Submitted:
22 January 2026
Posted:
23 January 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Garlic Cultivars and gDNA Extraction
2.2. Random Amplified Polymorphic DNA (RAPD) PCR
| No. | Primer | Sequence | GC(%) | No. | Primer | Sequence | GC(%) |
| 1 | OPA-07 | 5'-CAGGCCCTTC-3 | 70 | 25 | OPB-01 | 5'-GTTTCGCTCC-3’ | 60 |
| 2 | OPA-14 | 5'-TCTGTGCTGG-3' | 60 | 26 | OPA-04 | 5'-AATCGGGCTG-3' | 60 |
| 3 | OPE-16 | 5'-CCTGATCACC-3' | 60 | 27 | OPA-08 | 5'-GTGACGTAGG-3' | 60 |
| 4 | OPB-18 | 5'-CCACAGCAGT-3’ | 60 | 28 | OPA-09 | 5'-GGGTAACGCC-3’ | 70 |
| 5 | OPA-19 | 5'-CAAACGTCGG-3’ | 60 | 29 | OPA-10 | 5'-GTGATCGCAG-3' | 60 |
| 6 | OPC-07 | 5'-GTCCCGACGA-3’ | 70 | 30 | OPC-06 | 5'-GAACGGACTC-3' | 60 |
| 7 | OPB-13 | 5'-TTCCCCCGCT-3' | 70 | 31 | OPA-12 | 5'-TCGGCGATAG-3' | 60 |
| 8 | OPE-01 | 5'-CCCAAGGTCC-3' | 70 | 32 | OPE-14 | 5'-TGCGGCTGAG-3’ | 70 |
| 9 | OPA-17 | 5'-GACCGCTTGT-3’ | 60 | 33 | OPA-15 | 5'-TTCCGAACCC-3' | 60 |
| 10 | OPE-08 | 5'-GGTCGGAGAA-3' | 60 | 34 | OPA-16 | 5'-AGCCAGCGAA-3' | 60 |
| 11 | OPE-09 | 5'-TCGGACGTGA-3' | 60 | 35 | OPA-18 | 5'-AGGTGACCGT-3' | 60 |
| 12 | OPB-02 | 5'-TGATCCCTGG-3’ | 60 | 36 | OPA-01 | 5'-CAGGCCCTTC-3’ | 70 |
| 13 | OPE-11 | 5'-GGAAGTCGCC-3' | 70 | 37 | OPA-11 | 5'-CAATCGCCGT-3' | 60 |
| 14 | OPC-05 | 5'-GATGACCGCC-3' | 70 | 38 | OPA-20 | 5'-GTTGCGATCC-3' | 60 |
| 15 | OPE-17 | 5'-CTACTGCCGT-3' | 60 | 39 | OPC-09 | 5'-CTCACCGTCC-3' | 70 |
| 16 | OPE-18 | 5'-GGACTGCAGA-3’ | 60 | 40 | OPC-13 | 5'-AAGCCTCGTC-3' | 60 |
| 17 | OPE-20 | 5'-AACGGTGACC-3' | 60 | 41 | OPD-01 | 5'-ACCGCGAAGG-3' | 70 |
| 18 | OPH-01 | 5'-GGTCGGAGAA-3' | 60 | 42 | OPD-03 | 5'-GTCGCCGTCA-3' | 70 |
| 19 | OPC-04 | 5'-CCGCATCTAC-3’ | 60 | 43 | OPH-02 | 5'-TCGGACGTGA-3' | 60 |
| 20 | OPH-04 | 5'-GGAAGTCGCC-3' | 70 | 44 | OPE-03 | 5'-CCAGATGCAC-3' | 60 |
| 21 | OPF-03 | 5'-CCTGATCACC-3' | 60 | 45 | OPE-12 | 5'-TTATCGCCCC-3’ | 60 |
| 22 | OPG-18 | 5'-GGCTCATGTG-3' | 60 | 46 | OPB-06 | 5'-TGCTCTGCCC-3' | 70 |
| 23 | OPG-19 | 5'-GTCAGGGCAA-3' | 60 | 47 | OPG-02 | 5'-GGCACTGAGG-3' | 70 |
| 24 | OPA-02 | 5'-TGCCGAGCTG-3’ | 70 | 48 | OPG-03 | 5'-GAGCCCTCCA-3' | 70 |
2.3. Cloning
2.4. Target Insert Confirmation by PCR and Sequencing
2.5. Analysis of PCR Product and DNA Sequence Data
2.6. SCAR-PCR Validation
3. Results
3.1. RAPD PCR
3.2. Cloning and Sequence Analysis

3.3. Design of SCAR Molecular Markers

4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Choi, H.-S.; Kim, K.-T.; Ahn, Y.-G.; Kim, D.-S.; Woo, J.-G.; Lim, Y.-P. Analysis of Genetic Relationships in Garlic Germplasm and Fertile Garlic by RAPD. Horticulture, Environment, and Biotechnology 2003, 44(5), 595–600. Available online: https://zrr.kr/zkjVRG.
- Rural Development Administration (RDA). Agricultural Technology Guide_117_Garlic. Available online: https://zrr.kr/aSZMVo (accessed on 02 Dec 2025).
- Ahn, Y. K.; Yoon, M. K. Effect of Short Daylength and Temperature Control on Garlic Florogenesis. Horticultural Science and Technology 2010, 28(2), 180–185. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE11877595.
- Etoh, T. Germination of Seeds Obtained from a Clone of Garlic, Allium sativum L. Proceedings of the Japan Academy 1983, 59 (B), 83–87. [Google Scholar] [CrossRef]
- Katarzhin, M. S.; Katarzhin, I. M. Experiments on the Sexual Reproduction of Garlic. Byulleten' Vsesoyuznogo Ordena Lenina I Ordena Druzhby Narodov Instituta Rastenievodstva Imeni N.I. Vavilov 1978, 80, 74–76. Available online: https://www.cabidigitallibrary.org/doi/full/10.5555/19801687714.
- Etoh, T.; Noma, Y.; Nisfutarumizu, Y.; Wakomoto, T. Seed Productivity and Germinability of Various Clones Collected in Soviet Central Asia. Memoirs of the Faculty of Agriculture, Kagoshima University 1988, 24, 29–139. Available online: https://www.jstage.jst.go.jp/article/jjshs1925/55/3/55_3_312/_pdf.
- Dhall, R. K.; Cavagnaro, P. F.; Singh, H.; Mandal, S. History, Evolution and Domestication of Garlic: A Review. Plant Syst Evol 2023, 309, 33. [Google Scholar] [CrossRef]
- Pooler, M. R.; Simon, P. W. Characterization and Classification of Isozyme and Morphological Variation in a Diverse Collection of Garlic Clones. Euphytica 1993, 68, 121–130. [Google Scholar] [CrossRef]
- Choi, H. S.; Chae, W. B.; Kwack, Y. B.; Jeong, M. I. A New Early Harvest Garlic Cultivar 'Allkae'. Korean Journal of Horticultural Science and Technology 2008, 26 (II), 9–12. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE11877429.
- Yoon, M.; Ahn, Y.; Chae, S. Development of Garlic Cultivar (Allium sativum L.) Using Fertile Garlic. Horticultural Science and Technology 2007, 25 (I), 79–79. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE11871658.
- Kim, J.-S.; Ra, J. H. Comparison of Phytochemical Composition and Physiological Activity of ‘Hongsan’ and 'Hansan', a New Variety of Garlic. Korean Journal of Food Science and Technology 2019, 51(2), 147–151. [Google Scholar] [CrossRef]
- Park, J.-M.; Kim, A.-J. Evaluation of the Biological Activities of ‘Hongsan’ Garlic Bulbil. Journal of the Korean Society of Food Science and Nutrition 2023, 52(6), 773–779. [Google Scholar] [CrossRef]
- Kwak, J.-H.; Ahn, Y. K.; Kim, C.-W.; Kwon, Y.-S.; Choi, K. J.; Yoon, M. K. New Garlic Variety ‘Hongsan’ for High Yield and Nationwide Cultivation. Korean Journal of Horticultural Science and Technology 2016, 34 (I), 115–115. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE06685275.
- Lee, J.; Yoon, S.; Lee, M.; Kwon, J.; Hong, K. Effect of Bulblet Harvest Timings on Bulb and Bulblet Yield of Garlic cv. ‘Hongsan’. Korean Journal of Horticultural Science and Technology 2018, 36 (II), 79–79. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE07555674.
- Han, J. W.; Kwon, Y. S.; Kim, C. W.; Kwak, J. H. Changes on the Yield and Components in New Garlic Variety ‘Hongsan’ According to Preharvesting Treatment and Harvesting Season. Korean Journal of Horticultural Science and Technology 2017, 35 (I), 66–66. Available online: https://www.dbpia.co.kr/journal/articleDetail?nodeId=NODE07181725.
- Luitel, B. P.; Lee, H. J.; Choi, M. S.; Lim, T. J. Effects of Planting Depth and Sunshine Drying on Expression of Greenness at the Tip of Peeled ‘Hongsan’ Garlic Cloves. Korean Journal of Environmental Agriculture 2024, 43, 128–136. [Google Scholar] [CrossRef]
- Jenderek, M. M.; Schierenbeck, K.; Hannan, R. M. Random Amplified Polymorphic DNA Analysis of Garlic (Allium sativum L.) Germplasm Collection. HortScience 1997, 32(3), 452F. [Google Scholar] [CrossRef]
- Wang, H.; Li, X.; Liu, X.; Qiu, Y.; Song, J.; Zhang, X. Genetic Diversity of Garlic (Allium sativum L.) Germplasm from China by Fluorescent-Based AFLP, SSR and InDel Markers. Plant Breed 2016, 135, 743–750. [Google Scholar] [CrossRef]
- Ipek, M.; Sahin, N.; Ipek, A.; Cansev, A.; Simon, P. W. Development and Validation of New SSR Markers from Expressed Regions in the Garlic Genome. In Scientia Agricola; FapUNIFESP (SciELO), 2015. [Google Scholar] [CrossRef]
- Mane-Deshmukh, V.; Ghodake, B.; Kharpude, P.; Patil, A. Morphological and Molecular Characterization of Onion (Allium cepa L.) Genotypes Using RAPD Markers. The Pharma Innovation 2023, 12(2), 1925–1930. [Google Scholar] [CrossRef]
- Devos, K. M.; Gale, M. The Use of Random Amplified Polymorphic DNA Markers in Wheat. Theoretical and Applied Genetics 1992, 84, 567–572. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, J.; Chen, Q.; Chang, Y.; Du, J.; Meng, H. Analysis of the Genetic Diversity of Garlic (Allium sativum L.) Germplasm by SRAP. Biochemical Systematics and Ecology 2013, 50, 139–146. [Google Scholar] [CrossRef]
- Cabrita, L. F.; Aksoy, U.; Hepaksoy, S.; Leitão, J. M. Suitability of Isozyme, RAPD and AFLP Markers to Assess Genetic Differences and Relatedness Among Fig (Ficus carica L.) Clones. Scientia Horticulturae 2001, 87(4), 261–273. [Google Scholar] [CrossRef]
- Thormann, C. E.; Ferreira, M. E.; Camargo, L. E.; Tivang, J. G.; Osborn, T. C. Comparison of RFLP and RAPD Markers to Estimating Genetic Relationships Within and Among Cruciferous Species. Theoretical and Applied Genetics 1994, 88(8), 973–980. [Google Scholar] [CrossRef]
- Sairkar, P. K.; Sharma, A.; Shukla, N. P. SCAR Marker for Identification and Discrimination of Commiphora wightii and C. myrrha. Molecular Biology International 2016, 1482796. [Google Scholar] [CrossRef] [PubMed]
- Kok Hon, Y.; Yong, C. S.-Y.; Abdullah, J. O.; Go, R. Development of Species-Specific SCAR Markers for Identification and Authentication of Three Rare Peninsular Malaysian Endemic Coelogyne (Orchidaceae) Orchids. F1000Research 2021, 9, 1161. [Google Scholar] [CrossRef]
- Al-Mathidy, A. M.; Al-Talab, N. N.; Kharabe, K. B. E. Identification of Garlic (Allium sativum L.) Cultivars by Using Morphological and Chemical Characters. NVEO-NATURAL VOLATILES and ESSENTIAL OILS Journal 2021, 8893–8907. Available online: https://zrr.kr/sZTGW7.
- Bae, S.-K.; Jung, E.-A.; Kwon, S.-T. Genetic Variation and Identification of RAPD Markers from Some Garlic Cultivars in Korea and Mongolia. Korean Journal of Plant Resources 2010, 23(5), 458–464. Available online: https://koreascience.or.kr/article/JAKO201006159731691.page.
- Li, X.; Qiao, L.; Chen, B.; Zheng, Y.; Zhi, C.; Zhang, S.; Pan, Y.; Cheng, Z. SSR Markers Development and Their Application in Genetic Diversity Evaluation of Garlic (Allium sativum L.) Germplasm. Plant Diversity 2022, 44(5), 481–491. [Google Scholar] [CrossRef] [PubMed]
- Morales, R. G.; Resende, J. T.; Resende, F. V.; Delatorre, C. A.; Figueiredo, A. S.; Da-Silva, P. R. Genetic Divergence Among Brazilian Garlic Cultivars Based on Morphological Characters and AFLP Markers. Genetics and Molecular Research 2013, 12(1), 270–281. Available online: https://pubmed.ncbi.nlm.nih.gov/23408414/. [CrossRef]
- Yang, J.; Sun, M.; Ren, X.; Li, P.; Hui, J.; Zhang, J.; Lin, G. Revealing the Genetic Diversity and Population Structure of Garlic Resource Cultivars and Screening of Core Cultivars Based on Specific Length Amplified Fragment Sequencing (SLAF-Seq). Genes 2024, 15(9), 1135. [Google Scholar] [CrossRef]
- Alimoradi Askar, S.; Nasr Esfahani, M.; Shirazi, K.; Nasr Esfahani, A.; Zeinalzadeh-Tabrizi, H.; Mohammadi, M. Unveiling Genetic Variation in Garlic Genotypes in Response to Rust Disease Using RAPD Markers. OBM Genetics 2024, 8(2), 231. [Google Scholar] [CrossRef]
- Staden, R. The Staden Sequence Analysis Package. Molecular Biotechnology 1996, 5, 233–241. [Google Scholar] [CrossRef]
- Staden, R.; Beal, K. F.; Bonfield, J. K. The Staden Package, 1998. Bioinformatics Methods and Protocols 1998, 115–130. [Google Scholar] [CrossRef]
- Bonfield, J.; Beal, K.; Jordan, M.; Cheng, Y. The Staden Package Manual; Medical Research Council, Laboratory of Molecular Biology: Cambridge, UK, 1999. [Google Scholar]
- Lee, Y.-J.; Lee, J.-B.; Lim, G.-S.; Kim, B.-K.; Kim, J.-H.; Park, H.-B. Analysis of Sanger Sequencing Data Using the Open-Source STADEN Package for Single Nucleotide Polymorphism Detection. Journal of Animal Breeding and Genomics 2023, 7(1), 1–8. Available online: https://www.jabg.org/0701-01/.
- Untergasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B. C.; Remm, M.; Rozen, S. G. Primer3—New Capabilities and Interfaces. Nucleic Acids Research 2012, 40(15), e115. [Google Scholar] [CrossRef] [PubMed]
- Kwon, S.-T.; Oh, S.-M. Genetic Relationship Among Garlic Cultivars Based on RAPD Analysis. Journal of Life Science 1999, 9(6), 671–676. Available online: https://koreascience.kr/article/JAKO199911919955413.page.
- Eom, E. M.; Lee, D. H. Characterization of Chromosomal DNA and DNA Polymorphism in Korean Cultivars of Allium sativum L. Journal of Plant Biology 1999, 42, 159–167. [Google Scholar] [CrossRef]
- Bergkessel, M.; Guthrie, C. Colony PCR. Methods in Enzymology 2013, 529, 299–309. [Google Scholar] [CrossRef]
- Popov, M.; Petrov, S.; Nacheva, G.; Ivanov, I.; Reichl, U. Effects of Recombinant Gene Expression on ColE1-like Plasmid Segregation in Escherichia coli. BMC Biotechnology 2011, 11, 1–12. [Google Scholar] [CrossRef]
- Nabulsi, I.; Al-Safadi, B.; Ali, N. M.; Arabi, M. I. Evaluation of Some Garlic (Allium sativum L.) Mutants Resistant to White Rot Disease by RAPD Analysis. Annals of Applied Biology 2001, 138, 197–202. [Google Scholar] [CrossRef]








| Name | Sequence(5’-3’) | GC(%) | Tm(℃) | mer |
| SaH_191R | GGTGTTTCATTTGCAAGGCC | 50 | 59.8 | 20 |
| SaH_513F | CTCGGAGGAAGGTAATGCCC | 60 | 64.1 | 20 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).