Submitted:
13 December 2023
Posted:
14 December 2023
You are already at the latest version
Abstract
Keywords:Â
1. Introduction
2. Materials and Methods
2.1. Bacterial Isolates
2.2. Phenotypic Assay
2.3. Genotypic Assays
2.3.1. DNA Extraction
2.3.2. PCR Assays
3. Results
4. Discussion
5. Conclusion
Author Contributions
Funding
Declaration of Competing Interest
Transparency declarations
References
- M. G. Fakih , A. Bufalino, L. Sturm, R.-H. Huang, A. Ottenbacher, K. Saake, A. Winegar, R. Fogel e J. Cacchione, «Coronavirus disease 2019 (COVID-19) pandemic, central-line-associated bloodstream infection (CLABSI), and catheter-associated urinary tract infection (CAUTI): The urgent need to refocus on hardwiring prevention efforts,» Infection Control & Hospital Epidemiology, vol. 43, pp. 26-31, 2021.
- Jain e A. Agarwal, «Biofilm production, a marker of pathogenic potential of colonizing and commensal staphylococci,» Journal of Microbiological Methods, vol. 76, p. 88–92, 2008.
- P. Li, R. Yin, J. Cheng e J. Lin, «Bacterial Biofilm Formation on Biomaterials and Approaches to Its Treatment and Prevention,» International Journal of Molecular Sciences, vol. 24, 2023.
- C. Berne, C. K. Ellison , A. Ducret e Y. V. Brun , «Bacterial adhesion at the single-cell level,» Microbial biofilms, vol. 16, p. 616–627, 2018.
- V. Monzillo, S. Corona, P. Lanzarini, C. Dalla Valle e P. Marone, «Chlorhexidine-silver sulfadiazine-impregnated central venous catheters: in vitro antibacterial activity and impact on bacterial adhesion,» New Microbiologica, vol. 35, pp. 175-182, 2012.
- K. Becker, C. Heilmann e G. Peters, «Coagulase-Negative Staphylococci,» Clinical Microbiology Reviews, vol. 27, p. 870–926, 2014.
- G. D. I. de Silva, M. Kantzanou, A. Justice, R. C. Massey, A. R. Wilkinson, N. P. J. Day e S. J. Peacock, «The ica Operon and Biofilm Production in Coagulase-Negative Staphylococci Associated with Carriage and Disease in a Neonatal Intensive Care Unit,» Journal of Clinical Microbiology, p. 382–388, 2002.
- V. Cafiso, T. Bertuccio, M. Santagati, F. Campanile, G. Amicosante, M. Perilli, L. Selan, M. Artini, G. Nicoletti e S. Stefani, «Presence of the ica operon in clinical isolates of Staphylococcus epidermidis and its role in biofilm production,» Clinical Microbiology and Infection, p. 1081–1088, 2004.
- E. Paharik e A. R. Horswill, «The Staphylococcal Biofilm: Adhesins, regulation, and host response,» Microbiol spectr., 2016.
- K. Schilcher e A. R. Horswill, «Staphylococcal Biofilm Development: Structure, Regulation, and Treatment Strategies,» Microbiology and Molecular Biology Reviews, vol. 84, 2020.
- J. M. Ruiz-Giardin, I. Ochoa Chamorro, L. Velázquez RÃos, J. Jaqueti Aroca, M. I. GarcÃa Arata e J. V. SanMartÃn López, «Blood stream infections associated with central and peripheral venous catheters,» BMC Infectious Diseases, p. 19:841, 2019.
- G. D. Christensen, A. W. Simpson, A. L. Bisno e E. H. Beachey, «Adherence of Slime-Producing Strains of Staphylococcus epidermidis to Smooth Surfaces,» Infection and immunity, pp. 318-326, 1982.
- S. Manandhar, A. Singh, A. Varma, S. Pandey e N. Shrivastava, «Phenotypic and genotypic characterization of biofilm producing clinical coagulase negative staphylococci from Nepal and their antibiotic susceptibility pattern,» Annals of Clinical Microbiology and Antimicrobials, n. 41, p. 20, 2021.
- W. Ziebuhr, V. Krimmer, S. Rachid, I. Lößner, F. Götz e J. Hacker, «A novel mechanism of phase variation of virulence in Staphylococcus epidermidis: evidence for control of the polysaccharide intercellular adhesin synthesis by alternating insertion and excision of the insertion sequence element IS256,» Molecular microbiology, vol. 32, n. 2, pp. 345-356, 2002.
- C. R. Arciola, D. Campoccia, S. Ravaioli e L. Montanaro, «Polysaccharide intercellular adhesin in biofilm: structural and regulatory aspects,» Frontiers in cellular and infection microbiology, vol. 5, 2015.
- D. E. Moormeier, J. L. Bose, A. R. Horswill e K. W. Bayles, «Temporal and Stochastic Control of Staphylococcus aureus Biofilm Development,» mBio, vol. 5, 2014.
- R. Seng, T. Kitti, R. Thummeepak, P. Kongthai, U. Leungtongkam, S. Wannalerdsakun e S. Sitthisak, «Biofilm formation of methicillin-resistant coagulase negative staphylococci (MR-CoNS) isolated from community and hospital environments,» PLoS One, vol. 8, 2017.

| Gene target | Sequences | bp | Reference |
|---|---|---|---|
| icaA | F5’-TCTCTTGCAGGAGCAATCAA | 188 | [13] |
| R5’-TCAGGCACTAACATCCAGCA | |||
| icaB | F5’-ATGGCTTAAAGCACACGACGC | 526 | [14] |
| R5’-TATCGGCATCTGGTGTGACAG | |||
| icaC | F5’-ATCATCGTGACACACTTACTAACG | 934 | [8] |
| R5’-CTCTCTTAACATCATTCCGACGCC | |||
| icaD | F5’- ATGGTCAAGCCCAGACAGAG | 198 | [13] |
| R5’-CGTGTTTTCAACATTTAATGCAA |
| Phenotypic assay | Frequency | Range | Median (OD) |
95% CI for the median | Complete operon |
|---|---|---|---|---|---|
| Excellent producer | 49/89 (55.0%) | 0.240-3.50 | 0.68 | 0.46-1.21 | 33/49 (67.3%) |
| Weak producer | 20/89 (22.5%) | 0.130-0.230 | 0.17 | 0.14-0.20 | 4/20 (20.0%) |
| No producer | 20/89 (22.5%) | 0.06-0.120 | 0.09 | 0.1-0.1 | 5/20 (25.0%) |
| Samples | Phenotypic assay | Genotypic assay | |||||
|---|---|---|---|---|---|---|---|
| Strain | Specie | Average o.d. | Interpretation | icaA | icaD | icaB | icaC |
| 30678 | S.epidermidis | 3.50 | EP | + | + | + | + |
| 29789 | S.epidermidis | 3.50 | EP | + | + | + | + |
| 29216 | S.epidermidis | 3.43 | EP | + | + | + | + |
| 30667 | S.epidermidis | 3.33 | EP | + | + | + | + |
| 30203 | S.epidermidis | 3.30 | EP | + | + | + | + |
| 30383 | S.epidermidis | 2.37 | EP | + | + | + | + |
| 30428 | S.epidermidis | 2.25 | EP | + | + | + | + |
| 30371 | S.epidermidis | 2.24 | EP | + | + | + | + |
| 30344 | S.epidermidis | 1.94 | EP | + | + | + | + |
| 30710 | S.epidermidis | 1.78 | EP | + | + | + | + |
| 29533 | S.epidermidis | 1.74 | EP | + | + | + | + |
| 30385 | S.epidermidis | 1.65 | EP | + | + | + | + |
| 30575 | S.epidermidis | 1.61 | EP | + | + | + | + |
| 29383 | S.epidermidis | 1.59 | EP | + | + | + | + |
| 30164 | S.epidermidis | 1.59 | EP | - | - | - | - |
| 29317 | S.epidermidis | 1.52 | EP | + | + | + | + |
| 30677 | S.epidermidis | 1.37 | EP | + | + | + | + |
| 30077 | S.epidermidis | 1.23 | EP | + | + | + | + |
| 29981 | S.epidermidis | 1.14 | EP | + | + | + | + |
| 30455 | S.epidermidis | 1.02 | EP | - | - | - | - |
| 30697 | S.epidermidis | 0.86 | EP | + | + | + | + |
| 29581 | S.epidermidis | 0.82 | EP | + | + | + | + |
| 30338 | S.epidermidis | 0.77 | EP | + | + | + | + |
| 29412 | S.epidermidis | 0.73 | EP | + | + | + | + |
| 30306 | S.epidermidis | 0.68 | EP | + | + | + | + |
| 30740 | S.epidermidis | 0.67 | EP | + | + | + | + |
| 29525 | S.epidermidis | 0.66 | EP | - | - | - | - |
| 30440 | S.lugdunensis | 0.64 | EP | - | - | - | - |
| 30418 | S.epidermidis | 0.63 | EP | - | - | - | - |
| 30064 | S.epidermidis | 0.62 | EP | + | + | + | + |
| 29954 | S.hominis | 0.51 | EP | - | - | - | - |
| 29638 | S.hominis | 0.46 | EP | - | - | - | - |
| 29993 | S.epidermidis | 0.43 | EP | + | + | + | + |
| 29668 | S.epidermidis | 0.43 | EP | + | + | + | + |
| 29743 | S.hominis | 0.43 | EP | - | - | - | - |
| 30789 | S.epidermidis | 0.42 | EP | + | + | + | + |
| 30607 | S.capitis | 0.39 | EP | - | - | - | - |
| 30702 | S.hominis | 0.36 | EP | + | + | - | - |
| 30478 | S.epidermidis | 0.34 | EP | + | + | + | + |
| 29769 | S.hominis | 0.32 | EP | - | - | - | - |
| 29540 | S.epidermidis | 0.29 | EP | + | + | + | + |
| 30735 | S.haemolyticus | 0.28 | EP | - | - | - | - |
| 29798 | S.epidermidis | 0.27 | EP | - | - | - | - |
| 29726 | S.epidermidis | 0.27 | EP | + | + | + | + |
| 30706 | S.epidermidis | 0.26 | EP | + | + | + | + |
| 30530 | S.haemolyticus | 0.26 | EP | - | - | - | - |
| 30242 | S.hominis | 0.25 | EP | - | - | - | - |
| 30595 | S.epidermidis | 0.25 | EP | + | + | + | + |
| 30239 | S.epidermidis | 0.24 | EP | - | - | - | - |
| 29409 | S.epidermidis | 0.23 | WP | + | + | + | + |
| 30359 | S.capitis | 0.22 | WP | - | - | - | - |
| 29846 | S.epidermidis | 0.21 | WP | - | - | - | - |
| 29655 | S.hominis | 0.21 | WP | - | - | - | - |
| 29808 | S.epidermidis | 0.21 | WP | + | + | + | + |
| 28995 | S.haemolyticus | 0.20 | WP | - | - | - | - |
| 30244 | S.epidermidis | 0.20 | WP | - | - | - | - |
| 30296 | S.haemolyticus | 0.18 | WP | - | - | - | - |
| 30288 | S.hominis | 0.18 | WP | - | - | - | - |
| 30417 | S.hominis | 0.17 | WP | + | - | - | - |
| 29618 | S.epidermidis | 0.16 | WP | - | - | - | - |
| 29972 | S.epidermidis | 0.15 | WP | + | + | + | + |
| 30358 | S.haemolyticus | 0.15 | WP | - | - | - | - |
| 30291 | S.epidermidis | 0.15 | WP | - | - | - | - |
| 30319 | S.epidermidis | 0.14 | WP | - | - | - | - |
| 30013 | S.hominis | 0.14 | WP | - | - | - | - |
| 30773 | S.epidermidis | 0.13 | WP | + | + | + | + |
| 30387 | S.haemolyticus | 0.13 | WP | - | - | - | - |
| 29657 | S.epidermidis | 0.13 | WP | + | - | - | + |
| 29378 | S.hominis | 0.13 | WP | - | - | - | - |
| 30218 | S.epidermidis | 0.12 | NP | - | - | - | - |
| 29852 | S.haemolyticus | 0.12 | NP | - | - | - | - |
| 30539 | S.haemolyticus | 0.11 | NP | - | - | - | - |
| 29797 | S.haemolyticus | 0.11 | NP | - | - | - | - |
| 30814 | S.epidermidis | 0.10 | NP | - | - | - | - |
| 30807 | S.capitis | 0.10 | NP | - | - | - | - |
| 29834 | S.haemolyticus | 0.10 | NP | - | - | - | - |
| 29313 | S.epidermidis | 0.10 | NP | + | + | + | + |
| 29297 | S.epidermidis | 0.09 | NP | + | + | + | + |
| 29205 | S.epidermidis | 0.09 | NP | - | - | - | - |
| 29416 | S.epidermidis | 0.08 | NP | + | + | + | + |
| 29522 | S.epidermidis | 0.08 | NP | + | + | + | + |
| 29934 | S.capitis | 0.08 | NP | - | - | - | - |
| 29363 | S.epidermidis | 0.07 | NP | + | + | + | + |
| 29440 | S.hominis | 0.07 | NP | - | - | - | - |
| 29147 | S.hominis | 0.07 | NP | - | - | - | - |
| 29367 | S.haemolyticus | 0.07 | NP | - | - | - | - |
| 30761 | S.capitis | 0.06 | NP | - | - | - | - |
| 30318 | S.haemolyticus | 0.06 | NP | - | - | - | - |
| 29059 | S.haemolyticus | 0.06 | NP | - | - | - | - |
| EP, excellent producer; WP, weak producer; NP, No producer | |||||||
| Departments | Total | S. epidermidis | S. hominis | S. haemolyticus | S. capitis | S. lugdunensis |
|---|---|---|---|---|---|---|
| Anesthesia and reanimation | 49 | 36 | 9 | 4 | ||
| Surgeries | 5 | 4 | 1 | |||
| Pulmonology | 5 | 2 | 2 | 1 | ||
| Hematology | 10 | 3 | 5 | 2 | ||
| Oncologies | 9 | 6 | 1 | 2 | ||
| Cardiology | 8 | 5 | 1 | 1 | 1 | |
| Neonatal intensive care unit | 3 | 3 | ||||
| Total | 89 | 56 | 13 | 13 | 5 | 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
