Submitted:
06 May 2023
Posted:
08 May 2023
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Extraction of Rosebuds
2.2. Analysis of Antioxidant Ingredients
2.3. Measurement of Antioxidative Activities
2.3.1. Analysis of ABTS-scavenging activity
2.3.2. Analysis of DPPH-scavenging activity
2.3.3. Analysis of correlation between antioxidant contents and antioxidative activities
2.4. Measurement of Anti-inflammatory Activities
2.4.1. Analysis of NO-inhibitory activity
2.4.2. Analysis of correlation between antioxidant contents and NO-inhibitory activities
2.5. Measurement of In Vitro Anti-inflammatory Activity of PVRE
2.5.1. MTT assay for cytotoxicity
2.5.2. qPCR analysis of mRNA expressions of iNOS and COX-II
2.5.3. Chemical analysis of nitric oxide and prostaglandin E2
2.6. Measurement of In Vivo Anti-inflammatory Activity of PVRE
2.6.1. Animals
2.6.2. Experimental design using an air-pouch inflammation model
2.6.3. Analysis of exudate volume and inflammation cells
2.6.4. ELISA analysis of inflammatory cytokines
2.6.5. Chemical analysis of NO and PGE2
2.6.6. Image-J analysis of dermal blood vessel area
2.6.7. Microscopic examination of tissue inflammation
2.7. Statistical Analysis
3. Results
3.1. Antioxidant Contents in 24 Rosebud Extracts
3.2. Antioxidant Activities of 24 Rosebud Extracts
3.3. Inhibitory Activities of 24 Rosebud Extracts on NO Production
3.4. Correlation between Polyphenols and Antioxidative Activities
3.5. Correlation between Polyphenols and NO-Inhibitory Activities
3.6. Cytotoxicity of PVRE in RAW 264.7 Cells
3.7. Effects on iNOS and COX-II Expressions in RAW 264.7 Cells
3.8. Effects on NO and PGE2 Production in RAW 264.7 Cells
3.9. Effect on Exudation in Air-Pouch Inflammation
3.10. Effect on Inflammatory Cells in Exudate
3.11. Effect on Inflammatory Cytokine Concentration in Exudate
3.12. Effects on NO and PGE2 Concentrations in Exudate
3.13. Effect on Blood Vessel Area
3.14. Microscopic Findings
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Rani, V.; Deep, G.; Singh, R.K.; Palle, K.; Yadav, U.C.S. Oxidative stress and metabolic disorders: pathogenesis and therapeutic strategies. Life Sci 2016, 148, 183–193. [Google Scholar] [CrossRef] [PubMed]
- Qi, J.; Dong, F. The relevant targets of anti-oxidative stress: a review. J Drug Target 2021, 29, 677–686. [Google Scholar] [CrossRef] [PubMed]
- Serhan, C.N.; Chiang, N.; Dalli, J. The resolution code of acute inflammation: novel pro-resolving lipid mediators in resolution. Semin Immunol 2015, 27, 200–215. [Google Scholar] [CrossRef] [PubMed]
- Nonato, F.R.; Santana, D.G.; De Melo, F.M.; Dos Santos, G.G.L.; Brustolim, D.; Camargo, E.A.; De Sousa, D.P.; Soares, M.B.P.; Villarreal, C.F. Anti-inflammatory properties of rose oxide. Int Immunopharmacol 2012, 14, 779–784. [Google Scholar] [CrossRef] [PubMed]
- Tang, T.T.; Wang, B.; Lv, L.L.; Liu, B.C. Extracellular vesicle-based nanotherapeutics: emerging frontiers in anti-inflammatory therapy. Theranostics 2020, 10, 8111–8129. [Google Scholar] [CrossRef] [PubMed]
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar] [CrossRef] [PubMed]
- Schmid-Schönbein, G.W. Analysis of inflammation. Annu Rev Biomed Eng 2006, 8, 93–151. [Google Scholar] [CrossRef]
- Tsai, D.S.; Huang, M.H.; Tsai, J.C.; Chang, Y.S.; Chiu, Y.J.; Lin, Y.C.; Wu, L.Y.; Peng, W.H. Analgesic and anti-inflammatory activities of Rosa taiwanensis Nakai in mice. J Med Food 2015, 18, 592–600. [Google Scholar] [CrossRef]
- Liu, Y.; Su, W.W.; Wang, S.; Li, P.B. Naringgin inhibits chemokine production in an LPS-induced RAW 264.7 macrophage cell line. Mol Med Rep 2012, 6, 1343–1350. [Google Scholar] [CrossRef]
- Cheng, L.; Ren, Y.; Lin, D.; Peng, S.; Zhong, B.; Ma, Z. The anti-inflammatory properties of Citrus wilsonii Tananka extract in LPS-induced RAW 264.7 and primary mouse bone marrow-derived dendritic cells. Molecules 2017, 22, 1213. [Google Scholar] [CrossRef]
- Shin, S.; Joo, S.S.; Jeon, J.H.; Park, D.; Jang, M.J.; Kim, T.O.; Kim, H.K.; Hwang, B.Y.; Kim, K.Y.; Kim, Y.B. Anti-inflammatory effects of a Houttuynia cordata supercritical extract. J Vet Sci 2010, 11, 273–275. [Google Scholar] [CrossRef] [PubMed]
- Thomson, A.W.; Horne, C.H.W. Toxicity of various carrageenans in the mouse. Br J Exp Pathol 1976, 57, 455–459. [Google Scholar] [PubMed]
- Edwards, J.C.W.; Sedgwick, A.D.; Willoughby, D.A. The formation of a structure with the features of synovial lining by subcutaneous injection of air: an in vivo tissue culture system. J Pathol 1981, 134, 147–156. [Google Scholar] [CrossRef] [PubMed]
- Vandooren, J.; Berghmans, N.; Dillen, C.; Van Aelst, I.; Ronsse, I.; Israel, L.L.; Rosenberger, I.; Kreuter, J.; Lellouche, J.P.; Michaeli, S.; et al. Intradermal air pouch leukocytosis as an in vivo test for nanoparticles. Int J Nanomedicine 2013, 8, 4745–4756. [Google Scholar] [CrossRef] [PubMed]
- Claxson, A.; Grootveld, M.; Chander, C.; Earl, J.; Haycock, P.; Mantle, M.; Williams, S.R.; Silwood, C.J.L.; Blake, D.R. Examination of the metabolic status of rat air pouch inflammatory exudate by high field proton NMR spectroscopy. Biochim Biophys Acta 1999, 1454, 57–70. [Google Scholar] [CrossRef] [PubMed]
- Nijampurkar, B.; Qureshi, F.; Jain, N.; Banerjee, T.; Kumar, A.; Parmar, H.S. Anti-inflammatory role of thyroid hormones on rat air pouch model of inflammation. Inflamm Allergy Drug Targets 2015, 14, 117–124. [Google Scholar] [CrossRef] [PubMed]
- Eteraf-Oskouei, T.; Shafiee-Khamneh, A.; Heshmati-Afshar, F.; Delazar, A. Anti-inflammatory and anti-angiogenesis effect of bee pollen methanolic extract using air pouch model of inflammation. Res Pharm Sci 2020, 15, 66–75. [Google Scholar] [CrossRef]
- Fehrenbacher, J.C.; McCarson, K.E. Models of inflammation: carrageenan air pouch. Curr Protoc 2021, 1, e183. [Google Scholar] [CrossRef]
- Dinarello, C.A. Anti-inflammatory agents: Present and future. Cell 2010, 140, 935–950. [Google Scholar] [CrossRef]
- Kim, J.M.; Park, S.H. Risk and benefit of steroid therapy. J Korean Soc Intern Med 2009, 77, 298–303. [Google Scholar]
- Eteraf-Oskouei, T.; Mirak, S.M.; Najafi, M. Anti-inflammatory and anti-angiogenesis effects of verapamil on rat air pouch inflammation model. Adv Pharm Bull 2017, 7, 585–591. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.Y.; Cho, S.S.; Li, Y.C.; Bae, C.S.; Park, K.M.; Park, D.H. Anti-inflammatory effect of Curcuma longa and Allium hookeri co-treatment via NF-κB and COX-2 pathways. Sci Rep 2020, 10, 5718. [Google Scholar] [CrossRef] [PubMed]
- Boukhatem, M.N.; Kameli, A.; Ferhat, M.A.; Saidi, F.; Mekarnia, M. Rose geranium essential oil as a source of new and safe anti-inflammatory drugs. Libyan J Med 2013, 8, 22520. [Google Scholar] [CrossRef] [PubMed]
- Ahn, J.H.; Park, Y.L.; Song, A.Y.; Kim, W.G.; Je, C.Y.; Jung, D.H.; Kim, Y.J.; Oh, J.; Cho, J.Y.; Kim, D.J.; Park, J.H. Water extract of Artemisia scoparia Waldst. & Kitam suppresses LPS-induced cytokine production and NLRP3 inflammasome activation in macrophages and alleviates carrageenan-induced acute inflammation in mice. J Ethnopharmacol 2021, 268, 113606. [Google Scholar] [PubMed]
- Mileva, M.; Ilieva, Y.; Jovtchev, G.; Gateva, S.; Zaharieva, M.M.; Georgieva, A.; Dimitrova, L.; Dobreva, A.; Angelova, T.; Vilhelmova-Ilieva, N.; Valcheva, V.; Najdenski, H. Rose flowers — a delicate perfume or a natural healer? Biomolecules 2021, 11, 127. [Google Scholar] [CrossRef]
- Gorji, A. Pharmacological treatment of headache using traditional Persian medicine. Trends Pharmacol Sci 2003, 24, 331–334. [Google Scholar] [CrossRef] [PubMed]
- Pellegrini, N.; Serafini, M.; Colombi, B.; Del Rio, D.; Salvatore, S.; Bianchi, M. Total antioxidant capacity of plant foods, beverages and oils consumed in Italy assessed by three different in vitro assays. J Nutr 2003, 133, 2812–2819. [Google Scholar] [CrossRef]
- Cho, E.K.; Son, J.Y.; Kang, K.O. Antioxidant activities of rose, camellia and cockscomb flower extracts. Food Serv Indust J 2015, 11, 21–33. [Google Scholar]
- Lee, H.R.; Lee, J.M.; Choi, N.S.; Lee, J.M. The anti-oxidative and anti-microbial ability of ethanol extracts from Rosa hybrida. Korean J Food Sci Technol 2003, 35, 373–378. [Google Scholar]
- Park, D.; Jeon, J.H.; Kwon, S.C.; Shin, S.; Jang, J.Y.; Jeong, J.H.; Lee, H.S.; Kim, D.I.; Kim, Y.B.; Joo, S.S. Antioxidative activities of white rose flower extract and pharmaceutical advantages of its hexane fraction via free radical scavenging effects. Biochem Cell Biol 2009, 87, 943–952. [Google Scholar] [CrossRef]
- Seong, H.; Heo, J.; Lee, K.H.; Lee, Y.B.; Kim, Y.B.; Han, N.S. Enhancing the antioxidant activities of wines by addition of white rose extract. J Microbiol Biotechnol 2017, 27, 1602–1608. [Google Scholar] [CrossRef] [PubMed]
- Konczak, I.; Zhang, W. Anthocyanins-more than nature’s colours. J Biomed Biotechnol 2004, 2004, 239–240. [Google Scholar] [CrossRef] [PubMed]
- Özkan, G.; Sağdiç, O.; Baydar, N.G.; Baydar, H. Anti-oxidant and anti-bacterial activities of Rosa damascena flower extracts. Food Sci Technol Int 2004, 10, 277–281. [Google Scholar] [CrossRef]
- Park, D.; Shin, K.; Choi, Y.; Guo, H.; Cha, Y.; Kim, S.H.; Han, N.S.; Joo, S.S.; Choi, J.K.; Lee, Y.B.; Choi, E.K.; Kim, J.B.; Kim, Y.B. Antimicrobial activities of ethanol and butanol fractions of white rose petal extract. Regul Toxicol Pharmacol 2016, 76, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Jeon, J.; Kwon, S.; Park, D.; Shin, S.; Jeong, J.; Park, S.; Hwang, S.; Kim, Y.; Joo, S. Anti-allergic effects of white rose petal extract and anti-atopic properties of its hexane fraction. Arch Pharm Res 2009, 32, 823–830. [Google Scholar] [CrossRef] [PubMed]
- Choi, E.K.; Guo, H.; Choi, J.K.; Jang, S.K.; Shin, K.; Cha, Y.S.; Choi, Y.; Seo, D.W.; Lee, Y.B.; Joo, S.S.; Kim, Y.B. Extraction conditions of white rose petals for the inhibition of enzymes related to skin aging. Lab Anim Res 2015, 31, 148–152. [Google Scholar] [CrossRef] [PubMed]
- Yang, G.; Park, D.; Lee, S.; Bae, D.; Yang, Y.; Kyun, J.; Kim, D.; Choi, E.; Hong, J.; Jeong, H.; Kim, H.; Jang, S.; Joo, S.; Kim, Y. Neuroprotective effects of a butanol fraction of Rosa hybrida petals in a middle cerebral artery occlusion model. Biomol Ther 2013, 21, 454–461. [Google Scholar] [CrossRef] [PubMed]
- Yon, J.; Kim, Y.B.; Park, D. The ethanol fraction of white rose petal extract abrogates excitotoxicity-induced neuronal damage in vivo and in vitro through inhibition of oxidative stress and proinflammation. Nutrients 2018, 10, 1375. [Google Scholar] [CrossRef]
- Dewanto, V.; Wu, X.; Liu, R.H. Processed sweet corn has higher antioxidant activity. J Agric Food Chem 2002, 50, 4959–4964. [Google Scholar] [CrossRef]
- Choi, Y.; Lee, S.M.; Chun, J.; Lee, H.B.; Lee, J. Influence of heat treatment on the antioxidant activities and polyphenolic compounds of Shiitake (Lentinus edodes) mushroom. Food Chem 2006, 99, 381–387. [Google Scholar] [CrossRef]
- Hwang, I.G.; Woo, K.S.; Kim, T.M.; Kim, D.J.; Yang, M.H.; Jeong, H.S. Change of physicochemical characteristics of Korean pear (Pyrus pyrifolia Nakai) juice with heat treatment conditions. Korean J Food Sci Technol 2006, 38, 342–334. [Google Scholar]
- Hwang, M.R.; Kim, H.E.; Park, D.K.; Heu, Y.C.; Lee, H.J.; Kang, N.J. Induction of oxidative stress and activation of antioxidant enzymes by infection of powdery mildew in cucurbita plants. J Agric Life Sci 2013, 47, 75–81. [Google Scholar]
- Que, F.; Mao, L.; Zhu, C.; Xie, G. Anti-oxidant properties of Chinese yellow wine, its concentrate and volatiles. LWT-Food Sci Technol 2006, 39, 111–117. [Google Scholar] [CrossRef]
- Teixeira de Moraes Costa, M.M.; Penha de Oliveira, S.H.; Gomes-Filho, J.E. Mechanism of calcium hydroxide-induced neutrophil migration into air-pouch cavity. Oral Surgery Oral Med Oral Pathol Oral Radiol Endod 2008, 105, 814–821. [Google Scholar] [CrossRef] [PubMed]
- Perez, D.A.; Vago, J.P.; Athayde, R.M.; Reis, A.C.; Teixeira, M.M.; Sousa, L.; PPinho, V. Switching off key signaling survival molecules to switch on the resolution of inflammation. Mediators Inflamm 2014, 2014, 829851. [Google Scholar] [CrossRef]
- Zhang JM, An JX, Cytokines, inflammation, and pain. Int Anesth Clin 2009, 45, 27–37.
- Winyard, P.G.; Willoughby, D. Inflammation protocols. In Methods in Molecular Biology; Humana Press: New Jersey, 2003; p. 225. [Google Scholar]
- Wojdasiewicz, P.; Poniatowski, Ł.A.; Szukiewicz, D. The role of inflammatory and anti-inflammatory cytokines in the pathogenesis of osteoarthritis. Mediators Inflamm 2014, 2014, 561459. [Google Scholar] [CrossRef]
- Cinelli, M.A.; Do, H.T.; Miley, G.P.; Silverman, R.B. Inducible nitric oxide synthase: regulation, structure, and inhibition. Med Res Rev 2020, 40, 158–189. [Google Scholar] [CrossRef]
- Tian, Y.; Zhou, S.Q.; Takeda, R.; Okazaki, K.; Sekita, M. Anti-inflammatory activities of amber extract in lipopolysaccharide-induced RAW 264.7 macrophages. Biomed and Pharmacother 2021, 141, 111854. [Google Scholar] [CrossRef]
- Agard, M.; Asakrah, S.; Morici, L.A. PGE2 suppression of innate immunity during mucosal bacterial infection. Front Cell Infect Microbiol 2013, 3, 45. [Google Scholar] [CrossRef]
- Shin, S.; Jeon, H.; Park, D.; Jang, J.Y.; Joo, S.; Hwang, Y.; Choe, S.Y.; Kim, Y.B. Anti-inflammatory effects of an ethanol extract of Angelica gigas in a carrageenan-air pouch inflammation model. Exp Anim 2009, 58, 431–436. [Google Scholar] [CrossRef] [PubMed]
- Goppelt-Struebe, M.; Wolter, D.; Resch, K. Glucocorticoids inhibit prostaglandin synthesis not only at the level of phospholipase A2 but also at the level of cyclo-oxygenase/PGE isomerase. Br J Pharmacol 1989, 98, 1287–1295. [Google Scholar] [CrossRef] [PubMed]







| Genes | Sequence 5’-3’ | Temperature |
|---|---|---|
| iNOS | Forward: CAGGATCCAGTGGTCCAACC Reverse: CGTACCGGATGAGCTGTGAA |
60°C59°C |
| COX-2 | Forward: GTACAAGCAGTGGCAAAGGC Reverse: ACGAGGTTTTTCCACCAGCA |
60°C60°C |
| GAPDH | Forward: GACCTCATGGCCTACATGGC Reverse: GCCCCTCCTGTTATTATGGGG |
60°C59°C |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).