Submitted:
20 July 2023
Posted:
25 July 2023
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Location of area study and ethical procedure
2.2. Plant collection, sampling and chemical analysis of Leucaena leucocephala leaves and prickly pear
2.3. Chemical composition of the forage sources and experimental treatments
2.4. -Nutritional composition of the experimental treatments
2.5. In vitro gas and methane production parameters
2.6. Dry matter intake and in vitro degradability parameters of dry matter and neutral detergent fiber.
2.7. True digestibility in vitro of dry matter, rumen fermentation patterns and synthesis of microbial biomass of the experimental treatments
2.8. Rumen microbial population
2.8.1. Extraction of rumen microbial DNA.
2.8.2. Quantitative analysis of real-time PCR populations
2.9. Protozoa and cellulolytic bacteria
2.10. Statistical analysis
3. Results
3.1. In vitro gas and methane production
3.2.-. Dry matter intake, in vitro degradability parameters of dry matter and neutral detergent fiber.
3.3. True digestibility in vitro of dry matter (TDIVDM)), ruminal fermentation patterns and microbial biomass synthesis.
3.4. Rumen microbial population after in vitro incubation with rumen fluid
4. Discussion
4.1. In vitro gas and methane production
4.2.- Dry matter intake, in vitro degradability parameters of dry matter and neutral detergent fiber.
4.3. True digestibility in vitro of dry matter, ruminal fermentation patterns and microbial biomass synthesis.
4.4. Microbial population after in vitro incubation with rumen fluid
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ku, V.J.C.; Castelan, O.O.A.; Galindo, M.F.A.; Arango, J.; Chirinda, N.; Jiménez, O.R.; Valencia, S.S.S.; Flores, S.E.J.; Montoya, F.M.D.; Molina, B.I.C.; Piñeiro, V.A.T.; Arceo, C.J.I.; Aguilar, P.C.F.; Aviles, R.L.; Solorio, S.F.J. Review: Strategies for enteric methane mitigation in cattle fed tropical forages. Animal. 2020, 14, 453–463. [Google Scholar]
- Jackson, R.B.; Saunois, M.; Bousquet, P.; Canadell, J.G.; Poulter, B.; Stavert, A.R.; Bergamaschi, P.; Niwa, Y.; Segers, A.; Tsuruta, A. Increasing anthropogenic methane emissions arise equally from agricultural and fossil fuel sources. Environ. Res. Lett. 2020, 15, 071002. [Google Scholar] [CrossRef]
- Hernández, M.J.H. El metano y la ganadería bovina en México: ¿Parte de la solución y no del problema? . Agro Productividad. 2018, 11, 2, 46–51. [Google Scholar]
- Ibrahim, T.A.; Hassen, A.; Apostolides, Z. The Antimethanogenic Potentials of Plant Extracts: Their Yields and Phytochemical Compositions as Affected by Extractive Solvents. Plants 2022, 11, 3296. [Google Scholar] [CrossRef]
- Aboagye, I.A.; Beauchemin, K.A. Potential of Molecular Weight and Structure of Tannins to Reduce Methane Emissions from Ruminants: A Review. Animals 2019, 9, 856. [Google Scholar] [CrossRef]
- Srinivas, B.; Krishnamoorthy, U. Panoply of microbial protein production in ruminants. A review Indian. J. Anim. Sci. 2013, 83, 4, 331–346. [Google Scholar]
- Montoya, F.M.D.; Botero, M.I.C.; Arango; J.; Muñoz, R.J.J.; Solorio, S.F.J.; Aguilar, P.C.F.; Ku, V.J.C. Effect of dried leaves of Leucaena Leucocephala on rumen fermentation, rumen microbial population, and enteric methane production in crossbred heifers. Animals, 2020, 10, 300.
- Pastorelli, G.; Serra, V.; Vannuccini, C.; Attard, E. Opuntia spp. as Alternative Fodder for Sustainable Livestock Production. Animals 2022, 12, 13. [Google Scholar] [CrossRef] [PubMed]
- AOAC International, 2019. Official Methods of Analysis of AOAC International. 21th Edition. Gaithersburg, MD.
- Sniffen, C.J.; O'Connor, J.D.; Van Soest, P.J.; Fox, D.G.; Russell, J.B. A net carbohydrate and protein system for evaluating cattle diets: II. Carbohydrate and protein availability. J. Anim. Sci. 1992, 70, 3562–3577. [Google Scholar] [CrossRef] [PubMed]
- Makkar, H.P.S. Quantification of tannins in tree foliage. IAEA. (FAO/IAEA Working Document). 2000. Vienna, Austria.
- McDonald, I. A revised model for the estimation of protein degradability in the rumen. J. Agric. Sci. 1981, 96, 251–252. [Google Scholar] [CrossRef]
- Edmunds, B.; Südekum, K.-H.; Spiekers, H.; Schuster, M.; Schwarz, F. Estimating utilisable crude protein at the duodenum, a precursor to metabolisable protein for ruminants, from forages using a modified gas test. Anim. Feed. Sci. Technol. 2012, 175, 106–113. [Google Scholar] [CrossRef]
- Haugen, H.L.; Ivan, S.K.; MacDonald, J.C.; Klopfenstein, T.J. Determination of undegradable intake protein digestibility of forages using the mobile nylon bag technique1. J. Anim. Sci. 2006, 84, 886–893. [Google Scholar] [CrossRef] [PubMed]
- Khazaal, K.; Dentinho, M.T.; Ribeiro, J.M.; Ørskov, E.R. Prediction of apparent digestibility and voluntary intake of hays fed to sheep: comparison between using fibre components, in vitro digestibility or characteristics of gas production or nylon bag degradation. Anim. Sci. 1995, 61, 527–538. [Google Scholar] [CrossRef]
- rskov, ER.; Mcdonald, I. The estimate of protein degradability in the rumen from incubation measurements weighed according to rate of passage. J. Agri. Sci. 1979, 92, 499–503. [Google Scholar] [CrossRef]
- Galyean, M.L. Laboratory Procedures in Animal Nutrition Research. Department of Animal and Food Sciences Texas Tech. 2010. University, Lubbock. USA.
- Blümmel, M.; Steingass, H.; Becker, K. The relationship between in vitro gas production, in vitro microbial biomass yield and 15N incorporation and its implications for the prediction of voluntary feed intake of roughages. Brit. J. Nut. 1997, 77, 911–92. [Google Scholar] [CrossRef] [PubMed]
- Menke, K.H.; Steingass, H. Estimation of the energetic feed value obtained from chemical analysis and in vitro gas production using rumen fluid. Anim. Res. Develop. 1988, 28, 7–55. [Google Scholar]
- Rojas, H.R.; Narváez, Z.J.; Zamudio, M.M.; Mena, M.M.E. A simple silica-based method for metagenomic DNA extraction from soil and sediments. Molecular Biotech. 2008, 40, 13–17. [Google Scholar] [CrossRef] [PubMed]
- Czerkawski, J. Reassessment of Efficiency of Synthesis of Microbial Matter in the Rumen. J. Dairy Sci. 1978, 61, 1261–1273. [Google Scholar] [CrossRef]
- Denman, S.E.; Tomkins, N.W.; McSweeney, C.S. Quantitation and diversity analysis of ruminal methanogenic populations in response to the antimethanogenic compound bromochloromethane. FEMS Microbiol. Ecol. 2007, 62, 313–322. [Google Scholar] [CrossRef]
- Marconell A., C. Estudio de la dinámica poblacional de arqueas metanogénicas en un reactor anaerobio de membranas mediante PCR cuantitativa y métodos microscópicos y su relación con los parámetros operacionales. 2017. Available online: http://hdl.handle.net/10251/90999.
- Angarita, E.; Molina, I.; Villegas, G.; Mayorga, O.; Chará, J.; Rosales, R.B. Quantitative analysis of rumen microbial populations by qPCR in heifers fed on Leucaena leucocephala in the Colombian Tropical Dry Forest. Acta Sci. Anim. Sci. 2015, 37, 135–142. [Google Scholar] [CrossRef]
- Ley De Coss, A.; Cobos, P.M.A.; Hernández. S.D.; Medina, G.E. Formulation of an anaerobic culture medium of rumen ciliate protozoa and in vitro evaluation in the defaunant capacity of the extract of plants. Revista Científica, FCV-LUZ. 2011, 21, 43 – 49.
- Londoño, Z.A.F.; Fernandez, C.J.; Molina, G.L.P.; Polanco, E.D.; Gutierrez, B.L.A. Quantification of anaerobic cellulolytic bacteria from the rumen of cattle: comparison of three techniques. Hechos Microb. 2011, 2, 51–59. [Google Scholar]
- SAS Institute, Inc. Statistical analysis system, Windows version 9.1.2. 2003. SAS Institute, Inc., Cary, NC.
- Kelln, B.; Penner, G.B.; Acharya, S.N.; McAllister, T.A.; Lardner, H.A. Impact of condensed tannin-containing legumes on ruminal fermentation, nutrition, and performance in ruminants: a review. Can. J. Anim. Sci. 2021, 101, 210–223. [Google Scholar] [CrossRef]
- Khazaal, K.; Boza, J.; Ørskov, E. Assessment of phenolics-related antinutritive effects in Mediterranean browse: a comparison between the use of the in vitro gas production technique with or without insoluble polyvinylpolypyrrolidone or nylon bag. Anim. Feed. Sci. Technol. 1994, 49, 133–149. [Google Scholar] [CrossRef]
- Torres, F.K.; Páez, L.J.; Pàmanes, C.G.; Herrera, T.E.; Carrete, C.F.; Murillo, O.M. Substitution of garlic leaves to alfalfa hay and its effect in vitro ruminal fermentation. Abanico Veterinario. 2020, 10, 1–11. [Google Scholar]
- Phesatcha, K.; Phesatcha, B.; Wanapat, M.; Cherdthong. A. Mitragyna speciosa korth leaves supplementation on feed utilization, rumen fermentation efficiency, microbial population, and methane production. Fermentation. 2022, 8, 2-11.
- Beauchemin, K.A.; McGinn, S.M.; Martinez, T.F.; McAllister, T.A. Use of condensed tannin extract from quebracho trees to reduce methane emissions from cattle1. J. Anim. Sci. 2007, 85, 1990–1996. [Google Scholar] [CrossRef]
- Soltan, Y.A.; Morsy, A.S.; Sallam, S.M.; Lucas, R.C.; Louvandini, H.; Kreuzer, M.; Abdalla, A.L. Contribution of condensed tannins and mimosine to the methane mitigation caused by feedingLeucaena leucocephala. Arch. Anim. Nutr. 2013, 67, 169–184. [Google Scholar] [CrossRef]
- Van Soest, P.J. Nutritional Ecology of the Ruminant; Cornell University Press: Ithaca, NY, USA, 1994; p. 476. [Google Scholar] [CrossRef]
- Tavendale, M.H.; Meagher, L.P.; Pacheco, D.; Walker, N.; Attwood, G.T.; Sivakumaran, S. Methane production from in vitro rumen incubations with Lotus pedunculatus and Medicago sativa, and effects of extractable condensed tannin fractions on methanogenesis. Anim. Feed. Sci. Technol. 2005, 123-124, 403–419. [Google Scholar] [CrossRef]
- Cai, S.; Li, J.; Ze, H.F.Z.; Zhang, K.;. Lou, Y,; Janto, B.; Boissy, R.; Ehrlich, G.E.; Dong, X. Cellulosilyticum ruminicola, a newly described rumen bacterium that possesses redundant fibrolytic-protein-encoding genes and degrades lignocellulose with multiple carbohydrate borne fibrolytic enzymes. Appl. Environ. Microb. 2010, 76, 3818–3824.
- Billman, E.D.; Leanne, S. D:, Roca, F.A.I.; Soder, K.J. Supplementation of oilseeds to an herbage diet high in condensed tannins affects methane production with minimal impact on ruminal fermentation in continuous culture. Fermentation. 2022, 8, 3, 109.
- Paengkoum, P.; Paengkoum, S. ORIGINAL ARTICLE: Effects of supplementing rice straw with Leucaena (Leucaena leucocephala) and Madras thorn (Pithecellobium dulce) foliages on digestibility, microbial N supply and nitrogen balance of growing goats. J. Anim. Physiol. Anim. Nutr. 2010, 94, e59–e65. [Google Scholar] [CrossRef]
- Shahriari, Z.; Mohammadabadi, T.; Vakili, S. T.; Chaji, M.; Sari, M. Effect of replacing alfalfa with subabul (Leucaena leucocephala) pod on digestibility, in vitro fermentation and in situ degradability in cow and buffalo. J. Anim. Prod Res. 2017, 6, 63–72. [Google Scholar]
- Mohammadabadi, T.; Chaji, M.; Direkvandi, E.; Alqaisi, O. Effect of replacing alfalfa hay with Leucaena leucocephala (L. Leucocephala) leaves on in vitro gas production, digestibility and in situ degradability in buffalo Acta Scientiarum. Anim. Sci. 2021, 43, 521-529.
- Minson, D.J. Forage in Nutrition Ruminant. 1990. Academic Press, INC. United Kingdom. Edition.
- Wang, J.; Zhang, Z.; Liu, H.; Xu, J.; Liu, T.; Wang, C.; Zheng, C. Evaluation of Gas Production, Fermentation Parameters, and Nutrient Degradability in Different Proportions of Sorghum Straw and Ammoniated Wheat Straw. Fermentation 2022, 8, 415. [Google Scholar] [CrossRef]
- Kakengi, A.M.; Shem, M.N.; Mtengeti, E.P.; Otsyina, R. Leucaena leucocephala leaf meal as supplement to diet of grazing dairy cattle in semiarid Western Tanzania. Agrofor. Syst. 2001, 52, 73–82. [Google Scholar] [CrossRef]
- Barros, R.M.A.; Solorio, S.F.J.; Sandoval, C,A.F.; Klieve, A.; Rojas, H.R.A.; Briceño, P.E.G.; Ku, V.J.C. Rumen function in vivo and in sheep fed Leucaena Leucocephala. Trop. Anim. Health. Prod. 2015, 47, 757–764.
- Spanghero, M.; Gruber, L.; Zanfi, C. Precision and accuracy of the NDF rumen degradability of hays measured by the Daisy fermenter. Ital. J. Anim. Sci. 2007, 6, 363–365. [Google Scholar] [CrossRef]
- E Griswold, K.; Hoover, W.H.; Miller, T.K.; Thayne, W.V. Effect of form of nitrogen on growth of ruminal microbes in continuous culture. J. Anim. Sci. 1996, 74, 483–491. [Google Scholar] [CrossRef] [PubMed]
- Ma, T.; Tu, Y.; Zhang, N.F.; Deng, K.D.; Diao, Q.Y. Effect of the Ratio of Non-fibrous Carbohydrates to Neutral Detergent Fiber and Protein Structure on Intake, Digestibility, Rumen Fermentation, and Nitrogen Metabolism in Lambs. Asian-Australasian J. Anim. Sci. 2015, 28, 1419–1426. [Google Scholar] [CrossRef] [PubMed]
- Rira, M.; Morgavi, D.P.; Archimède, H.; Marie-Magdeleine, C.; Popova, M.; Bousseboua, H.; Doreau, M. Potential of tannin-rich plants for modulating ruminal microbes and ruminal fermentation in sheep1. J. Anim. Sci. 2015, 93, 334–347. [Google Scholar] [CrossRef] [PubMed]
- Chandrasekharaiah, M.; Thulasi, A.; Suresh, K.P.; Sampath, K.T. Rumen degradable nitrogen requirements for optimum microbialprotein synthesis and nutrient utilization in sheep fed on finger milletstraw (Eleucine coracana) based diet. Anim. Feed Sci. Technol. 2011, 163, 130–135. [Google Scholar] [CrossRef]
- Kang, S.; Wanapat, M.; Pakdee, P.; Pilajun, R.; Cherdthong, A. Effects of energy level and Leucaena leucocephala leaf meal as a protein source on rumen fermentation efficiency and digestibility in swamp buffalo. Anim. Feed. Sci. Technol. 2012, 174, 131–139. [Google Scholar] [CrossRef]
- Wei, Z.; Xie, X.; Xue, M.; Valencak, T.G.; Liu, J.; Sun, H. The Effects of Non-Fiber Carbohydrate Content and Forage Type on Rumen Microbiome of Dairy Cows. Animals 2021, 11, 3519. [Google Scholar] [CrossRef]
- Wang, K.; Xiong, B.; Zhao, X. Could propionate formation be used to reduce enteric methane emission in ruminants? Sci. Total. Environ. 2023, 855, 158867. [Google Scholar] [CrossRef]
- Krueger, N.A.; Adesogan, A.T.; Staples, C.R.; Krueger, W.K.; Kim, S.C.; Littell, R.C.; Sollenberger, L.E. Effect of method of applying fibrolytic enzymes or ammonia to Bermudagrass hay on feed intake, digestion, and growth of beef steers1. J. Anim. Sci. 2008, 86, 882–889. [Google Scholar] [CrossRef]
- Araiza, P.K.; Murillo, OM.; Herrera, T.E.; Valencia,V.R.; Carrete, C.F.; Pámanes, C.G. Leucaena Leucocephala and Opuntia ficus-indica reduce the ruminal methane production in vitro. 2020, Abanico Veterinario, 10: 1-13.
- Albores, M.S.; Alayón, G.J.A.; Mirana, R.L.A.; Alarcón, Z.B.; Jiménez, F.G.; Ku, V.J.C.; Piñero, V.A.T. Effect of tree foliage supplementation of tropical grass diet on in vitro digestibility and fermentation, microbial biomass synthesis and enteric methane production in ruminants. Trop. Anim. Health. Prod. 2019, 51, 893–904. [Google Scholar] [CrossRef]
- Abdalla, A.L.; Louvandini, H.; Sallam, S.M.A.H.; Bueno, I.C.d.S.; Tsai, S.M.; Figueira, A.V.d.O. In vitro evaluation, in vivo quantification, and microbial diversity studies of nutritional strategies for reducing enteric methane production. Trop. Anim. Heal. Prod. 2012, 44, 953–964. [Google Scholar] [CrossRef] [PubMed]
- Blümmel, M.; Cone, J.W.; Van Gelder, A.H.; Nshalai, I.; Umunna, N.N.; Makkar, H.P.S.; Becker, K. Prediction of forage intake using in vitro gas production methods Comparison of multiphase fermentation kinetics measured in an automated gas test, and combined gas volume and substrate degradability measurements in a manual syringe system. Anim. Feed Sci. Technol. 2005, 123–124. [Google Scholar] [CrossRef]
- Makkar, H.P.S.; Sen, S.; Blümmel, M.; Becker, K. Effects of fractions containing saponins from Yucca schidigera, Quillaja saponaria and Acacia auriculoformis on rumen fermentation. J. Agric. Food. Chem. 1998, 46, 4324–4328. [Google Scholar] [CrossRef]
- Pilajun, R.; Wanapat, M. Microbial population in the rumen of swamp buffalo (Bubalus bubalis) as influenced by coconut oil and mangosteen peel supplementation. J. Anim. Physiol. Anim. Nutr. 2013, 97, 439–445. [Google Scholar] [CrossRef] [PubMed]
- Patra, A.K.; Saxena, J. Dietary phytochemicals as rumen modifiers: a review of the effects on microbial populations. Antonie van Leeuwenhoek 2009, 96, 363–375. [Google Scholar] [CrossRef] [PubMed]
- Anantasook, N.; Wanapat, M.; Cherdthong, A.; Gunun, P. Changes of Microbial Population in the Rumen of Dairy Steers as Influenced by Plant Containing Tannins and Saponins and Roughage to Concentrate Ratio. Asian-Australasian J. Anim. Sci. 2013, 11, 1583–1591. [Google Scholar] [CrossRef]
- Longo, C.; Abdalla, A.; Liebich, J.; Janzik, I.; Hummel, J.; Correa, P.; Südekum, K.-H.; Burauel, P. Evaluation of the effects of tropical tanniferous plants on rumen microbiota using qRT PCR and DGGE analysis. Czech J. Anim. Sci. 2013, 3, 106–116. [Google Scholar] [CrossRef]
- Piñeiro, V.A.T.; Canul, S.J.R.; Jimenez, F.G.O.; Alayon, G.J.A.; Chay, C.A.J.; Ayala, B.A.J.; Aguilar, P.C.F.; Ku, V.J.C. Effect of condensed tannins from Leucaena Leucocephala on rumen fermentation, methane production and population of rumen protozoa in heifers fed low-quality forage. Asian. Australas. J. Anim. Sci. 2018, 31, 11,1738–1746. [Google Scholar]
- Hespell, R.B.; Bryant, M.P. Efficiency of rumen microbial growth: influence of some theoretical and experimental factors of YATP. J. Anim. Sci. 1979, 49, 1640-1659.Author 1, A.; Author 2, B. Title of the chapter. In Book Title, 2nd ed.; Editor 1, A., Editor 2, B., Eds.; Publisher: Publisher Location, Country, 2007; Volume 3, pp. 154–196.
| Alfalfa hay | LLL | PP | |
| DM | 897 | 895 | 900 |
| OM | 871 | 915 | 720 |
| CP | 167 | 213 | 53 |
| NDF | 450 | 429 | 483 |
| Lignin | 81 | 53 | 48 |
| TDIVMD | 557 | 457 | 515 |
| NFC | 234 | 670 | 649 |
| TPC g tannic acid eq/kg DM | 96.5 | 119.6 | 101.2 |
| CT mg /g DM | 0.40 | 0.98 | 0.51 |
| Treatments | ||||
| Ingredient (g Kg-1 DM). | T1 | T2 | T3 | T4 |
| Alfalfa hay | 500 | 300 | 300 | 300 |
| Leucaena Leaves | 0 | 200 | 0 | 100 |
| Prickly pear | 0 | 0 | 200 | 100 |
| Corn milled | 350 | 370 | 280 | 340 |
| Cottonseed | 140 | 120 | 210 | 150 |
| Minerals | 10 | 10 | 10 | 10 |
| Chemical composition (g Kg-1 DM). | ||||
| DM | 883 | 879 | 803 | 898 |
| OM | 904 | 915 | 874 | 883 |
| CP | 140 | 146 | 142 | 148 |
| EE | 31 | 27 | 21 | 24 |
| NDF | 422 | 473 | 424 | 461 |
| Lignin | 41 | 58 | 45 | 55 |
| NFC | 292 | 218 | 273 | 245 |
| TPC g tannic acid eq/kg DM | 105.4 | 122.5 | 95.9 | 106.0 |
| CT mg /g DM | 0.305 | 3.34 | 0.360 | 1.96 |
| ME Mcal/ Kg-DM* | 3.8 | 3.1 | 3.4 | 3.0 |
| Primer sequences used to quantify total bacteria by qPCR. | |||
| Gene 16S rRNA |
Sequence (5´- 3´) | Extension | |
| Forward | 5´CGGCAACGAGCGCAACCC3´ | 130 bp | |
| Reverse | 5´CCATTGTAGCACGTGTGTAGCC3´ | ||
| Primer sequences used to quantify total methanogens by qPCR | |||
| Gene mcrA |
Sequence (5´- 3´) | Extension | |
| Forward | 5´TTCGGTGGATCDCARAGRGC3´ | 128 bp | |
| Reverse | 5´ GBARGTCGWAWCCGTAGAATCC 3´ | ||
| Treatments | SEM | p< value | |||||
| T1 | T2 | T3 | T4 | ||||
| a (ml 200 mg-1 DM) | 16.1a | 7.1d | 12.3b | 9.4c | 1.8 | 0.001 | |
| b (ml 200 mg-1 DM); | 102.0a | 85.7d | 98.3b | 92.1c | 2.3 | 0.01 | |
| PGP (ml 200 mg-1 DM) | 118.1a | 92.8c | 110.6b | 101.5b | 1.1 | 0.05 | |
| RGP (ml 200 mg-1 DM) | 110.1a | 85.8d | 101.6b | 93.5c | 1.7 | 0.003 | |
| Kd (ml-1h) | 8.0a | 4.0d | 6.0b | 4.5c | 0.01 | 0.01 | |
| L (h); | 2.5 | 3.3 | 3.1 | 3.1 | 0.33 | 0.120 | |
| CH4 (ml g-1 DM); | 13.7b | 10.2d | 15.8a | 12.8c | 3.3 | 0.01 | |
| CO2 (ml g-1 DM). | 74.8d | 96.2a | 87.5c | 91.1b | 1.2 | 0.001 | |
| CO2:CH4: ratio | 5.4b | 7.8a | 5.5b | 7.1a | 0.004 | 0.310 | |
| Treatments | SEM | p< value | |||||
| T1 | T2 | T3 | T4 | ||||
| DMI (g -1 LW0.75) | 73.0a | 41.2d | 62.2b | 48.6c | 2.9 | 0.001 | |
| aDM (mg g-1 DM) | 27.4a | 17.6d | 22.1b | 19.7c | 2.1 | 0.002 | |
| aNDF (mg g-1 NDF) | 12.4a | 10.5c | 11.7b | 11.1b | 1.8 | 0.04 | |
| bDM (mg g-1 DM) | 58.2a | 44.9d | 51.3b | 48.3c | 2.0 | 0.004 | |
| bNDF (mg g-1 NDF) | 71.1a | 62.6d | 69.8b | 66.3c | 2.3 | 0.01 | |
| PDDM (mg g-1 DM) | 85.6a | 62.5d | 73.4b | 68.0c | 1.5 | 0.005 | |
| PDNDF (mg g-1 NDF) | 83.1a | 73.1d | 81.5b | 77.4c | 2.1 | 0.05 | |
| EDDM (mg g-1 DM) | 65.8a | 39.0d | 54.6b | 47.0c | 1.1 | 0.004 | |
| EDNDF (mg g-1 NDF) | 45.3a | 28.3d | 42.0b | 40.5c | 1.6 | 0.05 | |
| KdDM (mg-1h) | 8.2a | 3.3d | 7.1b | 5.2c | 0.005 | 0.005 | |
| KdNDF (mg-1h) | 5.0a | 2.0c | 4.0b | 4.0b | 0.002 | 0.01 | |
| LDM (h) | 2.0 | 2.3 | 2.1 | 2.0 | 0.98 | 0.05 | |
| LNDF (h) | 3.3 | 4.0 | 3.5 | 3.8 | 1.7 | 0.18 | |
| KpDM (mg-1h) | 4.2a | 3.6b | 4.1a | 4.0a | 0.002 | 0.05 | |
| KpNDF (mg-1h) | 5.8a | 5.0b | 5.2b | 5.0b | 0.007 | 0.05 | |
| MRRTDM (h) | 23.8c | 27.7a | 24.3c | 25.0b | 1.1 | 0.002 | |
| MRRTNDF (h) | 12.5c | 18.2a | 14.6b | 14.9b | 2.5 | 0.03 | |
| Treatments | SEM | p< value | ||||
| T1 | T2 | T3 | T4 | |||
| TDIVMD48h, (mg -1 100 mg DM) | 667a | 622d | 654b | 642c | 2.4 | 0.030 |
| pH | 6.60a | 6.6a | 6.6a | 6.5a | 0.017 | 0.854 |
| N-NH3, (mg dL-1) | 12.6a | 8.7d | 11.5b | 9.3c | 0.152 | 0.024 |
| TVFA, (mM/L) | 10.6a | 6.5.d | 7.9b | 7.5b | 0.281 | 0.148 |
| Volatile fatty acids (molar%) | ||||||
| Acetate | 66.8d | 72.0a | 67.7c | 70.5b | 0.161 | 0.741 |
| Propionate | 24.4a | 18.2d | 22.3b | 19.3c | 0.674 | 0.033 |
| Butyrate | 5.7b | 9.1a | 9.3a | 9.0a | 0.247 | 0.027 |
| A:P ratio | 2.7 | 3.9 | 3.0 | 3.6 | 0.143 | 0.911 |
| MBS (mg -1 g DM) | 165.2a | 132.2d | 147.4b | 145.1c | 1.13 | 0.007 |
| PF (mg TDMD/mL gas) | 6.0a | 6.5b | 6.5b | 6.3b | 1.05 | 0.050 |
| Treatments | SEM | p< value | ||||
| T1 | T2 | T3 | T4 | |||
| Total bacteria1 | 14.7 | 14.9 | 15.2 | 15.4 | 0.030 | 0.22 |
| Celulolytic bacteria4 | 7.6 | 7.6 | 7.6 | 5.0 | 0.076 | 0.98 |
| Protozoa3 | 16.6a | 7.3d | 13.3b | 10.2c | 0.082 | 0.04 |
| Total methanogens2 | 14.2a | 13.5b | 13.8b | 13.6b | 0.066 | 0.05 |
| Methanogen:bacteria ratio | 0.95 | 0.91 | 0.91 | 0.88 | 0.091 | 0.88 |
| YATP (g microbial cells mol-1 ATP) | 24.0 | 22.2 | 24.0 | 23.3 | 0.61 | 0.930 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).