Submitted:
24 September 2024
Posted:
25 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. A refined Metabolic Network Model Was Reconstructed for E. coli JC8031
2.2. E. coli JC8031 Mutant Strains Were Designed in Silico and Constructed In Vitro Using CRISPR-Cas9
2.2.1. Constructed Mutants Presented an Enhanced Vesicle Production
2.3. Lipidomic Analysis Shows Knock-Out Strains Keep a Stable Composition
3. Discussion
4. Materials and Methods
4.1. Vesicle Recovery and Quantification
4.2. Metabolic Network Model
4.3. Model Refinement
4.4. Model Objective Function Definition
4.5. Strain Design
4.6. Genome Editing
4.7. Lipidomics
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jan, A.T. Outer Membrane Vesicles (OMVs) of Gram-negative Bacteria: A Perspective Update. Front. Microbiol. 2017, 8, 1053–1053. [Google Scholar] [CrossRef] [PubMed]
- Nagakubo, T.; Nomura, N.; Toyofuku, M. Cracking Open Bacterial Membrane Vesicles. Front. Microbiol. 2020. [Google Scholar] [CrossRef] [PubMed]
- Kulp, A.; Kuehn, M.J. Biological Functions and Biogenesis of Secreted Bacterial Outer Membrane Vesicles. Annu. Rev. Microbiol. 2010, 64, 163–184. [Google Scholar] [CrossRef] [PubMed]
- Jain, S.; Pillai, J. Bacterial membrane vesicles as novel nanosystems for drug delivery. Int. J. Nanomed. 2017, 12, 6329–6341. [Google Scholar] [CrossRef]
- Reimer, S.L.; Beniac, D.R.; Hiebert, S.L.; Booth, T.F.; Chong, P.M.; Westmacott, G.R.; Zhanel, G.G.; Bay, D.C. Comparative Analysis of Outer Membrane Vesicle Isolation Methods With an Escherichia coli tolA Mutant Reveals a Hypervesiculating Phenotype With Outer-Inner Membrane Vesicle Content. Front. Microbiol. 2021. [Google Scholar] [CrossRef] [PubMed]
- Kadurugamuwa, J.L.; Beveridge, T.J. Bacteriolytic effect of membrane vesicles from Pseudomonas aeruginosa on other bacteria including pathogens: conceptually new antibiotics. J. Bacteriol. 1996, 178, 2767–2774. [Google Scholar] [CrossRef]
- Vasilyeva, N.V.; Tsfasman, I.M.; Kudryakova, I.V.; Suzina, N.E.; Shishkova, N.A.; Kulaev, I.S.; Stepnaya, O.A. The role of membrane vesicles in secretion of lysobacter sp. bacteriolytic enzymes. Microb. Physiol. 2013, 23, 142–151. [Google Scholar] [CrossRef]
- Li, Z.; Clarke, A.J.; Beveridge, T.J. Gram-negative bacteria produce membrane vesicles which are capable of killing other bacteria. J. Bacteriol. 1998, 180, 5478–5483. [Google Scholar] [CrossRef]
- Furuyama, N.; Sircili, M.P. Outer membrane vesicles (OMVs) produced by gram-negative bacteria: Structure, functions, biogenesis, and vaccine application. BioMed Res. Int. 2021. [Google Scholar] [CrossRef]
- Avila-Calderón, E.D.; Ruiz-Palma, M.d.S.; Aguilera-Arreola, M.G.; Velázquez-Guadarrama, N.; Ruiz, E.A.; Gomez-Lunar, Z.; Witonsky, S.; Contreras-Rodríguez, A. Outer Membrane Vesicles of Gram-Negative Bacteria: An Outlook on Biogenesis. Front. Microbiol. 2021. [Google Scholar] [CrossRef]
- Kulp, A.J.; Sun, B.; Ai, T.; Manning, A.J.; Orench-Rivera, N.; Schmid, A.K.; Kuehn, M.J. Genome-wide assessment of outer membrane vesicle production in Escherichia coli. PLOS ONE 2015, 10, e0139200. [Google Scholar] [CrossRef] [PubMed]
- Schwechheimer, C.; Kuehn, M.J. Outer-membrane vesicles from Gram-negative bacteria: biogenesis and functions. Nat. Rev. Microbiol. 2015, 13, 605–619. [Google Scholar] [CrossRef] [PubMed]
- Li, R.; Liu, Q. Engineered Bacterial Outer Membrane Vesicles as Multifunctional Delivery Platforms. Front. Mater. 2020, 7. [Google Scholar] [CrossRef]
- Jasim, R.; Han, M.-L.; Zhu, Y.; Hu, X.; Hussein, M.H.; Lin, Y.-W.; Zhou, Q.; Da Dong, C.Y.; Li, J.; Velkov, T. Lipidomic Analysis of the Outer Membrane Vesicles from Paired Polymyxin-Susceptible and -Resistant Klebsiella pneumoniae Clinical Isolates. Int. J. Mol. Sci. 2018, 19, 2356. [Google Scholar] [CrossRef] [PubMed]
- Lee, E.Y.; Choi, D.S.; Kim, K.P.; Gho, Y.S. Proteomics in gram-negative bacterial outer membrane vesicles. Mass Spectrom. Rev. 2008, 27, 535–555. [Google Scholar] [CrossRef]
- Lee, J.; Kim, O.Y.; Gho, Y.S. Proteomic profiling of Gram-negative bacterial outer membrane vesicles: Current perspectives. Proteom. – Clin. Appl. 2016, 10, 897–909. [Google Scholar] [CrossRef]
- Tiwari, V.; Solanki, V.; Roy, R.; Biswas, D.; Tiwari, M. Significances of OMV and Extracellular Vesicle Proteomics. Journal of Data Mining in Genomics & Proteomics 2017, 8, 1–10. [Google Scholar] [CrossRef]
- Monk, J.M.; Lloyd, C.J.; Brunk, E.; Mih, N.; Sastry, A.; King, Z.; Takeuchi, R.; Nomura, W.; Zhang, Z.; Mori, H.; et al. iML1515, a knowledgebase that computes Escherichia coli traits. Nat. Biotechnol. 2017, 35, 904–908. [Google Scholar] [CrossRef]
- Bernadac, A.; Gavioli, M.; Lazzaroni, J.-C.; Raina, S.; Lloubès, R. Escherichia coli tol-pal mutants form outer membrane vesicles. J. Bacteriol. 1998, 180, 4872–4878. [Google Scholar] [CrossRef]
- Oursel, D.; Loutelier-Bourhis, C.; Orange, N.; Chevalier, S.; Norris, V.; Lange, C.M. Lipid composition of membranes of Escherichia coli by liquid chromatography/tandem mass spectrometry using negative electrospray ionization. Rapid Commun. Mass Spectrom. 2007, 21, 1721–1728. [Google Scholar] [CrossRef]
- Burgard, A.P.; Pharkya, P.; Maranas, C.D. OptKnock: A Bilevel Programming Framework for Identifying Gene Knockout Strategies for Microbial Strain Optimization. Biotechnol. Bioeng. 2003, 84, 647–657. [Google Scholar] [CrossRef] [PubMed]
- Ayed, Z.; Cuvillier, L.; Dobhal, G.; Goreham, R.V. Electroporation of outer membrane vesicles derived from Pseudomonas aeruginosa with gold nanoparticles. SN Appl. Sci. 2019, 1, 1600. [Google Scholar] [CrossRef]
- Roier, S.; Zingl, F.G.; Cakar, F.; Durakovic, S.; Kohl, P.; Eichmann, T.O.; Klug, L.; Gadermaier, B.; Weinzerl, K.; Prassl, R.; et al. A novel mechanism for the biogenesis of outer membrane vesicles in Gram-negative bacteria. Nat. Commun. 2016, 7, 10515. [Google Scholar] [CrossRef]
- Markowitz, V.M.; Chen, I.-M.A.; Palaniappan, K.; Chu, K.; Szeto, E.; Grechkin, Y.; Ratner, A.; Jacob, B.; Huang, J.; Williams, P.; et al. IMG: the integrated microbial genomes database and comparative analysis system. Nucleic Acids Res. 2011, 40, D115–D122. [Google Scholar] [CrossRef]
- Lugtenberg, E.; Peters, R. Distribution of lipids in cytoplasmic and outer membranes of Escherichia coli K12. Biochim. et Biophys. Acta (BBA) - Lipids Lipid Metab. 1976, 441, 38–47. [Google Scholar] [CrossRef]
- Grabau, C.; Chang, Y.Y.; E Cronan, J. Lipid binding by Escherichia coli pyruvate oxidase is disrupted by small alterations of the carboxyl-terminal region. J. Biol. Chem. 1989, 264, 12510–12519. [Google Scholar] [CrossRef] [PubMed]
- Brooke, J.S.; Valvano, M.A. Biosynthesis of inner core lipopolysaccharide in enteric bacteria identification and characterization of a conserved phosphoheptose isomerase. Journal of Biological Chemistry 1996, 271, 3608–3614. [Google Scholar] [CrossRef]
- Yew, W.S.; Gerlt, J.A. Utilization of L-ascorbate by Escherichia coli K-12: Assignments of functions to products of the yjf-sga and yia-sgb operons. J. Bacteriol. 2002, 184, 302–306. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-I.; Shin, I.; Cho, S.; Lee, J.; Rhee, S. Structural and Functional Insights into (S)-Ureidoglycolate Dehydrogenase, a Metabolic Branch Point Enzyme in Nitrogen Utilization. PLOS ONE 2012, 7, e52066. [Google Scholar] [CrossRef]
- Kalra, H.; Simpson, R.J.; Ji, H.; Aikawa, E.; Altevogt, P.; Askenase, P.; Bond, V.C.; Borràs, F.E.; Breakefield, X.; Budnik, V.; et al. Vesiclepedia: A Compendium for Extracellular Vesicles with Continuous Community Annotation. PLoS Biol. 2012, 10, e1001450. [Google Scholar] [CrossRef]
- Kulkarni, H.M.; Jagannadham, M.V. Biogenesis and multifaceted roles of outer membrane vesicles from Gram-negative bacteria. Microbiology 2014, 160, 2109–2121. [Google Scholar] [CrossRef] [PubMed]
- Jeucken, A.; Molenaar, M.R.; van de Lest, C.H.; Jansen, J.W.; Helms, J.B.; Brouwers, J.F. A Comprehensive Functional Characterization of Escherichia coli Lipid Genes. Cell Rep. 2019, 27, 1597–1606. [Google Scholar] [CrossRef] [PubMed]
- Geiger, O.; Sohlenkamp, C.; López-Lara, I. M. Formation of Bacterial Membrane Lipids: Pathways, Enzymes, Reactions. In Handbook of Hydrocarbon and Lipid Microbiology; 2010. [Google Scholar] [CrossRef]
- Sohlenkamp, C.; Geiger, O. Bacterial membrane lipids: diversity in structures and pathways. 2015. [Google Scholar] [CrossRef] [PubMed]
- Orth, J.D.; Thiele, I.; Palsson, B.Ø. What is flux balance analysis? 2010. [Google Scholar] [CrossRef]
- Maranas, C.D.; Zomorrodi, A.R. Optimization Methods in Metabolic Networks; 2016. [Google Scholar]
- Kumar, V.S.; Maranas, C.D. GrowMatch: An automated method for reconciling in silico/in vivo growth predictions. PLOS Comput. Biol. 2009, 5, e1000308. [Google Scholar] [CrossRef]
- Burgard, A.P.; Maranas, C.D. Optimization-based framework for inferring and testing hypothesized metabolic objective functions. Biotechnol. Bioeng. 2003, 82, 670–677. [Google Scholar] [CrossRef]
- Balhuizen, M.D.; Veldhuizen, E.J.A.; Haagsman, H.P. Outer Membrane Vesicle Induction and Isolation for Vaccine Development. Front. Microbiol. 2021, 12. [Google Scholar] [CrossRef]
- Feist, A.M.; O Palsson, B. The biomass objective function. Curr. Opin. Microbiol. 2010, 13, 344–349. [Google Scholar] [CrossRef]
- Inc. Benchling, “Benchling [Biology Software],” Retrieved from https://benchling.com.
- Jiang, Y.; Chen, B.; Duan, C.; Sun, B.; Yang, J.; Yang, S. Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Appl. Environ. Microbiol. 2015, 81, 2506–2514. [Google Scholar] [CrossRef]



| Gene | Keio Code | Description |
|---|---|---|
| poxB | B0871 | Peripheral membrane protein |
| sgbE | B3583 | L-ribulose-5-phosphate-4-epimerase |
| gmhA | B0222 | Phosphoheptose isomerase |
| allD | B0517 | Ureodiglycerol dehydrogenation |
| Target gene | N20 | Platform | Cassette size | Plasmid cut sites |
|---|---|---|---|---|
| gmhA | 5’ CGTGATCAAAGCGATCGCAG 3´ | pTarget (Jiang et al., 2015) | 1133 bp | XbaI, AvrII |
| sgbE | 5´ CATCGGCGCTCACAGCAAGG 3´ | pTarget (Jiang et al., 2015) | 1133 bp | XbaI, AvrII |
| allD | 5´ GCGACTACCGTACAGGCATG 3´ | pTarget (Jiang et al., 2015) | 1133 bp | XbaI, AvrII |
| poxB | 5´ GCGACTACCGTACAGGCATG 3´ | pTarget (Jiang et al., 2015) | 1133 bp | XbaI, AvrII |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).