Maternal infections during pregnancy may increase the risk of psychiatric disorders in offspring. We recently demonstrated that activation of peroxisome proliferator-activate receptor‐α (PPARα), with the clinically available agonist fenofibrate, attenuates the neurodevelopmental disturbances induced by maternal immune activation (MIA) in rat offspring. We hypothesized that fenofibrate might reduce MIA-induced cytokine imbalance using a MIA model based on the viral mimetic polyriboinosinic-polyribocytidilic acid [poly (I:C)]. By using the Bio-Plex Multiplex-Immunoassay-System, we measured cytokine/chemokine levels in maternal serum and in the fetal brain of rats treated with fenofibrate, at 6 and 24 hours after poly (I:C). We found that MIA induced time-dependent changes in the levels of several cytokines/chemokines/colony-stimulating factors (CSFs). Specifically, the maternal serum of the poly (I:C)/CTRL group showed increased levels of (i) proinflammatory chemokine macrophage inflammatory protein 1-alpha (MIP-1α), (ii) tumor necrosis factor-alpha (TNF-), the monocyte chemoattractant protein-1 (MCP-1), the macrophage (M-CSF) and granulocyte-macrophage colony-stimulating factor (GM-CSF). Conversely, in the fetal brain of the poly (I:C)/CTRL group, interleukin 12p70 and MIP-1 levels were lower than in veh/CTRL group. Notably, MIP-1, TNF-, GRO/KC, GM-CSF, and M-CSF levels were lower in the poly (I:C)/FEN than in poly (I:C)/CTRL rats, indicating the protective role of the PPARα agonist. PPARα might represent a therapeutic target to attenuate the consequences of MIA.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Autism spectrum disorder (ASD) is a neuropsychiatric condition characterized by impaired social interactions and repetitive stereotyped behaviors. Growing evidence highlights an important role of the gut-brain-microbiome axis in the pathogenesis of ASD. Research indicates an abnormal composition of the gut microbiome and the potential involvement of bacterial molecules in neuroinflammation and brain development disruptions. Concurrently, attention is directed towards the role of short-chain fatty acids (SCFAs) and impaired intestinal tightness. This comprehensive review emphasizes the potential impact of maternal gut microbiota changes on the development of autism in children, especially considering maternal immune activation (MIA). The following paper evaluates the impact of the birth route on the colonization of the child with bacteria in the first weeks of life. Furthermore, it explores the role of pro-inflammatory cytokines, such as IL-6 and IL-17a and mother’s obesity as potentially environmental factors of ASD. The purpose of the present analysis is to advance our understanding of ASD pathogenesis, while also searching for the positive implications of the latest therapies, such as probiotics, prebiotics or fecal microbiota transplantation, targeting the gut microbiota and reducing inflammation. This review aims to provide valuable insights that could instruct future studies and treatments for individuals affected by ASD.