Submitted:
02 August 2024
Posted:
02 August 2024
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Patients
2.2. Cell Culture
2.3. EVs Isolation from Plasma
2.4. EVs Isolation from Cell Culture Medium
2.5. EVs Characterization
2.5.1. NanoSight™ Particle Tracking Analysis
2.5.2. Size Distribution Determined by Dynamic Light Scattering (DLS)
2.5.3. Scanning Transmission Electron Microscopy (STEM)
2.6. Protein Extraction, Quantification, and Western Blot Analysis
2.7. miRNA Extraction, Retro Transcription, and Real-Time PCR (qPCR)
2.8. Bioinformatic Analysis
2.9. Statistical Analysis
3. Results
3.1. Characterization of EVs

3.2. Evaluation of microRNAs Levels in EVs

3.3. miRNA Targets Prediction for Thyroid Cancer-Associated Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Goodarzi, E.; Moslem, A.; Feizhadad, H.; Jarrahi, A.; Adineh, H.; Sohrabivafa, M.; Khazaei, Z. Epidemiology, Incidence and Mortality of Thyroid Cancer and Their Relationship with the Human Development Index in the World: An Ecology Study in 2018. Advances in Human Biology 2019, 9, 162. [Google Scholar] [CrossRef]
- Romano, C.; Martorana, F.; Pennisi, M.S.; Stella, S.; Massimino, M.; Tirrò, E.; Vitale, S.R.; Di Gregorio, S.; Puma, A.; Tomarchio, C.; et al. Opportunities and Challenges of Liquid Biopsy in Thyroid Cancer. Int J Mol Sci 2021, 22, 7707. [Google Scholar] [CrossRef] [PubMed]
- Alberti, G.; Sánchez-López, C.M.; Andres, A.; Santonocito, R.; Campanella, C.; Cappello, F.; Marcilla, A. Molecular Profile Study of Extracellular Vesicles for the Identification of Useful Small “Hit” in Cancer Diagnosis. Applied Sciences 2021, 11, 10787. [Google Scholar] [CrossRef]
- Caruso Bavisotto, C.; Marino Gammazza, A.; Rappa, F.; Fucarino, A.; Pitruzzella, A.; David, S.; Campanella, C. Exosomes: Can Doctors Still Ignore Their Existence? EuroMediterranean Biomedical Journal 2013, 8. [Google Scholar] [CrossRef]
- Ning, J.; Hou, X.; Hao, J.; Zhang, W.; Shi, Y.; Huang, Y.; Ruan, X.; Zheng, X.; Gao, M. METTL3 Inhibition Induced by M2 Macrophage-Derived Extracellular Vesicles Drives Anti-PD-1 Therapy Resistance via M6A-CD70-Mediated Immune Suppression in Thyroid Cancer. Cell Death Differ 2023, 30, 2265–2279. [Google Scholar] [CrossRef] [PubMed]
- Delcorte, O.; Craps, J.; Mahibullah, S.; Spourquet, C.; D’Auria, L.; Van Der Smissen, P.; Dessy, C.; Marbaix, E.; Mourad, M.; Pierreux, C.E. Two MiRNAs Enriched in Plasma Extracellular Vesicles Are Potential Biomarkers for Thyroid Cancer. Endocr Relat Cancer 2022, 29, 389–401. [Google Scholar] [CrossRef] [PubMed]
- Mardente, S.; Aventaggiato, M.; Splendiani, E.; Mari, E.; Zicari, A.; Catanzaro, G.; Po, A.; Coppola, L.; Tafani, M. Extra-Cellular Vesicles Derived from Thyroid Cancer Cells Promote the Epithelial to Mesenchymal Transition (EMT) and the Transfer of Malignant Phenotypes through Immune Mediated Mechanisms. Int J Mol Sci 2023, 24, 2754. [Google Scholar] [CrossRef] [PubMed]
- Macario, A.J.L.; Conway de Macario, E. Chaperonins in Cancer: Expression, Function, and Migration in Extracellular Vesicles. Semin Cancer Biol 2022, 86, 26–35. [Google Scholar] [CrossRef] [PubMed]
- Paladino, L.; Vitale, A.; Santonocito, R.; Pitruzzella, A.; Cipolla, C.; Graceffa, G.; Bucchieri, F.; Conway de Macario, E.; Macario, A.; Rappa, F. Molecular Chaperones and Thyroid Cancer. Int J Mol Sci 2021, 22, 4196. [Google Scholar] [CrossRef]
- Caruso Bavisotto, C.; Marino Gammazza, A.; Campanella, C.; Bucchieri, F.; Cappello, F. Extracellular Heat Shock Proteins in Cancer: From Early Diagnosis to New Therapeutic Approach. Semin Cancer Biol 2022, 86, 36–45. [Google Scholar] [CrossRef]
- Caruso Bavisotto, C.; Marino Gammazza, A.; Lo Cascio, F.; Mocciaro, E.; Vitale, A.M.; Vergilio, G.; Pace, A.; Cappello, F.; Campanella, C.; Palumbo Piccionello, A. Curcumin Affects HSP60 Folding Activity and Levels in Neuroblastoma Cells. Int J Mol Sci 2020, 21. [Google Scholar] [CrossRef] [PubMed]
- Graziano, F.; Iacopino, D.G.; Cammarata, G.; Scalia, G.; Campanella, C.; Giannone, A.G.; Porcasi, R.; Florena, A.M.; Conway de Macario, E.; Macario, A.J.L.; et al. The Triad Hsp60-MiRNAs-Extracellular Vesicles in Brain Tumors: Assessing Its Components for Understanding Tumorigenesis and Monitoring Patients. Applied Sciences 2021, 11, 2867. [Google Scholar] [CrossRef]
- D’Amico, G.; Santonocito, R.; Vitale, A.M.; Scalia, F.; Marino Gammazza, A.; Campanella, C.; Bucchieri, F.; Cappello, F.; Caruso Bavisotto, C. Air Pollution: Role of Extracellular Vesicles-Derived Non-Coding RNAs in Environmental Stress Response. Cells 2023, Vol. 12, Page 1498 2023, 12, 1498. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Yu, J.; Wang, J.; Li, H.; Che, J.; Cao, B. Isolation and Identification of MiRNAs in Exosomes Derived from Serum of Colon Cancer Patients. J Cancer 2017, 8, 1145–1152. [Google Scholar] [CrossRef] [PubMed]
- Budakoti, M.; Panwar, A.S.; Molpa, D.; Singh, R.K.; Büsselberg, D.; Mishra, A.P.; Coutinho, H.D.M.; Nigam, M. Micro-RNA: The Darkhorse of Cancer. Cell Signal 2021, 83, 109995. [Google Scholar] [CrossRef] [PubMed]
- Yu, S.; Liu, Y.; Wang, J.; Guo, Z.; Zhang, Q.; Yu, F.; Zhang, Y.; Huang, K.; Li, Y.; Song, E.; et al. Circulating MicroRNA Profiles as Potential Biomarkers for Diagnosis of Papillary Thyroid Carcinoma. J Clin Endocrinol Metab 2012, 97, 2084–2092. [Google Scholar] [CrossRef] [PubMed]
- Jankovic Miljus, J.; Guillén-Sacoto, M.A.; Makiadi-Alvarado, J.; Wert-Lamas, L.; Ramirez-Moya, J.; Robledo, M.; Santisteban, P.; Riesco-Eizaguirre, G. Circulating MicroRNA Profiles as Potential Biomarkers for Differentiated Thyroid Cancer Recurrence. J Clin Endocrinol Metab 2022, 107, 1280–1293. [Google Scholar] [CrossRef] [PubMed]
- Shan, Z.-X.; Lin, Q.-X.; Deng, C.-Y.; Zhu, J.-N.; Mai, L.-P.; Liu, J.-L.; Fu, Y.-H.; Liu, X.-Y.; Li, Y.-X.; Zhang, Y.-Y.; et al. MiR-1/MiR-206 Regulate Hsp60 Expression Contributing to Glucose-Mediated Apoptosis in Cardiomyocytes. FEBS Lett 2010, 584, 3592–3600. [Google Scholar] [CrossRef] [PubMed]
- Caruso Bavisotto, C.; Cipolla, C.; Graceffa, G.; Barone, R.; Bucchieri, F.; Bulone, D.; Cabibi, D.; Campanella, C.; Marino Gammazza, A.; Pitruzzella, A.; et al. Immunomorphological Pattern of Molecular Chaperones in Normal and Pathological Thyroid Tissues and Circulating Exosomes: Potential Use in Clinics. Int J Mol Sci 2019, 20, 4496. [Google Scholar] [CrossRef]
- Paladino, L.; Santonocito, R.; Graceffa, G.; Cipolla, C.; Pitruzzella, A.; Cabibi, D.; Cappello, F.; Conway de Macario, E.; Macario, A.J.L.; Bucchieri, F.; et al. Immunomorphological Patterns of Chaperone System Components in Rare Thyroid Tumors with Promise as Biomarkers for Differential Diagnosis and Providing Clues on Molecular Mechanisms of Carcinogenesis. Cancers (Basel) 2023, 15. [Google Scholar] [CrossRef]
- Park, W.S.; Chung, K.-W.; Young, M.S.; Kim, S.-K.; Lee, Y.J.; Lee, E.K. Differential Protein Expression of Lymph Node Metastases of Papillary Thyroid Carcinoma Harboring the BRAF Mutation. Anticancer Res 2013, 33, 4357–4364. [Google Scholar] [PubMed]
- Ye, T.; Zhong, L.; Ye, X.; Liu, J.; Li, L.; Yi, H. MiR-221-3p and MiR-222-3p Regulate the SOCS3/STAT3 Signaling Pathway to Downregulate the Expression of NIS and Reduce Radiosensitivity in Thyroid Cancer. Exp Ther Med 2021, 21, 652. [Google Scholar] [CrossRef]
- Cai, S.; Ma, J.; Wang, Y.; Cai, Y.; Xie, L.; Chen, X.; Yang, Y.; Peng, Q. Biomarker Value of MiR-221 and MiR-222 as Potential Substrates in the Differential Diagnosis of Papillary Thyroid Cancer Based on Data Synthesis and Bioinformatics Approach. Front Endocrinol (Lausanne) 2021, 12, 794490. [Google Scholar] [CrossRef] [PubMed]
- Dai, L.; Wang, Y.; Chen, L.; Zheng, J.; Li, J.; Wu, X. MiR-221, a Potential Prognostic Biomarker for Recurrence in Papillary Thyroid Cancer. World J Surg Oncol 2017, 15, 11. [Google Scholar] [CrossRef] [PubMed]
- Chang, W.; Chang, Q.; Lu, H.; Li, Y.; Chen, C. MiR-221-3p Facilitates Thyroid Cancer Cell Proliferation and Inhibit Apoptosis by Targeting FOXP2 Through Hedgehog Pathway. Mol Biotechnol 2022, 64, 919–927. [Google Scholar] [CrossRef] [PubMed]
- Santonocito, R.; Paladino, L.; Vitale, A.M.; D’Amico, G.; Zummo, F.P.; Pirrotta, P.; Raccosta, S.; Manno, M.; Accomando, S.; D’Arpa, F.; et al. Nanovesicular Mediation of the Gut–Brain Axis by Probiotics: Insights into Irritable Bowel Syndrome. Biology (Basel) 2024, 13, 296. [Google Scholar] [CrossRef] [PubMed]
- Paterna, A.; Rao, E.; Adamo, G.; Raccosta, S.; Picciotto, S.; Romancino, D.; Noto, R.; Touzet, N.; Bongiovanni, A.; Manno, M. Isolation of Extracellular Vesicles From Microalgae: A Renewable and Scalable Bioprocess. Front Bioeng Biotechnol 2022, 10. [Google Scholar] [CrossRef] [PubMed]
- Adamo, G.; Fierli, D.; Romancino, D.P.; Picciotto, S.; Barone, M.E.; Aranyos, A.; Božič, D.; Morsbach, S.; Raccosta, S.; Stanly, C.; et al. Nanoalgosomes: Introducing Extracellular Vesicles Produced by Microalgae. J Extracell Vesicles 2021, 10. [Google Scholar] [CrossRef] [PubMed]
- Grimson, A.; Farh, K.K.-H.; Johnston, W.K.; Garrett-Engele, P.; Lim, L.P.; Bartel, D.P. MicroRNA Targeting Specificity in Mammals: Determinants beyond Seed Pairing. Mol Cell 2007, 27, 91–105. [Google Scholar] [CrossRef]
- Pizzato, M.; Li, M.; Vignat, J.; Laversanne, M.; Singh, D.; La Vecchia, C.; Vaccarella, S. The Epidemiological Landscape of Thyroid Cancer Worldwide: GLOBOCAN Estimates for Incidence and Mortality Rates in 2020. Lancet Diabetes Endocrinol 2022, 10, 264–272. [Google Scholar] [CrossRef]
- Chang, W.; Chang, Q.; Lu, H.; Li, Y.; Chen, C. MiR-221-3p Facilitates Thyroid Cancer Cell Proliferation and Inhibit Apoptosis by Targeting FOXP2 Through Hedgehog Pathway. Mol Biotechnol 2022, 64, 919–927. [Google Scholar] [CrossRef]
- Wei, Z.L.; Gao, A. Bin; Wang, Q.; Lou, X.E.; Zhao, J.; Lu, Q.J. <p>MicroRNA-221 Promotes Papillary Thyroid Carcinoma Cells Migration and Invasion via Targeting RECK and Regulating Epithelial–Mesenchymal Transition</P>. Onco Targets Ther 2019, 12, 2323–2333. [Google Scholar] [CrossRef]
- Yan, F.-Q.; Wang, J.-Q.; Tsai, Y.-P.; Wu, K.-J. HSP60 Overexpression Increases the Protein Levels of the P110α Subunit of Phosphoinositide 3-Kinase and c-Myc. Clin Exp Pharmacol Physiol 2015, 42, 1092–1097. [Google Scholar] [CrossRef]
- Campanella, C.; D’Anneo, A.; Marino Gammazza, A.; Caruso Bavisotto, C.; Barone, R.; Emanuele, S.; Lo Cascio, F.; Mocciaro, E.; Fais, S.; Conway de Macario, E.; et al. The Histone Deacetylase Inhibitor SAHA Induces HSP60 Nitration and Its Extracellular Release by Exosomal Vesicles in Human Lung-Derived Carcinoma Cells. Oncotarget 2016, 7, 28849–28867. [Google Scholar] [CrossRef]
- Marino Gammazza, A.; Campanella, C.; Barone, R.; Caruso Bavisotto, C.; Gorska, M.; Wozniak, M.; Carini, F.; Cappello, F.; D’Anneo, A.; Lauricella, M.; et al. Doxorubicin Anti-Tumor Mechanisms Include Hsp60 Post-Translational Modifications Leading to the Hsp60/P53 Complex Dissociation and Instauration of Replicative Senescence. Cancer Lett 2017, 385. [Google Scholar] [CrossRef]
- Comoglio, P.M.; Trusolino, L.; Boccaccio, C. Known and Novel Roles of the MET Oncogene in Cancer: A Coherent Approach to Targeted Therapy. Nature Reviews Cancer 2018 18:6 2018, 18, 341–358. [Google Scholar] [CrossRef]
- Zang, W.J.; Hu, Y.L.; Qian, C.Y.; Feng, Y.; Liu, J.Z.; Yang, J.L.; Huang, H.; Zhu, Y.Z.; Xue, W.J. HDAC4 Promotes the Growth and Metastasis of Gastric Cancer via Autophagic Degradation of MEKK3. British Journal of Cancer 2022 127:2 2022, 127, 237–248. [Google Scholar] [CrossRef]
- Spartalis, E.; Athanasiadis, D.I.; Chrysikos, D.; Spartalis, M.; Boutzios, G.; Schizas, D.; Garmpis, N.; Damaskos, C.; Paschou, S.A.; Ioannidis, A.; et al. Histone Deacetylase Inhibitors and Anaplastic Thyroid Carcinoma. Anticancer Res 2019, 39, 1119–1127. [Google Scholar] [CrossRef]
- Zhao, Z.; Yang, F.; Liu, Y.; Fu, K.; Jing, S. MicroRNA-409-3p Suppresses Cell Proliferation and Cell Cycle Progression by Targeting Cyclin D2 in Papillary Thyroid Carcinoma. Oncol Lett 2018. [Google Scholar] [CrossRef] [PubMed]
- Fornari, F.; Gramantieri, L.; Ferracin, M.; Veronese, A.; Sabbioni, S.; Calin, G.A.; Grazi, G.L.; Giovannini, C.; Croce, C.M.; Bolondi, L.; et al. MiR-221 Controls CDKN1C/P57 and CDKN1B/P27 Expression in Human Hepatocellular Carcinoma. Oncogene 2008 27:43 2008, 27, 5651–5661. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Tan, H.; Huang, Y.; Guo, M.; Dong, Y.; Liu, C.; Zhao, H.; Liu, Z. TAGLN2 Promotes Papillary Thyroid Carcinoma Invasion via the Rap1/PI3K/AKT Axis. Endocr Relat Cancer 2023, 30. [Google Scholar] [CrossRef]
- Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int J Mol Sci 2020, 21, 1723. [Google Scholar] [CrossRef]
| Antigen | Type and source | Supplier | Dilution |
|---|---|---|---|
| CD81 | Mouse monoclonal | Santa Cruz Biotechnology, Dallas, TX. Sc-70803 | 1:1,000 |
| Alix | Mouse monoclonal | Santa Cruz Biotechnology, Dallas, TX. Sc-53538 | 1:500 |
| Calnexin | Mouse monoclonal | Santa Cruz Biotechnology, Dallas, TX. Sc-46669 | 1:1,000 |
| miRNA | Code | Sequence | Supplier | Dilution |
|---|---|---|---|---|
| has-miR-16-1-3p | YP00206012 | MIMAT0004489: 5'CCAGUAUUAACUGUGCUGCUGA | QIAGEN, Hilden, Germany | 1:10 |
| hsa-miR-1-3p | YP00204344 | MIMAT000416: 5'UGGAAUGUAAAGAAGUAUGUAU | QIAGEN, Hilden, Germany | 1:10 |
| hsa-miR-206 | YP00206073 | MIMAT0000462: 5'UGGAAUGUAAGGAAGUGUGUGG | QIAGEN, Hilden, Germany | 1:10 |
| has-miR-221-3p | YP00204532 | MIMAT0000278: 5'AGCUACAUUGUCUGCUGGGUUUC | QIAGEN, Hilden, Germany | 1:10 |
| microRNAs | Target gene | Gene name | Total context score1 |
|---|---|---|---|
| hsa-miR-1-3p | MET | met proto-oncogene | -0.27 |
| HDAC4 | histone deacetylase 4 | -0.29 | |
| CCND2 | cyclin D2 | -0.53 | |
| TAGLN2 | transgelin 2 | -0.85 | |
| CAAP1 | caspase activity and apoptosis inhibitor 1 | -0.48 | |
| HSPD1 | heat shock 60kDa protein 1 (chaperonin) | -0.35 | |
| hsa-miR-206 | NOTCH3 | notch receptor 3 | -0,23 |
| VEGFA | vascular endothelial growth factor A | -0.20 | |
| CCND2 | cyclin D2 | -0.53 | |
| CDON | cell adhesion associated, oncogene regulated | -0.51 | |
| MET | met proto-oncogene | -0.27 | |
| CXCR4 | chemokine (C-X-C motif) receptor 4 | -0.38 | |
| HSPD1 | heat shock 60kDa protein 1 (chaperonin) | -0.35 | |
| hsa-miR-221-3p | CDKN1B | cyclin-dependent kinase inhibitor 1B (p27, Kip1) | -1.05 |
| TIMP3 | TIMP metallopeptidase inhibitor 3 | -0.20 | |
| RECK | reversion-inducing-cysteine-rich protein with kazal motifs | -0.26 | |
| CCT5 | chaperonin containing TCP1, subunit 5 (epsilon) | -0.69 | |
| TP53BP2 | tumor protein p53 binding protein, 2 | -0.54 | |
| CDKN1C | cyclin-dependent kinase inhibitor 1C (p57, Kip2) | -0.35 | |
| BCL2L11 | BCL2-like 11 (apoptosis facilitator) | -0.42 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).