Submitted:
09 August 2024
Posted:
12 August 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Preparation of Alginate-Based Solutions
2.3. Cell Culture and Maintenance
2.4. Oscillatory Rheological Measurements
2.5. Hydrogel Swelling Behavior
2.6. Mechanical Analysis
2.7. Bioprinting of Cell-Laden Hydrogels
2.8. Live/Dead Staining
2.9. Cell Viability Assay
2.10. Gene Expression
2.11. Statistical Analysis
3. Results and Discussion
3.1. Rheological Characterization
3.2. Mechanical Analysis
3.3. Hydrogel Swelling Behaviour
3.4. Bioprinting of Cell-Laden Hydrogels
3.5. Live/Dead Staining
3.6. Cell Viability Assay
3.7. Gene Expression
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
List of Abbreviations:
| 3D | three-dimensional |
| ALPL | alkaline phosphatase |
| CaCl2 | calcium chloride |
| Col | collagen |
| COL1A2 | collagen type 1 alpha 2 chain |
| DPBS | dulbecco’s phosphate-buffered saline |
| ECM | extracellular matrix |
| FBS | fetal bovine serum |
| G’ | storage modulus |
| G’’ | loss modulus |
| IBSP | integrin-binding sialoprotein |
| hBMSC | human bone marrow stem/stromal cell |
| HA | hydroxyapatite |
| LVR | linear viscoelastic region |
| MSC | mesenchymal stem/stromal cell |
| nHA | nano-hydroxyapatite |
| qPCR | quantitative real-time polymerase chain reaction |
| RUNX2 | runt-related transcription factor 2 |
| SPP1 | secreted phosphoprotein-1 |
| SE | standard deviation of the mean |
References
- Wu, A.-M.; Bisignano, C.; James, S.L.; Abady, G.G.; Abedi, A.; Abu-Gharbieh, E.; Alhassan, R.K.; Alipour, V.; Arabloo, J.; Asaad, M.; et al. Global, regional, and national burden of bone fractures in 204 countries and territories, 1990–2019: a systematic analysis from the Global Burden of Disease Study 2019. The Lancet Healthy Longevity 2021, 2, e580–e592. [Google Scholar] [CrossRef]
- Polinder, S.; Haagsma, J.; Panneman, M.; Scholten, A.; Brugmans, M.; Van Beeck, E. The economic burden of injury: Health care and productivity costs of injuries in the Netherlands. Accid Anal Prev 2016, 93, 92–100. [Google Scholar] [CrossRef] [PubMed]
- Borgström, F.; Karlsson, L.; Ortsäter, G.; Norton, N.; Halbout, P.; Cooper, C.; Lorentzon, M.; McCloskey, E.V.; Harvey, N.C.; Javaid, M.K.; et al. Fragility fractures in Europe: burden, management and opportunities. Arch Osteoporos 2020, 15, 59. [Google Scholar] [CrossRef] [PubMed]
- Caddeo, S.; Boffito, M.; Sartori, S. Tissue Engineering Approaches in the Design of Healthy and Pathological In Vitro Tissue Models. Front Bioeng Biotechnol 2017, 5, 40. [Google Scholar] [CrossRef] [PubMed]
- Owen, R.; Reilly, G.C. In vitro Models of Bone Remodelling and Associated Disorders. Frontiers in Bioengineering and Biotechnology 2018, 6. [Google Scholar] [CrossRef] [PubMed]
- Tripathi, S.; Mandal, S.S.; Bauri, S.; Maiti, P. 3D bioprinting and its innovative approach for biomedical applications. MedComm (2020) 2023, 4, e194. [Google Scholar] [CrossRef] [PubMed]
- Im, S.; Choe, G.; Seok, J.M.; Yeo, S.J.; Lee, J.H.; Kim, W.D.; Lee, J.Y.; Park, S.A. An osteogenic bioink composed of alginate, cellulose nanofibrils, and polydopamine nanoparticles for 3D bioprinting and bone tissue engineering. International Journal of Biological Macromolecules 2022, 205, 520–529. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Fernandez, T.; Sikorski, P.; Leach, J.K. Bio-instructive materials for musculoskeletal regeneration. Acta Biomater 2019, 96, 20–34. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez-Fernandez, T.; Tenorio, A.J.; Campbell, K.T.; Silva, E.A.; Leach, J.K. Alginate-Based Bioinks for 3D Bioprinting and Fabrication of Anatomically Accurate Bone Grafts. Tissue Eng Part A 2021, 27, 1168–1181. [Google Scholar] [CrossRef] [PubMed]
- Datta, S. Advantage of Alginate Bioinks in Biofabrication for Various Tissue Engineering Applications. International Journal of Polymer Science 2023, 2023, 6661452. [Google Scholar] [CrossRef]
- Mahmud, R.U.; Rahman, M.Z. 13.13 - Synthesis and characterization of nanocomposites for tissue engineering. In Comprehensive Materials Processing (Second Edition), Hashmi, S., Ed.; Elsevier: Oxford, 2024; pp. 241–269. [Google Scholar]
- Hariyadi, D.M.; Islam, N. Current Status of Alginate in Drug Delivery. Advances in Pharmacological and Pharmaceutical Sciences 2020, 2020, 8886095. [Google Scholar] [CrossRef] [PubMed]
- Shams, E.; Barzad, M.S.; Mohamadnia, S.; Tavakoli, O.; Mehrdadfar, A. A review on alginate-based bioinks, combination with other natural biomaterials and characteristics. Journal of Biomaterials Applications 2022, 37, 355–372. [Google Scholar] [CrossRef] [PubMed]
- Sudipto, D.; Ranjit, B.; Jonali, D. Importance of Alginate Bioink for 3D Bioprinting in Tissue Engineering and Regenerative Medicine. In Alginates, Leonel, P., Ed.; IntechOpen: Rijeka, 2019; p. Ch. 7. [Google Scholar]
- Ma, C.; Du, T.; Niu, X.; Fan, Y. Biomechanics and mechanobiology of the bone matrix. Bone Research 2022, 10, 59. [Google Scholar] [CrossRef] [PubMed]
- Bielajew, B.J.; Hu, J.C.; Athanasiou, K.A. Collagen: quantification, biomechanics and role of minor subtypes in cartilage. Nature Reviews Materials 2020, 5, 730–747. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Ruan, C.; Niu, X. Collagen-based bioinks for regenerative medicine: Fabrication, application and prospective. Medicine in Novel Technology and Devices 2023, 17, 100211. [Google Scholar] [CrossRef]
- Li, Y.; Liu, Y.; Li, R.; Bai, H.; Zhu, Z.; Zhu, L.; Zhu, C.; Che, Z.; Liu, H.; Wang, J.; et al. Collagen-based biomaterials for bone tissue engineering. Materials & Design 2021, 210, 110049. [Google Scholar] [CrossRef]
- Sousa, A.C.; Biscaia, S.; Alvites, R.; Branquinho, M.; Lopes, B.; Sousa, P.; Valente, J.; Franco, M.; Santos, J.D.; Mendonça, C.; et al. Assessment of 3D-Printed Polycaprolactone, Hydroxyapatite Nanoparticles and Diacrylate Poly(ethylene glycol) Scaffolds for Bone Regeneration. Pharmaceutics 2022, 14. [Google Scholar] [CrossRef] [PubMed]
- Sancilio, S.; Gallorini, M.; Di Nisio, C.; Marsich, E.; Di Pietro, R.; Schweikl, H.; Cataldi, A. Alginate/Hydroxyapatite-Based Nanocomposite Scaffolds for Bone Tissue Engineering Improve Dental Pulp Biomineralization and Differentiation. Stem Cells Int 2018, 2018, 9643721. [Google Scholar] [CrossRef] [PubMed]
- Quinlan, E.; López-Noriega, A.; Thompson, E.; Kelly, H.M.; Cryan, S.A.; O'Brien, F.J. Development of collagen-hydroxyapatite scaffolds incorporating PLGA and alginate microparticles for the controlled delivery of rhBMP-2 for bone tissue engineering. J Control Release 2015, 198, 71–79. [Google Scholar] [CrossRef] [PubMed]
- Soleymani, S.; Naghib, S.M. 3D and 4D printing hydroxyapatite-based scaffolds for bone tissue engineering and regeneration. Heliyon 2023, 9, e19363. [Google Scholar] [CrossRef] [PubMed]
- Melo, P.; Montalbano, G.; Fiorilli, S.; Vitale-Brovarone, C. 3D Printing in Alginic Acid Bath of In-Situ Crosslinked Collagen Composite Scaffolds. Materials (Basel) 2021, 14. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhou, Y.; Wang, C. Investigation of Collagen-Incorporated Sodium Alginate Bioprinting Hydrogel for Tissue Engineering. Journal of Composites Science 2022, 6, 227. [Google Scholar] [CrossRef]
- Hassani, A.; Khoshfetrat, A.B.; Rahbarghazi, R.; Sakai, S. Collagen and nano-hydroxyapatite interactions in alginate-based microcapsule provide an appropriate osteogenic microenvironment for modular bone tissue formation. Carbohydrate Polymers 2022, 277, 118807. [Google Scholar] [CrossRef] [PubMed]
- Campos, J.M.; Sousa, A.C.; Caseiro, A.R.; Pedrosa, S.S.; Pinto, P.O.; Branquinho, M.V.; Amorim, I.; Santos, J.D.; Pereira, T.; Mendonça, C.M.; et al. Dental pulp stem cells and Bonelike(®) for bone regeneration in ovine model. Regen Biomater 2019, 6, 49–59. [Google Scholar] [CrossRef] [PubMed]
- Merimi, M.; El Majzoub, R.; Lagneaux, L.; Agha, D.; Fatima, B.; Meuleman, N.; Fahmi, H.; Lewalle, P.; Mohammad, F.-K.; Najar, M. The Therapeutic Potential of Mesenchymal Stromal Cells for Regenerative Medicine: Current Knowledge and Future Understandings. Frontiers in Cell and Developmental Biology 2021, 9. [Google Scholar] [CrossRef] [PubMed]
- Aleynik, D.; Charykova, I.; Rubtsova, Y.; Linkova, D.; Farafontova, E.; Egorikhina, M. Specific Features of the Functional Activity of Human Adipose Stromal Cells in the Structure of a Partial Skin-Equivalent. International Journal of Molecular Sciences 2024, 25, 6290. [Google Scholar] [CrossRef] [PubMed]
- Sai, B.; Dai, Y.; Fan, S.; Wang, F.; Wang, L.; Li, Z.; Tang, J.; Wang, L.; Zhang, X.; Zheng, L.; et al. Cancer-educated mesenchymal stem cells promote the survival of cancer cells at primary and distant metastatic sites via the expansion of bone marrow-derived-PMN-MDSCs. Cell Death & Disease 2019, 10, 941. [Google Scholar] [CrossRef]
- Kemp, K.C.; Hows, J.; Donaldson, C. Bone marrow-derived mesenchymal stem cells. Leuk Lymphoma 2005, 46, 1531–1544. [Google Scholar] [CrossRef] [PubMed]
- Strassburg, S.; Richardson, S.M.; Freemont, A.J.; Hoyland, J.A. Co-culture induces mesenchymal stem cell differentiation and modulation of the degenerate human nucleus pulposus cell phenotype. Regen Med 2010, 5, 701–711. [Google Scholar] [CrossRef] [PubMed]
- Senior, J.J.; Cooke, M.E.; Grover, L.M.; Smith, A.M. Fabrication of Complex Hydrogel Structures Using Suspended Layer Additive Manufacturing (SLAM). Advanced Functional Materials 2019, 29, 1904845. [Google Scholar] [CrossRef]
- Moxon, S.R.; Cooke, M.E.; Cox, S.C.; Snow, M.; Jeys, L.; Jones, S.W.; Smith, A.M.; Grover, L.M. Suspended Manufacture of Biological Structures. Advanced Materials 2017, 29, 1605594. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Characterization of the human nucleus pulposus cell phenotype and evaluation of novel marker gene expression to define adult stem cell differentiation. Arthritis Rheum 2010, 62, 3695–3705. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Transcriptional profiling of bovine intervertebral disc cells: implications for identification of normal and degenerate human intervertebral disc cell phenotypes. Arthritis Res Ther 2010, 12, R22. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Datta, S. Advantage of alginate bioinks in biofabrication for various tissue engineering applications. International Journal of Polymer Science 2023, 2023. [Google Scholar] [CrossRef]
- Hassani, A.; Avci, Ç.B.; Kerdar, S.N.; Amini, H.; Amini, M.; Ahmadi, M.; Sakai, S.; Bagca, B.G.; Ozates, N.P.; Rahbarghazi, R.; et al. Interaction of alginate with nano-hydroxyapatite-collagen using strontium provides suitable osteogenic platform. Journal of Nanobiotechnology 2022, 20, 310. [Google Scholar] [CrossRef] [PubMed]
- Ojeda, E.; García-Barrientos, Á.; Martínez de Cestafe, N.; Alonso, J.M.; Pérez-González, R.; Sáez-Martínez, V. Nanometric Hydroxyapatite Particles as Active Ingredient for Bioinks: A Review. Macromol 2022, 2, 20–29. [Google Scholar] [CrossRef]
- Li, N.; Guo, R.; Zhang, Z.J. Bioink Formulations for Bone Tissue Regeneration. Front Bioeng Biotechnol 2021, 9, 630488. [Google Scholar] [CrossRef]
- Ferreira, M.J.S.L.M. Integrating 3D Bioprinting and Pluripotent Stem Cell Technologies for Articular Cartilage Tissue Engineering. The University of Manchester, 2022.
- Kostenko, A.; Connon, C.J.; Swioklo, S. Storable Cell-Laden Alginate Based Bioinks for 3D Biofabrication. Bioengineering (Basel) 2022, 10. [Google Scholar] [CrossRef]
- Paar, A. Amplitude sweeps. Available online: https://wiki.anton-paar.com/uk-en/amplitude-sweeps/#:~:text=The%20limit%20of%20the%20linear,with%20the%20lowest%20strain%20values. (accessed on 31-12-2024).
- Kocen, R.; Gasik, M.; Gantar, A.; Novak, S. Viscoelastic behaviour of hydrogel-based composites for tissue engineering under mechanical load. Biomedical Materials 2017, 12, 025004. [Google Scholar] [CrossRef]
- Shaabani, A.; Sedghi, R.; Motasadizadeh, H.; Dinarvand, R. Self-healable conductive polyurethane with the body temperature-responsive shape memory for bone tissue engineering. Chemical Engineering Journal 2021, 411, 128449. [Google Scholar] [CrossRef]
- Martinez, A.W.; Caves, J.M.; Ravi, S.; Li, W.; Chaikof, E.L. Effects of crosslinking on the mechanical properties, drug release and cytocompatibility of protein polymers. Acta Biomaterialia 2014, 10, 26–33. [Google Scholar] [CrossRef] [PubMed]
- Yi, B.; Xu, Q.; Liu, W. An overview of substrate stiffness guided cellular response and its applications in tissue regeneration. Bioact Mater 2022, 15, 82–102. [Google Scholar] [CrossRef] [PubMed]
- Naomi, R.; Ridzuan, P.M.; Bahari, H. Current Insights into Collagen Type I. Polymers (Basel) 2021, 13. [Google Scholar] [CrossRef] [PubMed]
- Iviglia, G.; Cassinelli, C.; Torre, E.; Baino, F.; Morra, M.; Vitale-Brovarone, C. Novel bioceramic-reinforced hydrogel for alveolar bone regeneration. Acta Biomaterialia 2016, 44, 97–109. [Google Scholar] [CrossRef] [PubMed]
- Fischer, L.; Nosratlo, M.; Hast, K.; Karakaya, E.; Ströhlein, N.; Esser, T.U.; Gerum, R.; Richter, S.; Engel, F.B.; Detsch, R.; et al. Calcium supplementation of bioinks reduces shear stress-induced cell damage during bioprinting. Biofabrication 2022, 14, 045005. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Su, X.; Xu, Y.; Kong, B.; Sun, W.; Mi, S. Bioprinting three-dimensional cell-laden tissue constructs with controllable degradation. Scientific Reports 2016, 6, 24474. [Google Scholar] [CrossRef] [PubMed]
- Du, L.; Qin, C.; Zhang, H.; Han, F.; Xue, J.; Wang, Y.; Wu, J.; Xiao, Y.; Huan, Z.; Wu, C. Multicellular Bioprinting of Biomimetic Inks for Tendon-to-Bone Regeneration. Advanced Science 2023, 10, 2301309. [Google Scholar] [CrossRef] [PubMed]
- Fideles, S.O.M.; Ortiz, A.C.; Assis, A.F.; Duarte, M.J.; Oliveira, F.S.; Passos, G.A.; Beloti, M.M.; Rosa, A.L. Effect of cell source and osteoblast differentiation on gene expression profiles of mesenchymal stem cells derived from bone marrow or adipose tissue. J Cell Biochem 2019, 120, 11842–11852. [Google Scholar] [CrossRef] [PubMed]
- Kriegel, A.; Schlosser, C.; Habeck, T.; Dahmen, C.; Götz, H.; Clauder, F.; Armbruster, F.P.; Baranowski, A.; Drees, P.; Rommens, P.M.; et al. Bone Sialoprotein Immobilized in Collagen Type I Enhances Bone Regeneration In vitro and In vivo. Int J Bioprint 2022, 8, 591. [Google Scholar] [CrossRef] [PubMed]
- Kriegel, A.; Langendorf, E.; Kottmann, V.; Kämmerer, P.W.; Armbruster, F.P.; Wiesmann-Imilowski, N.; Baranowski, A.; Gercek, E.; Drees, P.; Rommens, P.M.; et al. Bone Sialoprotein Immobilized in Collagen Type I Enhances Angiogenesis In Vitro and In Ovo. Polymers 2023, 15, 1007. [Google Scholar] [CrossRef] [PubMed]
- Singh, A.; Gill, G.; Kaur, H.; Amhmed, M.; Jakhu, H. Role of osteopontin in bone remodeling and orthodontic tooth movement: a review. Progress in Orthodontics 2018, 19. [Google Scholar] [CrossRef] [PubMed]
- Viguet-Carrin, S.; Garnero, P.; Delmas, P.D. The role of collagen in bone strength. Osteoporos Int 2006, 17, 319–336. [Google Scholar] [CrossRef] [PubMed]
- Gromolak, S.; Krawczenko, A.; Antończyk, A.; Buczak, K.; Kiełbowicz, Z.; Klimczak, A. Biological Characteristics and Osteogenic Differentiation of Ovine Bone Marrow Derived Mesenchymal Stem Cells Stimulated with FGF-2 and BMP-2. Int J Mol Sci 2020, 21. [Google Scholar] [CrossRef] [PubMed]








| Solutions | Sodium Alginate (w/v) | nHA (w/v) | Col (w/v) |
|---|---|---|---|
| Alginate | 2 | - | - |
| Alginate-nHA-Col | 2 | 0.5 | 0.5 |
| Primer | Accession Number | Forward Primer Sequence 5’-3’ | Reverse Primer Sequence 5’-3’ | Concentration (nM) |
|---|---|---|---|---|
| glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | NM_001256799 | CTCCTCTGACTTCAACAG | CGTTGTCATACCAGGAAA | 600 |
| runt-related transcription factor 2 (RUNX2) | NM_001024630 | CGCTGCAACAAGACC | CGCCATGACAGTAACC | 900 |
| alkaline phosphatase (ALPL) | NM_000478 | ACGTCTTCACATTTGGTG | GGTAGTTGTTGTGAGCATA | 450 |
| integrin-binding sialoprotein (IBSP) | NM_004967 | GACTGCTTTAATTTTGCTCAG | GTCACTACTGCCCTGAAC | 600 |
| secreted phosphoprotein-1 (SPP1) | NM_001040058 | CTGACATCCAGTACCCTG | CAGCTGACTCGTTTCATA | 600 |
| collagen type 1 alpha 2 chain (COL1A2) | NM_000089 | TGAAGCTGGTCCCCAAGGA | AATACCAGGAGCGCGCCGTTG | 300 |
| Parameter (MPa) | Alginate | Alginate-nHA-Col (w/v) | P Value |
|---|---|---|---|
| Young’s Modulus | 7.33 ± 1.21 | 6.80 ± 0.835 | 0.567 |
| Parameters | Values (unit) |
|---|---|
| Needle Diameter | 600 µm |
| Pressure | 0.02 MPa |
| Feed Rate | 10 mm/s |
| Filament Distance | 500 mm |
| Thickness | 500 mm |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).