Submitted:
27 December 2023
Posted:
27 December 2023
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Animals, materials and reagents
2.2. Structure characterization of PSP
2.2.1. Determination of content of total carbohydrate, protein, phenols, flavonoids, crude fat, ash and water
2.2.2. Molecular weight (Mw) analysis
2.2.3. Monosaccharide composition determination
2.2.4. Ultraviolet (UV) spectrum scan and Fourier transform infrared spectroscopy (FT-IR)
2.2.5. Scanning electron microscope (SEM) analysis
2.2.6. Atomic force microscope (AFM) analysis
2.3. Animal experiment
2.3.1. Evaluation of PSP after acute administration
2.3.2. CUMS procedure and PSP administration
2.4. Behavioral tests
2.4.1. Body weight
2.4.2. Novel tank test (NTT)
2.4.3. Light and dark tank test (LDT)
2.5. Sample collection
2.6. Nissl staining
2.7. Transmission electron microscope (TEM) observation
2.8. Immunohistochemistry
2.9. RNA Isolation and Real-Time Quantitative PCR
2.10. Enzyme-linked immunosorbent assay (ELISA)
2.11. Statistical analysis
3. Results
3.1. Structure characterization of PSP
3.1.1. Chemical, molecular weight (Mw) and monosaccharide composition of PSP
3.1.2. UV and FT-IR analysis
3.1.3. Conformational structure analysis of PSP
3.2. Effects of PSP on the body weight and depressive-like behaviors of CUMS-induced zebrafish
3.3. Effects of PSP on the HPI function of CUMS-induced zebrafish
3.4. Effects of PSP on the peripheral inflammation of CUMS-induced zebrafish
3.5. Effects of PSP on brain health in CUMS-induced zebrafish
3.6. Effects of PSP on microglia of CUMS-induced zebrafish
4. Discussion
5. Conclusion
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Bao, Y. F., Li, J. Y., Zheng, L. F., & Li, H. Y. 2015. Antioxidant activities of cold-nature Tibetan herbs are signifcantly greater than hot-nature ones and are associated with their levels of total phenolic components. Chin J Nat Medicines. 13 (8), 609-617. [CrossRef]
- Bensi, N., Bertuzzi, M., Armario, A., & Gauna, H. F. 1997. Chronic immobilization stress reduces sodium intake and renal excretion in rats. Physiol Behav. 62 (6), 1391-1396. [CrossRef]
- Bury, N. R., & Sturm, A. 2007. Evolution of the corticosteroid receptor signalling pathway in fish. Gen Comp Endocr. 153 (1-3), 47-56. [CrossRef]
- Cachat, J., Kyzar, E. J., Collins, C., Gaikwad, S., Green, J., Roth, A., El-Ounsi, M., Davis, A., Pham, M., Landsman, S., Stewart, A. M., & Kalueff, A. V. 2013. Unique and potent effects of acute ibogaine on zebrafish: the developing utility of novel aquatic models for hallucinogenic drug research. Behav Brain Res. 236 (1), 258-269. [CrossRef]
- Calcia, M. A., Bonsall, D. R., Bloomfield, P. S., Selvaraj, S., Barichello, T., & Howes, O. D. 2016. Stress and neuroinflammation: a systematic review of the effects of stress on microglia and the implications for mental illness. Psychopharmacology. 233 (9), 1637-1650. [CrossRef]
- Cao, L. H., Zhao, Y. Y., Bai, M., Geliebter, D., Geliebter, J., Tiwari, R., He, H. J., Wang, Z. Z., Jia, X. Y., Li, J., Li, X. M., & Miao, M. S. 2022. Mechanistic studies of Gypenosides in microglial state transition and its implications in depression-like behaviors: role of TLR4/MyD88/NF-kappaB signaling. Front Pharmacol. 13, 838261. [CrossRef]
- Chandrasekar, G., Arner, A., Kitambi, S. S., Dahlman-Wright, K., & Lendahl, M. A. 2011. Developmental toxicity of the environmental pollutant 4-nonylphenol in zebrafish. Neurotoxicol Teratol. 33 (6), 752-764. [CrossRef]
- Dang, R. Z., Wang, M. Y., Li, X. H., Wang, H. Y., Liu, L. X., Wu, Q. Y., Zhao, J. T., Ji, P., Zhong, L. M., Licinio, J., & Xie, P. 2022. Edaravone ameliorates depressive and anxiety-like behaviors via Sirt1/Nrf2/HO-1/Gpx4 pathway. J Neuroinflamm. 19 (1), 41. [CrossRef]
- D’Aquila, P. S., Brain, P., & Willner, P. 1994. Effects of chronic mild stress on performance in behavioural tests relevant to anxiety and depression. Physiol Behav. 56 (5), 861-867. [CrossRef]
- Deng, J. W., Zhou, F. W., Hou, W. T., Silver, Z., Wong, C., Y., Chang, O., Huang, E. & Zuo, K., Q. 2021. The prevalence of depression, anxiety, and sleep disturbances in COVID-19 patients: a meta-analysis. Ann NY Acad Sci. 1486 (1), 90-111. [CrossRef]
- Dion-Albert, L., Cadoret, A., Doney, E., Kaufmann, F. N., Dudek, K. A., Daigle, B., Parise, L. F., Cathomas, F., Samba, N., Hudson, N., Lebel, M., Signature, C., Campbell, M., Turecki, G., Mechawar, N., & Menard, C. 2022. Vascular and blood-brain barrier-related changes underlie stress responses and resilience in female mice and depression in human tissue. Nat Commun. 13 (1), 164. [CrossRef]
- DuBois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A., & Smith, F. 1956. Colorimetric method for determination of sugars and related substances. Anal Chem. 28 (3), 350-356. [CrossRef]
- Egan, R. J., Bergner, C. L., Hart, P. C., Cachat, J. M., Canavello, P. R., Elegante, M. F., Elkhayat, S. I., Bartels, B. K., Tien, A. K., Tien, D. H., Mohnot, S., Beeson, E., Glasgow, E., Amri, H., Zukowska, Z., & Kalueff, A. V. 2009. Understanding behavioral and physiological phenotypes of stress and anxiety in zebrafish. Behav Brain Res, 205 (1), 38-44. [CrossRef]
- Engelsma, M. Y., Huising, M. O., van Muiswinkel, W. B., Flik, G., Kwang, J., Savelkoul, H. F., & Verburg-van Kemenade, B. M. 2002. Neuroendocrine-immune interactions in fish: a role for interleukin-1. Vet Immunol Immunop, 87 (3-4), 467-479. [CrossRef]
- Fontana, B. D., Alnassar, N., & Parker, M. O. 2022. The zebrafish (Danio rerio) anxiety test battery: comparison of behavioral responses in the novel tank diving and light-dark tasks following exposure to anxiogenic and anxiolytic compounds. Psychopharmacology. 239 (1), 287-296. [CrossRef]
- Gao, C., Xu, J., Liu, Y., & Yang, Y. X. 2021. Nutrition policy and healthy China 2030 building. Eur J Clin Nutr. 75 (2), 238-246. [CrossRef]
- Guo, S. R., Wang, H., & Yin, Y. F. 2022. Microglia polarization from M1 to M2 in neurodegenerative diseases. Front Aging Neurosci. 14, 815347. [CrossRef]
- Guo, Y. X., Chen, X. F., Cong, P., Li, Z. X., Wu, Y. P., Zhang, J., Wang, J. T., Yao, W. B., Yang, W. J., & Chen, F. X. 2023. Advances in the mechanisms of polysaccharides in alleviating depression and its complications. Phytomedicine. 109, 154566. [CrossRef]
- Kandola, A., Ashdown-Franks, G., Hendrikse, J., Sabiston, C. M., & Stubbs, B. 2019. Physical activity and depression: towards understanding the antidepressant mechanisms of physical activity. Neurosci Biobehav R. 107, 525-539. [CrossRef]
- Liu, E. Y., Yang, C. L., Tsai, J. C., Cheng, H. Y., & Peng, W. H. 2023. Antidepressive mechanisms of rhynchophylline in mice with chronic unpredictable stress-induced depression. J Ethnopharmacol. 309, 116302. [CrossRef]
- Medina-Rodriguez, E. M., & Beurel, E. 2022. Blood brain barrier and inflammation in depression. Neurobiol Dis. 175, 105926. [CrossRef]
- Mojzesz, M., Widziolek, M., Adamek, M., Orzechowska, U., Podlasz, P., Prajsnar, T. K., Pooranachandran, N., Pecio, A., Michalik, A., Surachetpong, W., Chadzinska, M., & Rakus, K. 2021. Tilapia lake virus-induced neuroinflammation in zebrafish: microglia activation and sickness behavior. Front Immunol. 12, 760882. [CrossRef]
- Moret, C., Isaac, M., & Briley, M. 2009. Problems associated with long-term treatment with selective serotonin reuptake inhibitors. J Psychopharmacol. 23 (8), 967-974. [CrossRef]
- Nimmerjahn, A., Kirchhoff, F., & Helmchen, F. 2005. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science. 308 (5726), 1314-1318. [CrossRef]
- Ouyang, W., Rutz, S., Crellin, N. K., Valdez, P. A., & Hymowitz, S. G. 2011. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol. 29, 71-109. [CrossRef]
- Pei, J. J., Wang, Z. B., Ma, H. L., & Yan, J. K. 2015. Structural features and antitumor activity of a novel polysaccharide from alkaline extract of Phellinus linteus mycelia. Carbohyd Polym. 115, 472-477. [CrossRef]
- Porro, C., Cianciulli, A., & Panaro, M. A. 2020. The regulatory role of IL-10 in neurodegenerative diseases. Biomolecules. 10 (7). [CrossRef]
- Schaaf, M. J., Chatzopoulou, A., & Spaink, H. P. 2009. The zebrafish as a model system for glucocorticoid receptor research. Comp Biochem Phys A. 153 (1), 75-82. [CrossRef]
- Shen, F. M., Song, Z. J., Xie, P., Li, L., Wang, B., Peng, D. Y., & Zhu, G. Q. 2021. Polygonatum sibiricum polysaccharide prevents depression-like behaviors by reducing oxidative stress, inflammation, and cellular and synaptic damage. J Ethnopharmacol. 275, 114164. [CrossRef]
- Shen, F. M., Xie, P., Li, C. T., Bian, Z. J., Wang, X. C., Peng, D. Y., & Zhu, G. Q. 2022. Polysaccharides from Polygonatum cyrtonema Hua reduce depression-like behavior in mice by inhibiting oxidative stress-calpain-1-NLRP3 signaling axis. Oxid Med Cell Longev. 2022, 2566917. [CrossRef]
- Song, C., Liu, B. P., Zhang, Y. P., Peng, Z., Wang, J., Collier, A. D., Echevarria, D. J., Savelieva, K. V., Lawrence, R. F., Rex, C. S., Meshalkina, D. A., & Kalueff, A. V. 2018. Modeling consequences of prolonged strong unpredictable stress in zebrafish: Complex effects on behavior and physiology. Prog Neuro-Psychoph. 81, 384-394. [CrossRef]
- Togao, M., Nakayama, S. M. M., Ikenaka, Y., Mizukawa, H., Makino, Y., Kubota, A., Matsukawa, T., Yokoyama, K., Hirata, T., & Ishizuka, M. 2020. Bioimaging of Pb and STIM1 in mice liver, kidney and brain using laser ablation inductively coupled plasma mass spectrometry (LA-ICP-MS) and immunohistochemistry. Chemosphere. 238, 124581. [CrossRef]
- Vegh, R., Csoka, M., Stefanovits-Banyai, E., Juhasz, R., & Sipos, L. 2022. Biscuits enriched with monofloral bee pollens: Nutritional properties, techno-functional parameters, sensory profile, and consumer preference. Foods. 12 (1), 18. [CrossRef]
- Walker, J. M. 1994. The bicinchoninic acid (BCA) assay for protein quantitation. Methods in molecular biology. 32, 5-8. [CrossRef]
- Wang, H. X., He, Y., Sun, Z. L., Ren, S. Y., Liu, M. X., Wang, G., & Yang, J. 2022. Microglia in depression: an overview of microglia in the pathogenesis and treatment of depression. J Neuroinflamm. 19 (1), 132. [CrossRef]
- Wang, L., Li, M., Zhu, C. P., Qin, A. P., Wang, J. C., & Wei, X. N. 2022. The protective effect of Palmatine on depressive like behavior by modulating microglia polarization in LPS-induced mice. Neurochem Res. 47 (10), 3178-3191. [CrossRef]
- Wang, L. K., Lin, W., Zha, Q. J., Guo, H. H., Zhang, D. D., Yang, L. P., Li, L., Li, D. P., & Tang, R. 2020. Persistent exposure to environmental levels of microcystin-lr disturbs cortisol production via hypothalamic-pituitary-interrenal (HPI) axis and subsequently liver glucose metabolism in adult male zebrafish (Danio rerio). Toxins. 12 (5), 282. [CrossRef]
- Willner, P., Muscat, R., & Papp, M. 1992. Chronic mild stress-induced anhedonia: a realistic animal model of depression. Neurosci Biobehav R. 16 (4), 525-534. [CrossRef]
- Wu, S. T., Nguyen, L. T. M., Pan, H. R., Hassan, S., Dai, Y. M., Xu, J., & Wen, Z. L. 2020. Two phenotypically and functionally distinct microglial populations in adult zebrafish. Sci Adv. 6 (47), 1160. [CrossRef]
- Yu, B., Zhang, D., Wu, Y., Tao, W., Luorong, Q., Luo, J., Tan, L., Chen, H., & Cao, W. 2023. A new polysaccharide from Hawk tea: Structural characterization and immunomodulatory activity associated with regulating gut microbiota. Food Chem. 418, 135917. [CrossRef]
- Zeng, J., Ji, Y., Luan, F., Hu, J., Rui, Y., Liu, Y., Rao, Z., Liu, R., & Zeng, N. 2022. Xiaoyaosan ethyl acetate fraction alleviates depression-like behaviors in CUMS mice by promoting hippocampal neurogenesis via modulating the IGF-1Rbeta/PI3K/Akt signaling pathway. J Ethnopharmacol. 288, 115005. [CrossRef]
- Zhang, Y. Y., Sun, Y., Liu, Y. P., Liu, J. M., Sun, J., Bai, Y. J., Fan, B., Lu, C., & Wang, F. Z. 2023. Polygonum sibiricum polysaccharides alleviate chronic unpredictable mild stress-induced depressive-like behaviors by regulating the gut microbiota composition and SCFAs levels. J Funct Foods. 101. [CrossRef]
- Zhang, Y. Y., Sun, Y., Liu, Y. P., Liu, J. M., Sun, J., Liu, X. M., Fan, B., Lu, C., & Wang, F. Z. 2023. Polygonum sibiricum polysaccharides exert the antidepressant-like effects in chronic unpredictable mild stress-induced depressive mice by modulating microbiota-gut-brain axis. Phytother Res. 37 (8), 3408-3423. [CrossRef]
- Zhao, L. P., Zhang, B. P., Huang, S. B., Zhou, Z. L., Jia, X. B., Qiao, C. M., Wang, F., Sun, M. F., Shi, Y., Yao, L., Cui, C., & Shen, Y. Q. 2022. Insulin-like growth factor-1 enhances motoneuron survival and inhibits neuroinflammation after spinal cord transection in zebrafish. Cell Mol Neurobiol. 42 (5), 1373-1384. [CrossRef]
- Zhao, P., Li, X., Wang, Y., Yan, L., Guo, L., Huang, L., & Gao, W. 2020. Characterisation and saccharide mapping of polysaccharides from four common Polygonatum spp. Carbohyd Polym. 233, 115836. [CrossRef]
- Zhu, R., Zhang, X., Wang, Y., Zhang, L., Zhao, J., Chen, G., Fan, J., Jia, Y., Yan, F., & Ning, C. 2019. Characterization of polysaccharide fractions from fruit of Actinidia arguta and assessment of their antioxidant and antiglycated activities. Carbohyd Polym. 210, 73-84. [CrossRef]









| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| β-actin | ACCACGGCCGAAAGAGAAAT | ATGTCCACGTCGCACTTCAT |
| inos | CCTCCTCATGTACCTGAATCTCG | GCTCCTTGCTTTAGTATGTCGC |
| cd11b | TCCTCGGATTCCAGAAACAC | AGCAGCACAAGTCCTCCAAT |
| ym1 | GCAAGAGGAAGTCCACCTGAAGAC | ATACAGCAGCGGTCAGCATAAGC |
| arg-1 | TCCGTTCTCCAAAGGACAGC | GACTCGTCGTTGGGAAGGTT |
| cd206 | ACGCTTTCGATGGGTTTCCT | CCCTCCGTAGTACATTCCGC |
| egr-2 | TCTGGATGCGGAGAGGTCTATCAAG | AGTAGGATGGCGGAGGATATGAGATG |
| il-4 | TTGGTCCCCGTTTCTGAGTC | CCAGTCCCGGTATATGCTGC |
| il-10 | AAGCACTCCACAACCCCAAT | TGCATTTCACCATATCCCGCT |
| il-6 | AGACCGCTGCCTGTCTAAAA | TTTGATGTCGTTCACCAGGA |
| il-1β | TTCCCCAAGTGCTGCTTATT | AAGTTAAAACCGCTGTGGTCA |
| Items | PSP |
|---|---|
| Molar mass moments (g/mol) | |
| Mwa | 2.048 × 104 ± 0.03 |
| Mnb | 2.180 × 103 ± 0.05 |
| Mpc | 1.557 × 103 ± 0.04 |
| Mzd | 7.340 × 106 ± 0.08 |
| Polydispersity | |
| Mw/Mn | 9.394 ± 0.08 |
| Chemical composition (%, w/w) | |
| Total carbohydrate | 72.12 ± 0.90 |
| Protein | 14.40 ± 0.004 |
| Ash | 5.68 ± 0.51 |
| Water | 3.21 ± 0.08 |
| Flavonoids | 0.28 ± 0.06 |
| Phenols | 0.11 ± 0.003 |
| Crude fat | 0.03 ± 0.008 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).