Submitted:
30 September 2024
Posted:
03 October 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Study Population and Selection Criteria
4.2. RNA Extraction and cDNA Synthesis
4.3. Evaluation of Inflammasome Gene Expression
4.4. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Touitou, I. The spectrum of Familial Mediterranean Fever (FMF) mutations. Eur. J. Hum. Genet. 2001, 9, 473–483. [Google Scholar] [CrossRef]
- Schnappauf, O.; Chae, J.J., Kastner; Kastner, D.L.; Aksentijevich, I. The pyrin inflammasome in health and disease. Front. Immunol. 2019, 10, 1745. [Google Scholar] [CrossRef]
- Milhavet, F.; Cuisset, L.; Hoffman, H.M.; Slim, R.; El-Shanti, H.; Aksentijevich, I.; Lesage, S.; Waterham, H.; Wise, C.; Menthiere, C.S.; Touitou, I. The infevers autoinflammatory mutation online registry: Update with new genes and functions. Hum. Mutat. 2008, 29, 803–808. [Google Scholar] [CrossRef]
- Ben-Zvi, I.; Herskovizh, C.; Kukuy, O.; et al. Familial Mediterranean fever without MEFV mutations: A case–control study. Orphanet J Rare Dis 2015, 10, 34. [Google Scholar] [CrossRef]
- Marek-Yagel, D.; Berkun, Y.; Padeh Sh Abu, A.; Reznik-Wolf, H.; Livneh, A.; Pras, M.; Pras, E. Clinical disease among patients heterozygous for familial Mediterranean fever. Arthritis. Rheum. 2009, 60, 1862–1866. [Google Scholar] [CrossRef]
- Grandemange, S.; Soler, S.; Touitou, I. Expression of the familial Mediterranean fever gene is regulated by nonsense-mediated decay. Human molecular genetics 2009, 18, 4746–4755. [Google Scholar] [CrossRef]
- Papin, S.; Duquesnoy, P.; Cazeneuve, C.; Pantel, J.; Coppey-Moisan, M.; Dargemont, C.; Amselem, S. Alternative splicing at the MEFV locus involved in familial Mediterranean fever regulates translocation of the marenostrin/pyrin protein to the nucleus. Hum. Mol. Genet. 2000, 9, 3001–3009. [Google Scholar] [CrossRef]
- Erdem, G.C.; Erdemir, S.; Abaci, I.; Aydin, A.K.K.; Everest, E.; Turanli, E.T. Alternatively spliced MEFV transcript lacking exon 2 and its protein isoform pyrin-2d implies an epigenetic regulation of the gene in inflammatory cell culture models. Genet. Mol. Biol. 2017, 40, 688–697. [Google Scholar] [CrossRef]
- Matzner, Y.; Abedat, S.; Shapiro, E.; Eisenberg, S.; Bar-Gil-Shitrit, A.; Stepensky, P.; Calco, S.; Azar, Y.; Urieli-Shoval, S. Expression of the familial Mediterranean fever gene and activity of the C5a inhibitor in human primary fibroblast cultures. Blood 2000, 96, 727–731. [Google Scholar] [CrossRef]
- de Torre-Minguela, C.; Del Castillo, P.M.; Pelegrín, P. The NLRP3 and pyrin inflammasomes: Implications in the pathophysiology of autoinflammatory diseases. Front. Immunol. 2017, 8, 43. [Google Scholar] [CrossRef]
- Ozkurede, V.U.; Franchi, L. Immunology in clinic review series; focus on autoinflammatory diseases: Role of inflammasomes in autoinflammatory syndromes. Clin. Exp. Immunol. 2012, 167, 382–390. [Google Scholar] [CrossRef]
- Franchi, L.; Eigenbrod, T.; Munoz-Planillo, R.; Nunez, G. The inflammasome: A caspase-1-activation platform that regulates immune responses and disease pathogenesis. Nat. Immunol. 2009, 10, 241–247. [Google Scholar] [CrossRef]
- Bauernfeind, F.; Ablasser, A.; Bartok, E.; et al. Inflammasomes: Current understanding and open questions. Cell Mol. Life Sci. 2011, 68, 765–783. [Google Scholar] [CrossRef]
- Manukyan, G.; Aminov, R. Update on pyrin functions and mechanisms of Familial Mediterranean fever. Front. Microbiol. 2016, 7, 456. [Google Scholar] [CrossRef]
- Heilig, R.; Broz, P. Function and mechanism of the pyrin inflammasome. Eur. J. Immunol. 2018, 48, 230–238. [Google Scholar] [CrossRef]
- Repa, A.; Bertsias, G.K.; Petraki, E.; Choulaki, C.; Vassou, D.; Kambas, K.; Sidiropoulos, P. Dysregulated production of interleukin-1β upon activation of the NLRP3 inflammasome in patients with familial Mediterranean fever. Human Immunol. 2015, 76, 488–495. [Google Scholar] [CrossRef]
- Chae, J.J.; Wood, G.; Masters, S.L.; Richard, K.; Park, G.; Smith, B.J.; Kastner, D.L. The B30. 2 domain of pyrin, the familial Mediterranean fever protein, interacts directly with caspase-1 to modulate IL-1β production. PNAS 2006, 103, 9982–9987. [Google Scholar] [CrossRef]
- Chae, J.J.; Wood, G.; Richard, K.; Jaffe, H.; Colburn, N.T.; Masters, S.L.; Kastner, D.L. The familial Mediterranean fever protein, pyrin, is cleaved by caspase-1 and activates NF-κB through its N-terminal fragment. Blood 2008, 112, 1794–1803. [Google Scholar] [CrossRef]
- Ben-David, H.; Livneh, A.; Lidar, M.; Feld, O.; Yahia, S.H.; Grossman, C.; Ben-Zvi, I. Toll-like receptor 2 is overexpressed in Familial Mediterranean fever patients and is inhibited by colchicine treatment. Best Pract. Res. Clin. Rheumatol. 2018, 32, 651–661. [Google Scholar] [CrossRef]
- Jamilloux, Y.; Lefeuvre, L.; Magnotti, F.; Martin, A.; Benezech, S.; Allatif, O.; Henry, T. Familial Mediterranean fever mutations are hypermorphic mutations that specifically decrease the activation threshold of the pyrin inflammasome. Rheumatology (Oxford) 2018, 57, 100–111. [Google Scholar] [CrossRef]






| 1 | gapdh_s1_f | AGCCTCAAGATCATCAGCAAT |
| gapdh_s1_r | GTCATGAGTCCTTCCACGATAC | |
| 2 | p65_s1_f | CTGTCCTTTCTCATCCCATCTT |
| p65_s1_r | ACACCTCAATGTCCTCTTTCTG | |
| 3 | p65_s3_f | TACCTGCCAGATACAGACGA |
| p65_s3_r | CCGCTGAAAGGACTCTTCTT | |
| 4 | casp_s1_f | TTTCCGCAAGGTTCGATTT |
| casp_s1_r | CCTGGGAAGAGGTAGAAACA | |
| 5 | mefv_i1_s1_f | ATTCGGTCACCGGAAGG |
| mefv_i1_s1_r | GGAATCACGCACACAGGTA | |
| 6 | mefv_i2_s1_f | ACTCTGCTGGTCACCTACTAT |
| mefv_i2_s1_r | GGTGGCCTTCCCTGAATG | |
| 7 | mefv_i2_s2_f | GGCAGCCATTCAGGGAAG |
| mefv_i2_s2_r | GGAATCACGCACACAGGTA | |
| 8 | mefv_i1.2_s2_f | AGATCAGGAAGGCATATGACAC |
| mefv_i1.2_s2_r | CTCCAATGTCCTGCAGAAGT | |
| 9 | nlrp3_s1_f | GAAGAGGAGTGGATGGGTTTAC |
| nlrp3_s1_r | CTTTCTGTACTTCTTACGGTAATCTTTC | |
| 10 | nlrp3_s2_f | GAAGAAAGATTACCGTAAGAAGTACAG |
| nlrp3_s2_r | CGTGTGTAGCGTTTGTTGAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).