the National Academy of Sciences of the United StatesofAmerica, 2000,97(25): 13772-13777.
- Lemaitre, B.; Hoffmann, J. The host defense of Drosophila Melanogaster. Annual Review of Immunology, 2007,25: 697-743.
- Tanaka, H.; Ishibashi, J.; Fujita, K. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori [J]. Insect Biochem Mol Biol, 2008, 38(12): 1087-110.
- Meng, Q.; Yu, H.Y.; Zhang, H. Transcriptomic insight into the immune defenses in the ghost moth, Hepialus xiaojinensis, during an Ophiocordyceps sinensis fungal infection [J]. Insect Biochem Molec, 2015, 64: 1-15.
- Ochiai, M.; Ashida, M. A pattern-recognition protein for beta-1,3-glucan. The binding domain and the cDNA cloning of beta-1,3-glucan recognition protein from the silkworm, Bombyx mori [J]. J Biol Chem, 2000, 275(7): 4995-5002.
- Christophides, G.K.; Zdobnov, E.; Barillas-Mury, C. Immunity-related genes and gene families in Anopheles gambiae [J]. Science, 2002, 298(5591): 159-65.
- Xiong, G. H.; Xing, L.S.; Lin, Z. High throughput profiling of the cotton bollworm Helicoverpa armigera immunotranscriptome during the fungal and bacterial infections [J]. BMC Genomics, 2015, 16(1): 321.
- Zou, Z.; Jiang, H. Gene structure and expression profile of Manduca sexta prophenoloxidase-activating proteinase-3 (PAP-3), an immune protein containing two clip domains. Insect Mol Biol. 2005 Aug;14(4): 433-42.
- Meng, Q.; Yu, H.Y.; Zhang, H. Transcriptomic insight into the immune defenses in the ghost moth, Hepialus xiaojinensis, during an Ophiocordyceps sinensis fungal infection [J]. Insect Biochem Molec, 2015, 64:1-15.
- Liu, Y.; Shen, D.; Zhou, F. Identification of immunity-related genes in Ostrinia furnacalis against entomopathogenic fungi by RNA-seq analysis [J]. PLoS One, 2014, 9(1): e86436.
- Wang, Y.; Cheng, T.; Rayaprolu, S.; Zou, Z.; Xia, Q.; Xiang, Z.; Jiang, H. Proteolytic activation of pro-spätzle is required for the induced transcription of antimicrobial peptide genes in lepidopteran insects. Dev. Comp. Immunol, 2007, 31, 1002–1012.
- Huang, X.Y. Discovery of a new splicing isomer of silkworm BmSpatzle4 and its immune response to different microorganisms in the body wall [D]. Jiangsu University of Science and Technology, 2019.
- Lu, D.; Geng, D.; Hou, C.; Huang, Y.; Qin, G.; Guo, X. Bombyx mori cecropin A has a high antifungal activity to entomopathogenic fungus Beauveria bassiana [J]. Gene, 2016, 583(1): 29-35.
- Yi, H.; Chowdhury, M.; Huang, Y.; Yu, X. Insect antimicrobial peptides and their applications[J]. Applied Microbiology & Biotechnology, 2014, 98(13): 5807-5822.
- Lu, Y.; Su, F.; Li, Q.; Zhang, J.; Li, Y.; Tang, T.; Hu, Q.; Yu, X.Q. Pattern recognition receptors in Drosophila immune responses. Developmental and Comparative Immunology, 2020, 102: 103468.
- Gunaratna, R.T.; Jiang, H. A comprehensive analysis of the Manduca sexta immunotranscriptome [J]. Dev Comp Immunol, 2013, 39(4): 388-98.
- Xia, X.; Yu, L.; Xue, M. Genome-wide characterization and expression profiling of immune genes in the diamondback moth, Plutella xylostella (L.) [J]. Sci Rep, 2015, 5: 9877.
- Xu, L.; Zhang, Y.; Zhang, S. Comparative analysis of the immune system of an invasive bark beetle, Dendroctonus Bombyx mori, infected by an entomopathogenic fungus [J]. Dev Comp Immunol, 2018, 88: 65-9.
- Song, X.M.; Wang, M.F.; Dong, L. PGRP-LD mediates A. stephensi vector competency by regulating homeostasis of microbiota-induced peritrophic matrix synthesis [J]. Plos Pathogens, 2018, 14(2): e1006899.
- Yoshida, H.; Kinoshita, K.; Ashida, M. Purification of a peptidoglycan recognition protein from hemolymph of the silkworm, Bombyx mori [J]. J Biol Chem, 1996, 271(23): 13854-60.
- Chang, C.; Chelliah, Y.; Borek, D.; Mengin-Lecreulx, D.; Deisenhofer, J. Structure of tracheal cytotoxin in complex with a heterodimeric pattern-recognition receptor[J]. Science, 2006, 311(5768): 1761-1764.
- Choe, K.M.; Werner, T.; Stoven, S. Requirement for a peptidoglycan recognition protein (PGRP) in Relish activation and antibacterial immune responses in Drosophila [J]. Science, 2002, 296(5566): 359-62.
- Wang, X.H.; 2018. Mechanism of peptidoglycan recognition protein RfPGRP-S1 in the maintenance of intestinal flora homeostasis in red palm weevil [D]. Fujian Agriculture and Forestry University.
- Wang, X.H. PGRP-S1 Downregulates the Intestinal Immunity to Maintain the Homeostasis of Gut Microbiota in Rhynchophorus ferrugineus Olivier. Fujian Agriculture and Forestry University, 2018.
- Werner, T.; Borge-Renberg, K.; Mellroth, P.; Steiner, H.; Dan, H. Functional diversity of the Drosophila PGRP-LC gene cluster in the response to lipopolysaccharide and peptidoglycan. J. Biol. Chem. 2003, 278,26319–26322.














| Primer | Forward primer | Reverse primer |
|---|---|---|
| PGRP-LE2 | ATTTCGCACACTGCTACCGA | TGGACTGAGAGTAGACGCCA |
| PGRP-LB | CAAGGAAGACTGCTCAGCGA | AGGCAGTTCCAGGACATTCG |
| PGRP-LB1 | GCACGCGCTACATTTCAACA | TTGAAGAGTGCGTCTCCTGG |
| PGRP-LB2 | AGACCGCCTAATGGTTCGAC | AGCCAAGCTTCACTCCAGTC |
| PGRP-L1 | AGCAGCCAATGGAATCAGGA | GAGAGCTGACTATGGGCCAC |
| PGRP-L2 | GTCAGCTTGCTCCTGGTGAT | ATCGTTCCGTTCCCGTTTGA |
| PGRP-L3 | GAATTGCGCAGCTGAGATGG | CAAGCTCGACACCCTTGTCT |
| PGRP-S1 | AAATGGGGACTGTGGCGTAG | CGTATACTTTGCCGTTGCCG |
| PGRP-S2 | TTGTGTCGAGGATCGGTTGG | CTCATACACTGTCCCCTGGC |
| βGRP1 | GAAGTGCTCCAACCGAAGGA | CGAATATGGTTTGGCCTGCG |
| βGRP2 | CCCTGGAGAACCGGACTTTC | AGGTGATGATCGGTGGGAGA |
| βGRP3 | GTTAGCCGGAGTATTGGCGA | AATCTCCGGCGGGCATTTTA |
| PRL18 | GCCAAGACCGTTCTGCTGC | CGCTCGTGTCCCTTAGTGC |
| PRL3 | CCAAGGGTAAAGGATACAAAGGTG | TCATTCACCGTTGCCCGT |
| SAmple | Raw reads | Raw bases | Clean bases | Error rate(%) | Q20(%) | Q30(%) | GC pct(%) |
|---|---|---|---|---|---|---|---|
| PBS | 54529714 | 8180000000 | 7540000000 | 0.01 | 98.49 | 95.76 | 45.95 |
| Ec | 48893730 | 7330000000 | 6940000000 | 0.01 | 98.67 | 96.11 | 46.7 |
| Bt | 48788450 | 7320000000 | 6890000000 | 0.01 | 98.46 | 95.72 | 45.24 |
| SA | 51879208 | 7780000000 | 7460000000 | 0.01 | 98.67 | 96.2 | 45.3 |
| Bb | 46291118 | 6940000000 | 6720000000 | 0.01 | 98.56 | 95.96 | 45.15 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).