Submitted:
31 May 2024
Posted:
04 June 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
Production of Drone Brood Homogenate (DBH)
2.1. Animals
2.2. Hematology
2.3. Determination of Phagocytic Cell Functions by Flow Cytometry
2.4. Determination of Lymphocyte Subpopulations
2.5. Flush Protocol
2.6. Secretory IgA and MUC-2 Detection by ELISA
2.7. Histology and Morphometry of Ileum
2.8. Homogenization of Samples and Isolation of Total RNA from Tissue Samples
2.9. Quantitative Real-Time PCR Method
2.10. Statistical Analysis
3. Results
3.1. Growth Performance of Weaning Pigs
3.2. Peripheral Blood Values
3.3. Functions of Phagocytes
3.4. Phenotyping of Lymphocytes in Blood and Spleen
3.5. Morphometry of Intestine
3.6. Mucin and sIgA Quantitation
3.7. Relative Expression of Genes in qRT-PCR
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sawczuk,R. ; Karpinska,J.; Miltyk,W. What do we need to know about drone brood homogenate and what is known. J. Etnopharmacol. 2019, 245, 111581. [Google Scholar] [CrossRef] [PubMed]
- Lazaryan, D.S. Comparative amino acids analysis in bee brood. Pharm. Chem. J. 2002, 36, 680–682. [Google Scholar] [CrossRef]
- Narumi, S. Honeybee brood as a nutritional food. Honeybee Sci. 2004, 25, 119–124. [Google Scholar]
- Isidorov, V.; Bakier, S.; Stocki, M. GC-MS investigation of the chemical compostion of honeybee drone and queen larva homogenate. J. Apicultural Sci. 2016, 60, 111–120. [Google Scholar] [CrossRef]
- Shoinbayeva, K.; Omirzak, T.; Bigara, T.; Abubakirova, A.; Dauylbay, A. Biologically active preparation and reproductive function of stud rams. Asian J. Pharm. 2017, 11, 184–190. [Google Scholar]
- Finke, M.D. Nutrient composition of bee brood and its potential as human food. Ecol. Food Nutr. 2005, 44, 257–270. [Google Scholar] [CrossRef]
- Silici, S. Drone larvae homogenate (Apilarnil) as natural remedy: Scientific Review. J. Agric. Sci. 2023, 29, 947–959. [Google Scholar]
- Yemets, Y.M. Dietary effects of drone larves homogenate on the homeostatic constants and the reproductive capacity of large white gilts. Trans. Res. Vet. Sci. 2020, 3, 27–39. [Google Scholar] [CrossRef]
- Yucel, B.; Acikgoz, Z.; Bayraktar, H.; Seremet, C. The effects of Apilarnil (Drone Bee Larvae) administration on growth performance and secondary sex characteristics of male broilers. J. Anim. Vet. Adv. 2011, 10, 2263–2266. [Google Scholar]
- Bolatovna, K.S.; Rustenov, A.; Eleuqalieva, N.; Omirzak, T.; Akhanov, U.K. Improving reproductive qualities of pigs using drone brood homogenate. Biol. Med. 2015, 7, 2. [Google Scholar]
- Doganyigit, Z.; Okan, A.; Kaymak, E.; Pandır, D.; Silici, S. Investigation of protective effects of Apilarnil against lipopolysaccharide induced liver injury in rats via TLR 4/ HMGB-1/ NF-κB pathway. Biomed. Pharmacother. 2020, 125, 109967. [Google Scholar] [CrossRef] [PubMed]
- Seres, A.B.; Ducza, E.; Bathori, M.; Hunyadi, A.; Beni, Z.; Dekany, M. and Gaspar, R. Raw drone milk of honeybees elicits uterotrophic effect in rats: Evidence for estrogenic activity. J. Med. Food, 2013; 16, 404–409. [Google Scholar]
- Seres, AB.; Ducza, E.; Báthori, M.; Hunyadi, A.; Béni, Z.; Dékány, M.; Hajagos-Tóth, J.; Verli, J. ; Róbert, Gáspár, R. Androgenic effect of honeybee drone milk in castrated rats: Roles of methyl palmitate and methyl oleate. J. Etnopharmacol. 2014; 153, 446–453. [Google Scholar]
- Kistanova, E.; Zdoroveva, E.; Nevitov, M.; Nosov, A.; Vysokikh, M.; Sukhanova, I.; Vishnyakova, P.; Abadjieva, D.; Ankova, D.; Rashev, P.; Boryaev, G. Drone brood fed supplement impacts on the folliculogenesis in growing gilts. Vet. Arhiv. 2020, 90, 583–592. [Google Scholar] [CrossRef]
- Purchiarani, F.; Tortora, A.; Gabrielli, M.; Bertucci, F.; Gigante, G.; Ianiro, G.; Ojetti, V.; Scarpellini, E.; Gasbarrini, A. The role of intestinal microbiota and the immune system. Eur. Rev. Med. Pharmacol. Sci. 2013, 17, 323–333. [Google Scholar]
- Broun, H.; Esterházy, D. Intestinal immune compartmentalization: implications of tissue specific determinants in health and disease. Mucosal Immunol. 2021, 14, 1259–1270. [Google Scholar] [CrossRef] [PubMed]
- Varol, C.; Mildner, A.; Jung, S. Macrophages development and tissue specialization. Annu. Rev. Immunol. 2015, 33, 643–675. [Google Scholar] [CrossRef] [PubMed]
- Stunault, M.I.; Bories, G.; Guinamard, R.R.; Ivanov, S. Metabolism plays a key role during macrophages activation. Mediators Inflamm. 2018, 1–10. [Google Scholar] [CrossRef] [PubMed]
- O´Neill, L.A.; Pearce, E.J. Immunometabolism governs dendritic cell and macrophages functions. JEM. 2016, 213, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Murray, P.J. Macrophage polarization. Annu. Rev. Physiol. 2017, 79, 541–566. [Google Scholar] [CrossRef] [PubMed]
- Woof, J.M.; Ken, M.A. The function of immunoglobulin A in immunity. J. Pathol. 2006, 208, 270–282. [Google Scholar] [CrossRef]
- Peng, J.; Tang, Y.; Huang, Y. Gut health: the results of the microbial and mucosal immune interactions in pigs. Anim. Nutr. 2021, 7, 282–294. [Google Scholar] [CrossRef]
- Sutherland, D.B.; Fagarasan, S. IgA synthesis: A form of functional immune adaptation extending beyond gut. Curr. Opin. Immunol. 2012, 24, 261–268. [Google Scholar] [CrossRef] [PubMed]
- Pietrzak, B.; Tomela, K.; Olejnik-Schmidt, A.; Mackiewicz, A.; Schmidt, M. Secretory IgA in intestinal mucosal secretions as an adaptive barrier against microbial cells. Int. J. Mol. Sci. 2020, 21, 9254. [Google Scholar] [CrossRef] [PubMed]
- Hansson, G.C. Role of mucus layers in gut infection and inflammation. Curr. Opin. Microbiol. 2012, 15, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Johansson, M.E.; Hansson, G.C. Immunological aspects of intestinal mucus and mucins. Nat. Rev. Immunol. 2016, 16, 639–646. [Google Scholar] [CrossRef] [PubMed]
- Melhem, H.; Regan-Komito, D.; Niess, J.H. Mucins dynamics in physiological and pathological conditions. Int. J. Mol. Sci. 2021, 22, 13642. [Google Scholar] [CrossRef] [PubMed]
- Boyum, M.A. Separation of blood leukocytes, granulocytes and lymphocytes. Tissue Antigens, 1974; 4, 269–274. [Google Scholar]
- Karaffová, V.; Marcinková, E.; Bobíková, K.; Herich, R.; Revajová, V.; Stašová, D.; Kavuľová, A.; Levkutová, M.; Levkut, M.Jr.; Lauková, A.; Ševčíková, Z.; Levkut, M. Sr. TLR4 and TLR21 expression, MIF, IFN-β, MD-2, CD14 activation, and sIgA production in chickens administered with EFAL41 strain challenged with Campylobacter jejuni. Folia Microbiol. 2017, 62, 89–97. [Google Scholar]
- Dang, Y.; Lachance, C.; Wang, Y.; Gagnon, C.A.; Savard, C.; Segura, M.; Grenier, D.; Gottschalk, M. Transcriptional approach to study porcine tracheal epithelial cells individually or dually infected with swine influenza virus and Streptococcus suis. BMC Vet. Res. 2014, 10, 86. [Google Scholar] [CrossRef] [PubMed]
- Hou J, Wang L, Quan R, Fu Y, Zhang H, Feng WH. Induction of interleukin-10 is dependent on p38 mitogen-activated protein kinase pathway in macrophages infected with porcine reproductive and respiratory syndrome virus. Virol J. 2012, 9, 165. [Google Scholar] [CrossRef] [PubMed]
- Moue, M.; Tohno, M.; Shimazu, T.; Kido, T.; Aso, H.; Saito, T.; Kitazawa, H. Toll-like receptor 4 and cytokine expression involved in functional immune response in an originally established porcine intestinal epitheliocyte cell line. Biochem. Biophys. Acta 2008, 1780, 134–144. [Google Scholar] [CrossRef]
- Cinar, M.U.; Islam, M.A.; Uddin, M.J.; Tholen, E.; Tesfaye, D.; Looft, C.; Schellander, K. Evaluation of suitable reference genes for gene expression studies in porcine alveolar macrophages in response to LPS and LTA. BMC Res. Notes. 2012, 5, 107. [Google Scholar] [CrossRef]
- Bhattarai, S.; Nielsen, J.P. Association between hematological status at weaning and weight gain post-weaning in piglets. Livest. Sci. 2015, 182, 64–68. [Google Scholar] [CrossRef]
- Habis, A.; Hobson, W.L.; Greenberg, L. Cerebral sinovenous thrombosis in a toddler with iron deficiency anemia. Pediatr. Emerg. Care, 2010, 26, 848–851. [Google Scholar] [CrossRef]
- Özcan, A.; Cakmak, M.; Toraman, A.R.; Colak, A.; Yazgan, H.; Demirdoven, M.; Yoku, O.; Gurel, A. Evaluation of leucocyte and its subgroups in iron deficiency anemia. Int. J. Med. Med. Sci. 2011, 3, 135–138. [Google Scholar]
- Yčas, J.W.; Horrow, J.C.; Horne, B.D. Persistent increase in red cell size distribution width after acute diseases: A biomarker of hypoxemia? Clin. Chim. Acta 2015, 448, 107–117. [Google Scholar] [CrossRef] [PubMed]
- Lindholm-Perry, A.K.; Kuehn, L.A.; Wells, J.E.; Rempel, L.A.; Chitko-McKown, C.G.; Keel, B.N.; Oliver, W.T. Hematology parameters as potential indicators of feed efficiency in pigs. Transl. Anim. Sci. 2021, 5, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Yu, B.; Liu, Q.; Zhang, Y.; Zhu, M.; Shi, L.; Chen, H. Assessment of hematologic and biochemical parameters for healthy commercial pigs in China. Animals 2022, 12, 2464. [Google Scholar] [CrossRef] [PubMed]
- Arabpour, M.; Saghazadeh, A.; Rezaei, N. Anti-inflammatory and M2 macrophage polarization-promoting effect of mesenchymal stem cell-derived exosomes. Int. J. Pharmacol. 2021, 97, 107823. [Google Scholar] [CrossRef] [PubMed]
- Luo, Y.; Guo, Y.; Zhao, W.; Khalifa, S.A.; El- Seedi, H.R.; Su, X.; Wu, L. Total lipid extract of honeybee drone larvae are modulated by extraction temperature and display consistent anti-inflammatory potential. Foods 2023, 12, 4058. [Google Scholar] [CrossRef] [PubMed]
- Hamamci, M.; Doganyigit, Z.; Silici, S.; Okan, A.; Kaymak, F.; Yilmaz, S.; Tokpinar, A.; Inan, L.F. Apilarnil: a novel neuroprotective candidate. Acta Neurol. Taiwan 2020, 29, 33–45. [Google Scholar]
- Inandiklioglu, N.; Doganyigit, Z.; Okan, A.; Kaymak, E. & Silici, S. Nephroprotective effect of apilarnil in lipopolysaccharide-induced sepsis through TLR4/NF-κB signaling pathway. Life Sci. 2021, 284. [Google Scholar]
- Sidor, E.; Dzugan, M. Drone brood homogenate as natural remedy for treating health care problem: A scientific and practical approach. Molecules 2020, 25, 1–15. [Google Scholar] [CrossRef]
- Vlahopoulos, S.; Boldogh, I.; Casola, A.; Brasier, A.R. Nuclear factor-kappaB-dependent induction of interleukin-8 gene expression by tumor necrotic factor alpha: evidence for an antioxidant sensitive activating patway distinct from nuclear translocation. Blood 1999, 94, 1878–1889. [Google Scholar] [CrossRef] [PubMed]
- Odewusi, O.O.; Osadolor, H.B. Interleukin 10 and 18 levels in essential hypertensives. JASEM 2019, 23, 819–824. [Google Scholar] [CrossRef]
- Carlini, V.; Noonan, D.M.; Abdalalem, E.; Goletti, D.; Sansone, C.; Calabrone, L. and Albini, A. The multifaceted nature of IL-10: regulation, role in immunological homeostasis and its relevance to cancer, COVID-19 and post-COVID conditions. Front. Immunol. 2023, 14, 1161067. [Google Scholar] [CrossRef] [PubMed]
- Braun, R.O.; Python, S.; Summerfield, A. Porcine B cell subset responses to toll-like receptor ligands. Front. Immunol. 2017, 8, 1044. [Google Scholar] [CrossRef] [PubMed]
- Matsubara, T.; Nishii, N.; Takashima, S.; Takasu, M.; Imaeda, N.; Aiki-Oshimo, K.; Yamazoe, K.; Kakisaka, M.; Takeshima, S.N.; Aida, Y.; Kametani, Y.; Kulski, J.K.; Ando, A.; Kitagawa, H. Identification and characterization of two CD4 alleles in Microminipigs. BMC Vet. Res. 2016, 12, 222. [Google Scholar] [CrossRef] [PubMed]
- Grondin, J.A.; Kwon, Y.H.; Far, P.M.; Hag, S.; Khan, W.I. Mucins in intestinal mucosal defense and inflammation: Learning from clinical and experimental studies. Front. Immunol. 2020, 11, 2054. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.C.; Chou, W.M.; Widowati, D.A.; Lin, I.P.; Peng, C.C. 10-hydroxy-2-decenoic acid of royal jelly exhibits bactericide and anti-inflammatory activity in human colon cancer cells. BMC Complement Altern. Med. 2018, 18, 202. [Google Scholar] [CrossRef] [PubMed]
- Selecká, E.; Levkut, M. Jr.; Revajova, V.; Levkutova, M.; Karaffova, V.; Ševčíkova, Z.; Herich, R.; Levkut, M. Immunocompetent cells in blood and intestine after administration of Lacto-Immuno-Vital in drinking water of broiler chickens. Poult. Sci. 2021, 100, 101282. [Google Scholar] [CrossRef]
- Xiong, N.; Hu, S. Regulation of intestinal IgA responses. Cellular and Molecular Life Sci. 2015, 72, 2645–2655. [Google Scholar] [CrossRef]
- Fagarasan, S.; Kawamoto, S.; Kanagawa, O.; Suzuki, K. Adaptive immune regulation in the gut: T cell-dependent and T cell-independent IgA synthesis. Annu. Rev. Immunol. 2010, 28, 243–273. [Google Scholar] [CrossRef] [PubMed]
| Ingredient (% diet) | TEKRO starter |
| Wheat Barley Soybean meal extracted Fish meal Dried whey Soybean oil Monocalcium phosphate Limestone Salt Vitamin-mineral premix1 |
41.60 25.00 9.00 10.00 5.00 3.00 0.65 0.50 0.25 5.00 |
| N-substances | g.kg-1 | 195.0 |
| Fat | g.kg-1 | 55.0 |
| Dietary fibre | g.kg-1 | 35.0 |
| Lysine | g.kg-1 | 14.0 |
| Methionine | g.kg-1 | 5.3 |
| Calcium | g.kg-1 | 7.0 |
| Phosphorus | g.kg-1 | 5.5 |
| Sodium | g.kg-1 | 2.0 |
| Copper | mg.kg-1 | 130 |
| Zinc | mg.kg-1 | 2500 |
| Specificity | MoAbs | Isotype | Dilution | Cat. No. |
| CD45 | K252.1B4 | IgG1-FITC | 1/10 | MCA1222 |
| CD2 | MSA4 | IgG2a | 1/25 | WS0590S-100 |
| CD3 | PPT3 | IgG1-SPRD | 1/50 | 0102-13 |
| CD4 | 74-12-4 | IgG2b-RPE | 1/25 | 0104-09 |
| CD8 | 76-2-11 | IgG2a-FITC | 1/25 | 0102-02 |
| CD21 | BB6-11C9.6 | IgG1-R-PE | 1/25 | 0102-09 |
| IgM (µ chain) | K139.3EI | IgG2a | 1/25 | MCA633 |
| SWC3 | 74-22-15 | IgG1 | 1/25 | donation |
| Mouse IgG1 | 15HG | IgG1-RPE | 1/25 | 0102-09 |
| Mouse IgG2a | HOPC-1 | IgG2a-FITC | 1/25 | 0103-02 |
| Primer | Sequence 5‘–3’ | References |
| IL-8 Fw | TTATCGGAGGCCACAATAAG | [30] |
| IL-8 Rev | TGGAATAGTAGATGGAGCCA | |
| IL-10 Fw | CGGCGCTGTCATCAATTTCTG | [31] |
| IL-10 Rev | CCCCTCTCTTGGAGCTTGCTA | |
| IL-18 Fw | CTGCTGAACCGGAAGACAAT | [32] |
| IL-18 Rev | TCCGATTCCAGGTCTTCATC | |
| HPRT Fw | AACCTTGCTTTCCTTGGTCA | [33] |
| HPRT Rev | TCAAGGGCATAGCCTACCAC |
| Groups (n = 4) |
BW beginning of trial/kg | BW end of trial/kg |
Daily weight gain/g | % to Control body mass |
Feed conversion ratio |
% to Control feed conversion |
|---|---|---|---|---|---|---|
| C E1 E2 |
21.37 ± 1.60 21.39 ± 3.14 21.38 ± 2.70 |
36.77 ± 0.95 37.72 ± 4.88 38.14 ± 3.88 |
860 ± 0.11 910 ± 0.01 930 ± 0.08 |
100.0 106.0 108.8 |
1.66 ± 0.22 1.57 ± 0.17 1.56 ± 0.13 |
100.0 94.3 93.9 |
| WBC | Groups | P value | ||
| Control | E1 | E2 | ||
| Leukocytes | 15.98 ± 2.65 | 16.98 ± 2.29 | 18.95 ± 4.02 | 0.4165 |
| Lymphocytes | 9.04 ± 1.23 | 10.16 ± 0.74 | 11.35 ± 2.44 | 0.1917 |
| Neutrophils Seg. | 3.49 ± 1.48 | 2.48 ± 0.72 | 3.76 ± 1.57 | 0.3864 |
| Neutrophils Band | 2.53 ± 0.33 | 3.42 ± 1.26 | 2.60 ± 0.96 | 0.3637 |
| Eosinophils | 0.41 ± 0.15 | 0.35 ± 0.18 | 0.60 ± 0.08 | 0.7703 |
| Basophils | 0.16 ± 0.03 | 0.17 ± 0.02 | 0.29 ± 0.15 | 0.1043 |
| Monocytes | 0.36 ± 0.08 | 0.39 ± 0.14 | 0.49 ± 0.08 | 0.1956 |
| Parameters | Groups | P values | ||
|---|---|---|---|---|
| Control | E1 | E2 | ||
| RBC 1012.L-1 | 6.64 ± 0.36 | 6.96 ± 0.38 | 6.68 ± 0.80 | 0.6898 |
| HGB g/dl | 14.33 ± 0.50 | 14.03 ± 0.27 | 13.68 ± 0.66 | 0.2469 |
| HCT % | 0.44 ± 0.02 | 0.44 ± 0.01 | 0.43 ± 0.04 | 0.8086 |
| MCV fL | 66.80 ± 0.93 | 62.85 ± 2.13 | 64.45 ± 2.84 | 0.0749 |
| MCH pg | 21.53 ± 0.43 | 20.13 ± 1.24 | 20.60 ± 1.71 | 0.3168 |
| MCHC g/dl | 32.30 ± 0.35 | 29.90 ± 4.61 | 31.95 ± 1.55 | 0.4595 |
| RDW % | 15.48 ± 0.82a | 15.30 ± 0.22a | 16.53 ± 0.35b | 0.0196 |
| PLT 109.L-1 | 399.80 ± 48.36 | 419.80 ± 135.90 | 563.80 ± 106.20 | 0.1007 |
| MPV fL | 8.78 ± 0.50 | 9.12 ± 0.49 | 9.17 ± 0.34 | 0.4265 |
| PDW | 16.13 ± 0.25 | 16.13 ± 0.17 | 16.08 ± 0.05 | 0.9004 |
| PCT % | 0.35 ± 0.05 | 0.38 ± 0.11 | 0.52 ± 0.10 | 0.0703 |
| Parameters | Groups | P values | |||
|---|---|---|---|---|---|
| Control | E1 | E2 | |||
| Phagocytic activity (PA %) | 93.03 ± 1.52 | 93.53 ± 2.46 | 89.78 ± 7.78 | 0.5120 | |
| Index of PA | 24 344 ± 5 120 | 25 936 ± 9 178 | 25 803 ± 8 544 | 0.9550 | |
| Metabolic activity (MA %) | 67.78 ± 14.29a | 72.30 ± 4.54 | 88.30 ± 6.16b | 0.0300 | |
| Index of MA | 2 147 ± 841 | 1 730 ± 249 | 1 530 ± 401.3 | 0.3250 |
| Parameters | Groups | P values | ||
| Control | E1 | E2 | ||
| CD2 | 3.77 ± 1.14 | 3.68 ± 1.36 | 4.30 ± 1.32 | 0.77 |
| CD3 | 3.47 ± 1.13 | 4.69 ± 0.66 | 5.31 ± 1.21 | 0.09 |
| CD4 | 2.20 ± 0.45 | 2.60 ± 0.25 | 2.87 ± 0.48 | 0.11 |
| CD8 | 1.45 ± 0.35 | 1.24 ± 0.26 | 1.74 ± 0.76 | 0.41 |
| CD21 | 1.32 ± 0.33 | 1.93 ± 0.34 | 1.97 ± 0.72 | 0.18 |
| IgM | 1.53 ± 0.27 | 1.74 ± 0.32 | 1.68 ± 0.32 | 0.61 |
| SWC3 | 0.04 ± 0.02 | 0.04 ± 0.01 | 0.16 ± 0.15 | 0.12 |
| Parameters | Groups | P values | ||
| Control | E1 | E2 | ||
| CD2 | 28.48 ± 1.72 | 26.70 ± 10.91 | 23.13 ± 4.09 | 0.5701 |
| CD3 | 17.73 ± 2.39 | 17.20 ± 3.62 | 20.33 ± 5.04 | 0.5290 |
| CD4 | 23.63 ± 1.73b | 22.60 ± 2.65b | 29.60 ± 2.55a | 0.0097 |
| CD8 | 5.85 ± 0.95 | 5.38 ± 1.63 | 4.23 ± 0.15 | 0.2403 |
| CD21 | 15.43 ± 8.47b | 16.60 ± 6.11b | 35.87 ± 11.72a | 0.0286 |
| IgM | 16.48 ± 3.84 | 19.10 ± 5.81 | 20.38 ± 6.84 | 0.6235 |
| SWC3 | 2.03 ± 1.28 | 1.98 ± 0.83 | 3.15 ± 1.49 | 0.3545 |
| Parameters | Groups |
P values |
||
|---|---|---|---|---|
| Control | E1 | E2 | ||
| Height of villi (µm) | 810.17 ± 178.79c | 806.56 ± 197.16c | 893.52 ± 205.95a | 0.0020 |
| Cutting surface (mm2) | 0.304 ± 0.109c | 0.330±0.109 | 0.360 ±0.133a | 0.0043 |
| Density of goblet cells (µm2) | 6.22 ± 2.05 | 6.42 ± 1.78 | 6.26 ± 2.0 | 0.6819 |
| Parameters | Groups |
P values |
||
|---|---|---|---|---|
| Control | E1 | E2 | ||
| MUC-2 | 0.471 ± 0.015d | 0.468 ± 0.014d | 0.449 ± 0.015a | 0.0002 |
| sIgA | 0.0685 ± 0.0002a | 0.0679 ± 0.0002dda | 0.0672 ± 0.0001dd | 0.0002 |
| Groups | Control | E1 | E2 |
| IL-8 | 0.018 ± 0.0042e | 0.038 ± 0.0035e | 0.510 ± 0.1296a |
| IL-10 | 0.003 ± 0.0003b | 0.003 ± 0.0003b | 0.004 ± 0.0003a |
| IL-18 | 0.002 ± 0.0008d | 0.004 ± 0.0015c | 0.008 ± 0.0010a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).