Preprint
Article

This version is not peer-reviewed.

Genotypic Diversity and Antimicrobial Resistance Profiles of Multidrug-Resistant Escherichia coli in Porcine Populations from Hubei, China

A peer-reviewed version of this preprint was published in:
International Journal of Molecular Sciences 2026, 27(1), 524. https://doi.org/10.3390/ijms27010524

Submitted:

11 December 2025

Posted:

12 December 2025

You are already at the latest version

Abstract

The indiscriminate and excessive use of antimicrobial agents in livestock production constitutes a significant contributor to antimicrobial resistance (AMR), posing substantial threats to global public health. Despite this critical concern, the genetic diversity and antibiotic resistance patterns of Escherichia coli (E. coli) in regional ecosystems remain insufficiently characterized. This study investigated the prevalence of antibiotic resistance, transmission mechanisms, and molecular epidemiology of E. coli strains isolated from swine farms in Hubei Province, China, while simultaneously analyzing their clonal and genetic diversity. A total of 148 E. coli isolates were collected from porcine sources in central China, revealing distinct regional variations in genetic diversity. Multilocus sequence typing (MLST) analysis identified 38 sequence types (STs) distributed across 7 clonal complexes (CCs) and several unassigned clones. ST46 emerged as the predominant sequence type (19.6% prevalence), followed by ST23 and ST10. Antimicrobial susceptibility testing demonstrated universal resistance to lincosamides and sulfonamides, with all isolates exhibiting multidrug resistance (MDR) to ≥9 antimicrobial classes. Genetic characterization detected 16 resistance determinants, with individual isolates carrying 5-7 resistance genes on average. The resistance profile included:Seven β-lactamase genes: blaTEM (61.5%), blaCTX-M-1G (57.4%), blaDHA (46.6%), blaSHV (39.2%), blaCTX-M-9G (24.3%), blaOXA (13.5%), and blaCMY-2 (1.4%). Eight aminoglycoside-modifying enzyme genes, polymyxin resistance gene mcr-1 (7.4%).Virulence factor screening through PCR detected nine associated genes, with EAST1, fyuA, STa, K88, STb, Irp2, and LT-1 present in 95.3% of isolates, while K99 and 987P were absent in all specimens. This investigation documents alarmingly high antimicrobial resistance rates in swine-derived E. coli populations while elucidating their genetic diversity. The findings suggest that intensive antibiotic use in porcine production systems has driven the evolution of extensively drug-resistant bacterial strains. These results emphasize the urgent need for implementing antimicrobial stewardship programs in livestock management to mitigate AMR proliferation.

Keywords: 
;  ;  ;  ;  ;  

1. Introduction

Escherichia coli (E. coli) is a predominant commensal bacterium residing as part of the natural gut microbiota in humans and warm-blooded animals [1,2,3,4]. However, pathogenic strains of E. coli are a major cause of intestinal infections in neonatal piglets aged 1-10 days, primarily causing diarrhea and edema in this vulnerable population [5]. The lack of effective vaccines to prevent E. coli outbreaks attributable to its diverse serotypes and region-specific epidemiological variations has led to heavy reliance on antimicrobial agents for disease management in most agricultural settings. The escalating use of antimicrobials in livestock production has precipitated the emergence of multidrug-resistant (MDR), extensively drug-resistant (XDR), and even pandrug-resistant (PDR) bacterial strains, raising significant global health concerns. Of particular urgency is the rapid dissemination of antimicrobial resistance (AMR), a critical public health crisis that now permeates multiple sectors of society and imposes substantial economic burdens worldwide [6].
Antimicrobial resistance (AMR) has evolved into one of the most critical global health threats of the past three decades [7]. Of particular concern is the rising prevalence of drug-resistant Gram-negative bacteria in livestock populations, which can transmit to humans through environmental pathways and food chain contamination [8]. The intensive use of antibiotics in swine production has exacerbated this trend, with resistance patterns in pig-derived pathogens showing accelerated development compared to other livestock sectors. Notably, surveillance data from Great Britain revealed higher AMR prevalence in porcine-derived E. coli isolates than those from cattle and sheep [9], underscoring the urgency to systematically characterize antibiotic resistance profiles of pathogenic E. coli in Chinese swine operations. Surveillance data from 2011-2012 revealed high resistance rates in swine E. coli isolates to tetracycline (79.57%), trimethoprim-sulfamethoxazole (73.12%), and kanamycin (55.91%) [10]. Subsequent monitoring in Guangdong Province (2013-2016) detected multidrug resistance (MDR) in 100% of 333 E. coli isolates from commercial pig operations [11]. These findings reflect global concerns where MDR Gram-negative pathogens contribute to 60-70% of antimicrobial treatment failures in veterinary practice, highlighting critical challenges for animal health management [12].
Extended-spectrum beta-lactamase (ESBL)-producing-E. coli is spreading worldwide and poses a public health issue[13]. Escherichia coli has evolved multiple β-lactamase-mediated resistance mechanisms, including: Extended-spectrum β-lactamases (ESBLs; SHV, TEM, OXA, and CTX-M types), Plasmid-mediated AmpC β-lactamases (CMY-2, a plasmid-mediated AmpC-like gene) and Carbapenemases (MBL, KPC, and class D oxacillinases) [14]. CTX-Ms was the largest group of ESBLs, and they have become globally disseminated. Currently, CTX-M-15 (a part of the CTX-M-1 group) is the most frequent CTX-M worldwide. This is closely followed by CTX-M-14 (a member of the CTX-M-9 group) [15]. Given the limited data on the epidemiology of MDR E. coli from pigs in Hubei province in China, it is interesting to investigate the spread of these resistant bacteria, particularly the ESBL types, which may be the cause of the spread of resistance genes from pork to human.
Several studies of epidemiological studies on E. coli have been initiated in parts of China. In Northeastern China, a survey showed that the separation rate of E. coli isolated from pig fecal samples reached 88% [16]. An investigation on pig farms in Henan province found that the positive rate of E. coli was 70.74%, of which the commonly sequenced types (STs) 10 and 101 were identified [17]. However, data on genetic diversity and antimicrobial resistance of E. coli is still restricted in the Hubei province of central China.
E. coli can induce porcine postweaning diarrhea (PWD) [18], and it may be associated with the expression of fimbriae to mediate adhesion and colonization of porcine enterocytes [19,20]. The most adhesins are related with fimbriae F18 and F4 (K88), F5 (K99), F6 (987P) and F41, while F18 and F4 (K88) are leading cause of PWD of piglets [21,22,23]. While the pathogenic E. coli predominant toxins including heat-labile (LT-Ⅰand LT-Ⅱ) [24,25], heat-stable (STa and STb) [26], enteroaggregative E. coli heat-stable enterotoxin 1 (EAST1) [27] and produce other virulence factors, such as pathogenicity islands (PAI). In particular, the locus of enterocyte effacement (LEE) and high-pathogenicity island (HPI) are the significant PAIs. Irp2 and fyuA genes, located in the high-pathogenicity island (HPI), encode a yesiniabactin-like iron scavenging system [28]. However, E. coli isolated from pigs with diarrhea carry different types of virulence genes, which can enhance the pathogenicity of E. coli through synergistic effects. However, data on characteristics of virulence genes of E. coli is still restricted in the Hubei province of central China.
Multilocus sequence typing (MLST) has been used to study the evolution and epidemiology of a number of bacterial pathogens. It has become the method of choice for typing epidemiologically important strains. MLST is a standard molecular subtyping technique that identifies the genetic relatedness of strains and determines the strains with high discriminatory power [29]. Investigating the trend characterization of epidemic strains will help us to better understand epidemiology.
This present study was carried out to investigate the prevalence and characteristics of E. coli, the MLST genotypes, antibiotic resistance and virulence genes of E. coli isolates were examined, collected from 2019 to 2022 in Hubei province of China. These findings provide information and implication for safeguarding and commanding the occurrence of diseases in future studies.

2. Methods

Isolation of E. coli

From 2019 to 2022, a total of 148 fecal swab samples were collected from pig farms in 4 cities, including Xiangyang, Yichang, Suizhou, Wuhan in Hubei province. The samples were taken from diseased piglets with diarrhea symptoms. These strains isolated by MacConkey agar incubated at 37℃ for 24 h. Pink colonies were picked and purified again, then bacterial stains cultured in Luria-Bertani (LB) broth at 37℃ for 24 h. And further confirmed by the PCR amplification of the 16S rRNA gene with primers (16S-F: 5ʹ-AGAGTTTGATCATGGCTCAG-3ʹ; 16S-R: 5ʹ-TAGGGTTACCTTGTTACGACTT-3 ʹ) as previously described[30] with some slight modifications.

Antibiotic Resistance Profiles

According to the guidelines of the Clinical and Laboratory Standards Institute[31], the confirmed E. coli was identified for antimicrobial susceptibility. E. coli isolates were examination for susceptibility to antimicrobial drugs utilizing a disk diffusion assay. All samples were analyzed for the presence of resistant bacteria. A total of 17 antimicrobials were tested, comprising cefuroxime (CXM), ceftriaxone (CRO), cephalothin (CEP), cefotaxime (CTX), ampicillin (AMP), amoxicillin (AMX), lincomycin (MY), doxycycline (DOC), tetracycline (TET), kanamycin (KMC), gentamicin (GEN), amikacin (AMK), ciprofloxacin (CIP), enoxacin (ENO), lomefloxacin (LOM), azithromycin (AZM), sulfafurazole (SFN). Inoculated plates were incubated at 37℃ for 24 h, subsequently the diameters (in mm) of the inhibition zone were measured. Based on the minimal inhibitory concentration determined for each drug, the isolates were classified as “susceptible”, “intermediate”, or “resistant”. The E. coli strain ATCC 25922 was utilized for quality control. Multidrug-resistant (MDR) of an isolate was designated as clinical resistance to at least one agent in three or more antimicrobial categories[32].

Detection of Antibiotic Resistance Genes

The boiling the lysis of isolated colonies method was used to extract total DNA of each E. coli strain. PCR was used to identify genes responsible for resistance to β-lactamase genes (blaDHA, blaCMY-2, blaTEM, blaSHV, blaCTX-M-1G, blaCTX-M-9G, blaOXA), aminoglycoside modifying enzyme genes (aac(3’)-Ia, aac(3’)-IIc, aac(3’)-IV, aac(6’)-Ib, aadA1, aadA2, rmtA, rmtB), and polypeptide resistance gene mcr-1. The primers for PCR are listed in Table 1 and were synthesised at Sangon Biotech, Shanghai.

Detection of Virulence-Associated Genes

Considering the contribution of virulence genes to the invasiveness and pathogenicity of E. coli, DNA was isolated and identified nine virulence-associated genes of each strain, including LT-1, STa, STb, EAST1, irp2, fyuA, K88, K99, 987P were amplified by PCR, as previously described[33,34,35,36]. The primer sequences of virulence genes are shown in Table 2. PCR reactions were carried out in a final volume of 25 μl containing 12.5 μl mix (Vazyme Biotech, Nanjing, China), 1 μl each of primers, and 2 μl bacterial DNA. PCR was performed in a GeneAmp PCR System 9700 (Applied Bio-systems, Darmstadt, Germany), under the following conditions: initial denaturation at 95℃for 5 min, cycling consisted of 35 cycles of 30 s at 94 ℃, 30 s at 58℃and 1 min at 72℃and a final extension at 72℃for 10 min. The resulting amplification products were separated by electrophoresis in 1% agarose gel, stained with ethidium bromide and visualized using a GelDoc XR System (Bio-Rad, Shanghai, China).

MLST and Phylogenetic Tree

The multilocus sequence typing (MLST) was executed on E. coli isolates according to the E. coli MLST database guidelines (http://enterobase.warwick.ac.uk/
species/ecoli/allele st search), accreting to the protocols published on the web site. Briefly, the seven house-keeping genes adk, fumC, gyrB, icd, mdh, purA and recA were amplified employing a PCR protocol, and the amplicons sequenced utilizing the amplification primers. Investigated individual gene sequences and allocated an allelic profile number in line with the MLST database. Sequence type (STs) and clone complexes (CCs) designations of each strain were comprised of seven alleles. The calculated tree of the E. coli resistant isolates was constructed by applying the MEGA cluster analysis based on seven housekeeping gene sequences.

Statistics Analysis

The student’s t-test was employed to analyze the data. When P < 0.05, difference was considered statistically significant. The analysis was performed using GraphPad Prism version 8 (GraphPad Software, Inc., USA).

3. Result

Isolation of E. coli Strains and Antimicrobial Susceptibility Profile

E. coli isolates were obtained from fecal of weaned piglets from Hubei province. A total of 148 strains of E. coli were separated from samples and further identified by PCR tests as E. coli. There are 15 strains of E. coli isolated from Suizhou city, 37 strains of E. coli isolated from Xiangyang city, 82 strains of E. coli isolated from Wuhan city and 14 strains of E. coli isolated from Yichang city (Figure 1).

Antimicrobial Susceptibility Profile of E. coli Isolates

Antimicrobial susceptibility testing (AST) results showed that all of the E. coli isolates showed resistance to lincosamides and sulfonamide (Figure 2A). A high rate of resistance to sulfaisoxazole, tetracycline, lomefloxacin, enoxacin, ampicillin, amoxicillin, azithromycin, gentamicin, has also been observed for the isolates, among which 100% of the E. coli was resistant to sulfaisoxazole; 97.97% of the E. coli was resistant to tetracycline; 95.95% of the E. coli was resistant to lomefloxacin; 93.24% of the E. coli was resistant to enoxacin; 91.89% of the E. coli was resistant to ampicillin; 91.89% of the E. coli was resistant to amoxicillin; 89.19% of the E. coli was resistant to azithromycin; 82.43% of the E. coli was resistant to gentamicin. The isolates demonstrated a relatively low rate of resistance to cephalothin (77.7%) cefuroxime (68.92%), doxycycline (68.92%), cefotaxime (68.24%), ceftriaxone (62.84%), ciprofloxacin (61.49%), amikacin (52.7%) and kanamycin (51.35%) (Figure 2A, Figure 3).
As shown in the Figure 2B, all of the isolates were multidrug-resistant (MDR) strains, and most of the isolates were resistant to more than nine drug classes. AST revealed that the 20 isolates showed severe resistance profiles that was resistant to the seventeen antimicrobial agents tested. Overall, most of the isolates were conferring resistance to 12-14 antimicrobial agents tested. Among antibiotics tested here, resistance to sulfaisoxazole, azithromycin, lomefloxacin, enoxacin, amikacin, tetracycline, doxycycline, lincomycin, cefuroxime, ceftriaxone, cephalothin, cefotaxime.
E. coli in different regions has separate antibiotic resistance. The AST results revealed that resistance to lincomycin, and sulfaisoxazole was a common phenotype of the isolates from the pig farms in 4 cities, including Xiangyang, Yichang, Suizhou, Wuhan in Hubei province (Figure 3). E. coli strains resistant to doxycycline and amikacin were isolated including Yichang, Suizhou, Wuhan in Hubei province, respectively; Xiangyang was the only region where no strains from pig farms with the abovementioned resistant phenotypes were detected (Figure 3). Notably, MDR isolates were identified on pig farms in Hubei province, but a relatively high proportion of the MDR isolates were identified on farms in wuhan and yichang relative to those from the other city.

Detection of Antimicrobial Resistance Genes

16 ARGs (Antibiotic resistance genes, ARGs) in 148 strains of E. coli were detected (Figure 4A) using PCR-based assays. Of which, aac(6’)-Ib (71.6%, 106/148), blaTEM (61.5%, 91/148), aadA1 (60.1%, 89/148), blaCTX-M-1G (57.4%, 85/148), aac(3’)-Iv (55.4%, 82/148), aac(3’)-IIc (54.1%, 80/148), aadA2 (52.7%, 78/148), blaDHA (46.9%, 69/148) were prevalent with higher detection rates (Figure 4B). Among the 148 E. coli strains, 147 strains carried β-lactamase genes with a detection rate of 99.3%, of which, the detection rates of blaSHV, blaTEM, blaOXA, blaCMY-2 and blaDHA were 39.2% (58/148), 61.5% (91/148), 13.5% (20/148),1.4% (2/148) and 46.6% (69/148), respectively. The detection rate of blaCTX-M-1G in CTX-M was 57.4% (highest) and the detection rate of blaCTX-M-9G was 24.3%.
Among the 148 E. coli strains, 144 strains carried aminoglycoside-modifying enzyme genes with a detection rate of 97.3%, of which, the detection rates of rmtB (8.1%) and aac(3’)-Ia (33.8%) were prevalent with lower detection rates. Amongst the strains positive for aminoglycoside-modifying enzyme genes, only one strain was positive for rmtA. In addition, the detection rate of the mobilised colistin resistance gene mcr-1 was 7.4%.
Antibiotic resistance genes were detected in all 147 strains, only one strain was not detected anyone antibiotic gene. Of which, 91 (61.5%) strains had more than six ARGs, four (2.7%) strains had more than 10 ARGs, and two strains had 11 ARGs (Supplementary Table 1).

Various Extended-Spectrum β-Lactamase Genes Were Present in the Isolates

Amongst the 148 strains tested, 147 (99.3%) strains carried ESBLs and 130 of them harbored various number of ESBLs. The most frequent was blaTEM+blaSHV+blaCTX-M-1G (13.5%, 20/148); 64 strains were found to have two different ESBLs genes; 52 strains were found to have three different ESBLs genes; 11 strains were found to have four different ESBLs genes; 3 strains were found to have five ESBLs genes blaTEM, blaCTX-M-1G, blaCTX-M-9G, blaDHA and blaOXA (Figure 4C, Supplementary Table 1).

Various Extended-Spectrum Aminoglycoside-Modifying Enzyme Genes Were Present in the Isolates

Amongst the 148 strains tested, 144 (97.3%) strains carried aminoglycoside-modifying enzyme genes and 133 of them harbored various number of aminoglycoside-modifying enzyme genes. The most frequent were aadA1+aadA2+aac(3’)-Iv+aac(6’)-Ib and aac(3’)-IIc+aadA1+aadA2+aac(3’)-Iv+aac(6’)-Ib (15.5%, 23/148); 34 strains were found to have two different ESBLs genes; 22 strains were found to have three different ESBLs genes; 41 strains were found to have four different ESBLs genes; 27 strains were found to have five different ESBLs genes; 9 strains were found to have six different ESBLs genes (Figure 4D, Supplementary Table 1).

Prevalence of Virulence Genes in E. coli Isolates from Pigs

The distribution of 8 virulence genes in 148 strains of E. coli has been examined in this study. As shown in Figure 5A/B, the virulence gene EASTI (80.4%, 119/148) were found in most of the E. coli isolates, followed by fyuA (55.4%, 82/148), STa (52%, 77/148), K88 (38.5%, 57/148) and irp2 (3.1%, 49/148). While K99 and 987P were not detected in all isolates.
Amongst the 148 strains tested, 141 (95.3%) strains carried virulence genes and 123 of them harbored various number of virulence genes. The most frequent were EASTI+ and EASTI+fyuA+ (9.9%, 14/141), followed by irp2+fyuA+ (9.2%, 13/141), STa+EASTI (7.1%, 10/141), STa+EASTI+irp2+fyuA+K88+ (6.4%, 9/141), STa+EASTI+fyuA+K88+ (5.7%, 8/141), EASTI+EASTI+irp2+ (5.0%, 7/141), LT-1+STa+STb+EASTI+irp2+fyuA+K88+ (4.3%, 6/141), LT-1+STa+STb+EASTI+K88+ (4.3%, 6/141), STa+EASTI+K88+ (4.3%, 6/141) (Figure 5C, Supplementary Table 1).

Multi-Locus Sequence Typing (MLST)

The genetic diversity of these E. coli isolates was analyzed with MLST. A total of 148 isolates were analyzed utilizing MLST, the identification of 38 sequence types (STs). Among these isolates, 101 out of the 148 isolates possessed 14 different STs which belonged to 7 CCs. The remaining 46 isolates belonged to 23 different unassigned STs. A new STs were due to new combinations of previously known alleles in adk (allele 7), fumC (allele 7), gyrB (allele 193), icd (allele 1), mdh (allele 986), purA (allele 159) and recA (allele 139). The predominant STs were ST46, ST23 and ST10 containing 29 (19.59%), 20 (13.51%),12 (8.11%) isolates respectively. Ten STs contained 3 or more isolates with ST602, ST165, ST100, ST744, ST7452, ST1642, ST1081, ST515, ST48 and ST101 comprising 9 (6.08%), 8 (5.41%), 8 (5,41%), 7 (4.73%), 5 (3.38%), 4 (2.70%), 4 (2.70%), 4 (2.70%), 3 (2.03%) and 3 (2.03%) isolates respectively. Seven STs (ST410, ST650, ST764, ST1147, ST1518, ST2739 and ST5229) contained 2 isolates each. Eight STs (ST77, ST88, ST457, ST542, ST617, ST710, ST746, ST1112, ST1585, ST1716, ST1990, ST3744, ST5334, ST7601, ST9607, ST11019 and ST11284) had only 1 isolate each (Figure 6).
Minimum-spanning trees showed that the tested E. coli mainly classed into seven clonal complexes and other unassigned clone complexes. CC-46 was the most frequently isolated clonal complex which contained 29 isolates belonging to one STs, and accounted for 19.59% (29/148) of all the isolates. The major clonal complexes also included CC-23 (25/148, 16.89%), CC-10 (16/148, 10.81%) and CC-165 (16/148, 10.81%). The other isolates covered 28 STs belonging to 3 CCs and unassigned.
To further analyzing STs utilized the UPGMA cluster analysis (Figure 6). 37 identified STs were classified into four major groups. Group 1 included 1 isolate that only belonged to one unassigned clone complexes. There are 6 isolates included two different unassigned clone complexes constitute Group 2. Group 3 and group 4 covered a great majority of STs, containing 140 isolates, belonging to the CC-10, CC-23, CC-46, CC-101, CC-165, CC-206, CC-446 and unassigned clone complexes. CC-10 contained 3 of our STs (ST10, ST48 and ST617). CC-23 contained 4 of our STs (ST23, ST88, ST410 and ST650). CC-101 contained 2 of our STs (ST101 and ST5229). CC-165 contained 2 of our STs (ST100 and ST165) (Figure 6).

4. Discussion

E. coli is one of the main pathogenic bacteria that impact the production and growth of pigs in pig farms. It is associated with gastrointestinal diseases such as diarrhea, edema disease, and systemic infections such as septicemia and polyserositis [2]. These diseases caused by E. coli can increase mortality, morbidity and growth delays of piglets, which are responsible for economic losses. This study analyzed the prevalence, genetic diversity and antibiotic resistance of disease, which may help us to improve methods of prevention and treatment.
The distribution of swine-origin E. coli in pigs differs between countries and regions. From 2002 to 2008, the prevalence of E. coli isolated from pork chop samples was 44% in the United States [37]. However, various incidence rates have also been reported in different regions of China. From 2003 to 2009, the prevalence of E. coli isolates from pig farms was 77.78% in China [38]. From 2013 to 2016, the positive rates of E. coli between farm 1 and farm 2 were 40.25% and 59.75% in Guangdong province [11]. Between 2016 and 2017, a survey indicated that the separation rate of E. coli isolated from pig fecal swabs reached 88% in northeastern China, including Heilongjiang, Jilin and Liaoning [16]. In this study, we collected samples from the fecal of weaned piglets, and a total of 148 strains of E. coli were isolated from 4 cities in Hubei province.
Diarrhea in weaned piglets driven by E. coli remains a principal cause of economic losses for the pig industry. This commonly seeks antimicrobial drug treatment, which is considerable to cure pathogen animals. In 2011, Danish scholar Agersө et al. study found that 32% of isolates have multi-drug resistance, mainly concentrated on ampicillin (27%) and tetracycline (29%) [39]. In 2012, Tadesse et al. tested 1729 isolates of E. coli antibiotic susceptibility varied from different sources, the resistance rate of E. coli increased from 7.2% to 63.6% but the most common resistance to tetracycline, streptomycin and sulfonamides [40]. Total of 131 E. coli isolates were obtained from the pigs presenting from diarrhea in Switzerland from 2014 to 2015, isolates exhibited resistance to tetracycline (50%), sulfamethoxazole (49%), ampicillin (26%), gentamicin (17%), ciprofloxacin (8%) [41]. However, this caused a rise in the employment of various antimicrobial agents, such as lincosamides, tetracyclines and sulfonamides, which may expand antimicrobial resistance.
In this study, E. coli isolates results of the antimicrobial susceptibility tests presented that the most prevalent antibiotic resistance was to lincosamides, tetracyclines, sulfonamides. This may be related to the long-term irrational use of these three antibiotics to control bacterial diarrhea in piglets in Hubei province. More than 80% of E. coli isolates presented high resistance rates to tetracycline, lomefloxacin, enoxacin, ampicillin, amoxicillin, azithromycin and gentamicin. The isolates are also resistant to beta-lactams drugs, the resistance to first-generation cephalosporin drug cephalothin 77.7%, higher than the second-generation cephalosporins cefuroxime (68.9%) and the third-generation drugs cefotaxime (68.2%) and ceftriaxone (62.8%). All of the isolates were resistant to test antibiotics to vary degrees, and Most of E. coli isolates advent high prevalent multi-drug resistance. There were twenty E. coli strains that were resistant to the seventeen antimicrobial agents tested. Overall, more than half of the isolates were conferring resistance to 9-17 antimicrobial agents tested. The most frequent multidrug resistance pattern was resistance to cefuroxime, amikactin, ampicillin, amoxicillin, lincomycin, doxycycline, tetracycline, gentamicin, lenoxacin, lomefloxacin, azithromycin and sulfaisoxazole, which covered 30 isolates. In some other studies in China, Jiang et al. revealed that E. coli isolates had high rates of resistance to ampicillin (99.5%), tetracycline (93.4%) and amoxicillin (65.1%). Resistance to cephalosporins, quinolones, and aminoglycosides was also quite prevalent[42]. Meng et al. study results showed that the great majority of E. coli isolates resistance to tetracycline (79.57%), trimethoprim-sulfamethoxazole (73.12%) and kanamycin in China (55.91%) [10]. However, E. coli isolates showed the highest resistance to sulfamethoxazole (61.6%), followed by tetracycline (61.2%), ampicillin (48.2%) and kanamycin (22.4%) in Sichuan province between 2012 and 2013 [43]. E. coli were isolated from pig farms from seven provinces that the resistance rate to ampicillin was 81.44%, 94.37% to tetracycline and 88.36% to sulfaisoxazole [44]. These findings provide important information and implications for the application of antibiotics in future studies.
It has been documented that E. coli has a great ability to accumulate ARGs, mainly through horizontal gene transfer [45]. In this study, a large number of ARGs are detected in various strains and it was found that a higher proportion contained six or more resistance genes. One of the most common antibiotic resistance mechanisms in E. coli is mediated by the production of β-lactamase, ESBLs are an increasing cause of resistance to third-generation cephalosporins, including the fourth-generation cephalosporins in Enterobacteriaceae [46,47]. The blaTEM, blaCTX-M and blaSHV types have been recognized as the most prevalent ESBL genes that confer antibiotic resistance among pathogens [48,49]. In this study, five ESBL genes and two AmpC enzyme gene (blaDHA, blaCMY-2) were detected. Among the 5 ESBL genes, blaTEM (61.5%) was the most prevalent gene, similar to the ESBLs epidemic in Guizhou in 2021 [50]; followed by blaCTX-M-1 at 57.4%, blaSHV at 39.2%, blaCTX-M-9G at 24.3% and blaOXA at 13.5%. ESBLs are paradigmatic of resistance, usually encoded on mobile genetic elements that accelerate their dissemination, has become another challenge for drug resistance control in pig farms [51].
It is inevitable for bacteria to develop resistance to aminoglycosides due to their widespread use. There have been reports of aminoglycoside resistance in both Gram-negative and Gram-positive bacteria [52]. In this study, the detection rate of five aminoglycoside-modifying enzyme genes (aac(6’)-Ib, aac(3’)-IV, aac(3’)-IIc, aadA1, aadA2) exceeds 50%, and it is possible to carry multiple aminoglycoside modifying enzyme genes in a single strain, leading to high levels of resistance to aminoglycosides. In 2015, the plasmid-mediated colistin resistance gene, mcr-1, was reported for the first time in E. coli isolate from the animals and their food in China [53], it has quickly spread to human pathogens [54]. The transfer of colistin resistance by plasmid has been ascribed to the mcr-1 gene, which is the most predominant type of mcr genes [55]. The low detection rate (7.4%) of mcr-1 in this study likely results from low use of polymyxins in pig feed in Hubei. It is important to monitor such strains closely to prevent their spread. The concern of antibiotics resistance in these categories is serious and need urgent attention. It demands urgent attention for regularization monitoring of antimicrobial susceptibilities and efficient administration of bacterial infections to restrict the further spread of multidrug resistance in Hubei province.
In the past decades, the occurrence and spread of PWD in piglets have caused massive economic losses to the development of the pig farming industry in China [36]. The highest detection rate of virulence factor EAST1 (80.4%), followed by fyuA (55.4%). Fimbriae adhesins are necessary in the pathogenetic mechanism, the most common adhesins on E. coli from PWD in pigs are fimbriae F4 and F18 [56]. F4 (K88) (38.5%) was identified in this study, which indicated that it was closely related with pathogenic E. coli. For enterotoxins detected in this study, the gene encoding the heat-stable enterotoxin STa was frequently detected (52.0%), which was similar with the finding reported in Korea and other countries [57,58], followed by the heat-stable enterotoxin STb (25.7%). The detection of heat-labile enterotoxin (LT-1) (10.1%) was less than the STa and STb in this study, it is possible that the comparative identified of enterotoxins seem to vary from one geographic area to another. This study finding the distribution and characteristics of virulence factors in E. coli in Hubei province of, and the data may be useful for establishing preventive measures for PWD.
The application of MLST in E. coli isolates better comprehending the genetic diversity of these E. coli isolates. In this study, a total of 148 isolates were analyzed utilizing MLST, the identification of 38 sequence types (STs), the most frequent ST was ST46, followed by ST23, ST10, ST602, ST165, ST100, ST744, ST7452, ST1642, ST1081, ST515, ST48, ST101, ST410, ST650, ST764, ST1147, ST1518, ST2739 and ST5229, and then the other strains were individually classified into 8 different STs. These isolates belonged to 7 CCs and other unassigned clone complexes, including CC46, CC23, CC10 and so on. It reveals that there is diversity in ST types in Hubei province. In Yang′s study, the common ST was ST10 (22/171, 12.9%), followed by , ST48 (16/171, 9.4%), ST744 (8/171, 4.7%), ST101 (7/171, 4.1%), ST617 (6/171, 3.5%), ST165 (5/171, 2.9%)[30]. Recently, E. coli ST10 has not only been presented by animals in China but also raised the ST10 from human infections in China [59]. Zhang et al. showed that the most prevalent ST was ST10 (16/32, 50%) [11]. However, ST10 (12/148, 8.11%) of the result in this study seem to conflict with those from most previous studies. The potential reason for these results is the limitation of the data and region.
In this study, a high antimicrobial resistance and the genotypic diversity of E. coli were observed isolated from swine-origin in Hubei province. From the results obtained it can be concluded that these isolates present high prevalent multi-drug resistance. These data provide a greater understanding of the genetic diversity and antimicrobial resistance of E. coli.

Supplementary Materials

The following supporting information can be downloaded at the website of this paper posted on Preprints.org.

Funding

This work was supported by the Technical Innovation Project of Hubei Province (2024CSA070); the Hubei Provincial Major Science and Technology Innovation Plan (2023BBB069), and the Hubei Province Innovation Center of Agricultural Sciences and Technology; (2021-620-000-001-017). The funders had no role in the study design, data collection, and analysis, decision to publish, or preparation of the manuscript.

Acknowledgments

Not applicable.

Conflicts of Interest

The authors report no declarations of interest.

References

  1. Marques C, Belas A, Franco A, Aboim C, Gama LT, Pomba C. Increase in antimicrobial resistance and emergence of major international high-risk clonal lineages in dogs and cats with urinary tract infection: 16 year retrospective study. J Antimicrob Chemother. 2018;73(2):377-84;. [CrossRef]
  2. Fairbrother JM, Nadeau E, Gyles CL. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim Health Res Rev. 2005;6(1):17-39;. [CrossRef]
  3. Suryadevara M, Clark AE, Wolk DM, Carman A, Rosenbaum PF, Shaw J. Molecular Characterization of Invasive Staphylococcus aureus Infection in Central New York Children: Importance of Two Clonal Groups and Inconsistent Presence of Selected Virulence Determinants. J Pediatric Infect Dis Soc. 2013;2(1):30-9;. [CrossRef]
  4. Moore JE, Watabe M, Millar BC, Rooney PJ, Loughrey A, Goldsmith CE. Direct molecular (PCR) detection of verocytotoxigenic and related virulence determinants (eae, hyl, stx) in E. coli O157:H7 from fresh faecal material. Br J Biomed Sci. 2008;65(3):163-5;. [CrossRef]
  5. Casey WT, McClean S. Exploiting molecular virulence determinants in Burkholderia to develop vaccine antigens. Curr Med Chem. 2015;22(14):1719-33;. [CrossRef]
  6. Yang SC, Lin CH, Aljuffali IA, Fang JY. Current pathogenic Escherichia coli foodborne outbreak cases and therapy development. Arch Microbiol. 2017;199(6):811-25;. [CrossRef]
  7. Beasley DW, Davis CT, Whiteman M, Granwehr B, Kinney RM, Barrett AD. Molecular determinants of virulence of West Nile virus in North America. Arch Virol Suppl. 2004;(18):35-41;. [CrossRef]
  8. Umpierrez A, Bado I, Oliver M, Acquistapace S, Etcheverria A, Padola NL, et al. Zoonotic Potential and Antibiotic Resistance of Escherichia coli in Neonatal Calves in Uruguay. Microbes Environ. 2017;32(3):275-82;. [CrossRef]
  9. Enne VI, Cassar C, Sprigings K, Woodward MJ, Bennett PM. A high prevalence of antimicrobial resistant Escherichia coli isolated from pigs and a low prevalence of antimicrobial resistant E. coli from cattle and sheep in Great Britain at slaughter. FEMS Microbiol Lett. 2008;278(2):193-9;. [CrossRef]
  10. Tauch A, Burkovski A. Molecular armory or niche factors: virulence determinants of Corynebacterium species. FEMS Microbiol Lett. 2015;362(23):fnv185;. [CrossRef]
  11. Zhang Y, Sun YH, Wang JY, Chang MX, Zhao QY, Jiang HX. A Novel Structure Harboring blaCTX-M-27 on IncF Plasmids in Escherichia coli Isolated from Swine in China. Antibiotics (Basel). 2021;10(4);. [CrossRef]
  12. De Waele JJ, Boelens J, Leroux-Roels I. Multidrug-resistant bacteria in ICU: fact or myth. Current Opinion in Anaesthesiology. 2020;33(2):156-61;. [CrossRef]
  13. Carvalho I, Tejedor-Junco MT, Gonzalez-Martin M, Corbera JA, Suarez-Perez A, Silva V, et al. Molecular diversity of Extended-spectrum beta-lactamase-producing Escherichia coli from vultures in Canary Islands. Environ Microbiol Rep. 2020;12(5):540-7;. [CrossRef]
  14. Ghafourian S, Sadeghifard N, Soheili S, Sekawi Z. Extended Spectrum Beta-lactamases: Definition, Classification and Epidemiology. Curr Issues Mol Biol. 2015;17:11-21.
  15. Peirano G, Pitout JDD. Extended-Spectrum beta-Lactamase-Producing Enterobacteriaceae: Update on Molecular Epidemiology and Treatment Options. Drugs. 2019;79(14):1529-41;. [CrossRef]
  16. Cheng P, Yang Y, Cao S, Liu H, Li X, Sun J, et al. Prevalence and Characteristic of Swine-Origin mcr-1-Positive Escherichia coli in Northeastern China. Front Microbiol. 2021;12:712707;. [CrossRef]
  17. Hu Z, Peng Z, Zhang X, Li Z, Jia C, Li X, et al. Prevalence and Molecular Characterization of Antimicrobial-Resistant Escherichia coli in Pig Farms, Slaughterhouses, and Terminal Markets in Henan Province of China. Foodborne Pathog Dis. 2021;18(10):733-43;. [CrossRef]
  18. Barros MM, Castro J, Araujo D, Campos AM, Oliveira R, Silva S, et al. Swine Colibacillosis: Global Epidemiologic and Antimicrobial Scenario. Antibiotics (Basel). 2023;12(4);. [CrossRef]
  19. Tran-Mai AP, Tran HT, Mai QG, Huynh KQ, Tran TL, Tran-Van H. Flagellin from Salmonella enteritidis Enhances the Immune Response of Fused F18 from Enterotoxigenic Escherichia coli. Trop Life Sci Res. 2022;33(3):19-32;. [CrossRef]
  20. Luo X, Wu S, Jia H, Si X, Song Z, Zhai Z, et al. Resveratrol alleviates enterotoxigenic Escherichia coli K88-induced damage by regulating SIRT-1 signaling in intestinal porcine epithelial cells. Food Funct. 2022;13(13):7346-60;. [CrossRef]
  21. Jerez-Bogota K, Jensen M, Hojberg O, Cormican P, Lawlor PG, Gardiner GE, et al. Antibacterial plant combinations prevent postweaning diarrhea in organically raised piglets challenged with enterotoxigenic Escherichia coli F18. Front Vet Sci. 2023;10:1095160;. [CrossRef]
  22. Fiil BK, Thrane SW, Pichler M, Kittila T, Ledsgaard L, Ahmadi S, et al. Orally active bivalent V(H)H construct prevents proliferation of F4(+) enterotoxigenic Escherichia coli in weaned piglets. iScience. 2022;25(4):104003;. [CrossRef]
  23. Duan Q, Wu W, Pang S, Pan Z, Zhang W, Zhu G. Coimmunization with Two Enterotoxigenic Escherichia coli (ETEC) Fimbrial Multiepitope Fusion Antigens Induces the Production of Neutralizing Antibodies against Five ETEC Fimbriae (F4, F5, F6, F18, and F41). Appl Environ Microbiol. 2020;86(24);. [CrossRef]
  24. Huang J, Duan Q, Zhang W. Significance of Enterotoxigenic Escherichia coli (ETEC) Heat-Labile Toxin (LT) Enzymatic Subunit Epitopes in LT Enterotoxicity and Immunogenicity. Appl Environ Microbiol. 2018;84(15);. [CrossRef]
  25. Joffre E, Sjoling A. The LT1 and LT2 variants of the enterotoxigenic Escherichia coli (ETEC) heat-labile toxin (LT) are associated with major ETEC lineages. Gut Microbes. 2016;7(1):75-81;. [CrossRef]
  26. Tobias J, Von Mentzer A, Loayza Frykberg P, Aslett M, Page AJ, Sjoling A, et al. Stability of the Encoding Plasmids and Surface Expression of CS6 Differs in Enterotoxigenic Escherichia coli (ETEC) Encoding Different Heat-Stable (ST) Enterotoxins (STh and STp). PLoS One. 2016;11(4):e0152899;. [CrossRef]
  27. Vereecke N, Van Hoorde S, Sperling D, Theuns S, Devriendt B, Cox E. Virotyping and genetic antimicrobial susceptibility testing of porcine ETEC/STEC strains and associated plasmid types. Front Microbiol. 2023;14:1139312;. [CrossRef]
  28. Guerra JA, Romero-Herazo YC, Arzuza O, Gomez-Duarte OG. Phenotypic and genotypic characterization of enterotoxigenic Escherichia coli clinical isolates from northern Colombia, South America. Biomed Res Int. 2014;2014:236260;. [CrossRef]
  29. Yun KW, Kim DS, Kim W, Lim IS. Molecular typing of uropathogenic Escherichia coli isolated from Korean children with urinary tract infection. Korean J Pediatr. 2015;58(1):20-7;. [CrossRef]
  30. Yang GY, Guo L, Su JH, Zhu YH, Jiao LG, Wang JF. Frequency of Diarrheagenic Virulence Genes and Characteristics in Escherichia coli Isolates from Pigs with Diarrhea in China. Microorganisms. 2019;7(9);. [CrossRef]
  31. Noah DL, Krug RM. Influenza virus virulence and its molecular determinants. Adv Virus Res. 2005;65:121-45;. [CrossRef]
  32. Song H, Santi N, Evensen O, Vakharia VN. Molecular determinants of infectious pancreatic necrosis virus virulence and cell culture adaptation. J Virol. 2005;79(16):10289-99;. [CrossRef]
  33. Li S, Wang L, Zhou Y, Miao Z. Prevalence and characterization of virulence genes in Escherichia coli isolated from piglets suffering post-weaning diarrhoea in Shandong Province, China. Vet Med Sci. 2020;6(1):69-75;. [CrossRef]
  34. Osman KM, Mustafa AM, Aly MA, AbdElhamed GS. Serotypes, virulence genes, and intimin types of shiga toxin-producing Escherichia coli and enteropathogenic Escherichia coli isolated from mastitic milk relevant to human health in Egypt. Vector Borne Zoonotic Dis. 2012;12(4):297-305;. [CrossRef]
  35. Cheng D, Sun H, Xu J, Gao S. PCR detection of virulence factor genes in Escherichia coli isolates from weaned piglets with edema disease and/or diarrhea in China. Vet Microbiol. 2006;115(4):320-8;. [CrossRef]
  36. Liu W, Yuan C, Meng X, Du Y, Gao R, Tang J, et al. Frequency of virulence factors in Escherichia coli isolated from suckling pigs with diarrhoea in China. Vet J. 2014;199(2):286-9;. [CrossRef]
  37. Zhao S, Blickenstaff K, Bodeis-Jones S, Gaines SA, Tong E, McDermott PF. Comparison of the prevalences and antimicrobial resistances of Escherichia coli isolates from different retail meats in the United States, 2002 to 2008. Appl Environ Microbiol. 2012;78(6):1701-7;. [CrossRef]
  38. Zhao QY, Li W, Cai RM, Lu YW, Zhang Y, Cai P, et al. Mobilization of Tn1721-like structure harboring blaCTX-M-27 between P1-like bacteriophage in Salmonella and plasmids in Escherichia coli in China. Vet Microbiol. 2021;253:108944;. [CrossRef]
  39. Hatta M, Kawaoka Y. [Molecular determinants associated with high virulence of influenza A virus]. Tanpakushitsu Kakusan Koso. 2007;52(10 Suppl):1237-41.
  40. Tadesse DA, Zhao S, Tong E, Ayers S, Singh A, Bartholomew MJ, et al. Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States, 1950-2002. Emerg Infect Dis. 2012;18(5):741-9;. [CrossRef]
  41. Brand P, Gobeli S, Perreten V. Pathotyping and antibiotic resistance of porcine enterovirulent Escherichia coli strains from Switzerland (2014-2015). Schweiz Arch Tierheilkd. 2017;159(7):373-80;. [CrossRef]
  42. Jiang H-X, Lü D-H, Chen Z-L, Wang X-M, Chen J-R, Liu Y-H, et al. High prevalence and widespread distribution of multi-resistant Escherichia coli isolates in pigs and poultry in China. The Veterinary Journal. 2011;187(1):99-103;. [CrossRef]
  43. Zhang A, He X, Meng Y, Guo L, Long M, Yu H, et al. Antibiotic and Disinfectant Resistance of Escherichia coli Isolated from Retail Meats in Sichuan, China. Microb Drug Resist. 2016;22(1):80-7;. [CrossRef]
  44. Zhang P, Shen Z, Zhang C, Song L, Wang B, Shang J, et al. Surveillance of antimicrobial resistance among Escherichia coli from chicken and swine, China, 2008-2015. Vet Microbiol. 2017;203:49-55;. [CrossRef]
  45. Poirel L, Madec JY, Lupo A, Schink AK, Kieffer N, Nordmann P, et al. Antimicrobial Resistance in Escherichia coli. Microbiol Spectr. 2018;6(4);. [CrossRef]
  46. Gelalcha BD, Kerro Dego O. Extended-Spectrum Beta-Lactamases Producing Enterobacteriaceae in the USA Dairy Cattle Farms and Implications for Public Health. Antibiotics (Basel). 2022;11(10);. [CrossRef]
  47. Saravanan M, Ramachandran B, Barabadi H. The prevalence and drug resistance pattern of extended spectrum beta-lactamases (ESBLs) producing Enterobacteriaceae in Africa. Microb Pathog. 2018;114:180-92;. [CrossRef]
  48. Tawfik AF, Alswailem AM, Shibl AM, Al-Agamy MH. Prevalence and genetic characteristics of TEM, SHV, and CTX-M in clinical Klebsiella pneumoniae isolates from Saudi Arabia. Microb Drug Resist. 2011;17(3):383-8;. [CrossRef]
  49. Dirar MH, Bilal NE, Ibrahim ME, Hamid ME. Prevalence of extended-spectrum beta-lactamase (ESBL) and molecular detection of blaTEM, blaSHV and blaCTX-M genotypes among Enterobacteriaceae isolates from patients in Khartoum, Sudan. Pan Afr Med J. 2020;37:213;. [CrossRef]
  50. Yu B, Zhang Y, Yang L, Xu J, Bu S. Analysis of antibiotic resistance phenotypes and genes of Escherichia coli from healthy swine in Guizhou, China. Onderstepoort J Vet Res. 2021;88(1):e1-e8;. [CrossRef]
  51. Perez F, Endimiani A, Hujer KM, Bonomo RA. The continuing challenge of ESBLs. Curr Opin Pharmacol. 2007;7(5):459-69;. [CrossRef]
  52. Gad GF, Mohamed HA, Ashour HM. Aminoglycoside resistance rates, phenotypes, and mechanisms of Gram-negative bacteria from infected patients in upper Egypt. PLoS One. 2011;6(2):e17224;. [CrossRef]
  53. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16(2):161-8;. [CrossRef]
  54. Hussein NH, Al-Kadmy IMS, Taha BM, Hussein JD. Mobilized colistin resistance (mcr) genes from 1 to 10: a comprehensive review. Mol Biol Rep. 2021;48(3):2897-907;. [CrossRef]
  55. Moosavian M, Emam N. The first report of emerging mobilized colistin-resistance (mcr) genes and ERIC-PCR typing in Escherichia coli and Klebsiella pneumoniae clinical isolates in southwest Iran. Infect Drug Resist. 2019;12:1001-10;. [CrossRef]
  56. Luppi A. Swine enteric colibacillosis: diagnosis, therapy and antimicrobial resistance. Porcine Health Manag. 2017;3:16;. [CrossRef]
  57. Kwon D, Choi C, Jung T, Chung HK, Kim JP, Bae SS, et al. Genotypic prevalence of the fimbrial adhesins (F4, F5, F6, F41 and F18) and toxins (LT, STa, STb and STx2e) in Escherichia coli isolated from postweaning pigs with diarrhoea or oedema disease in Korea. Vet Rec. 2002;150(2):35-7;. [CrossRef]
  58. Do TN, Cu PH, Nguyen HX, Au TX, Vu QN, Driesen SJ, et al. Pathotypes and serogroups of enterotoxigenic Escherichia coli isolated from pre-weaning pigs in north Vietnam. J Med Microbiol. 2006;55(Pt 1):93-9;. [CrossRef]
  59. Yu T, He T, Yao H, Zhang JB, Li XN, Zhang RM, et al. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China. Foodborne Pathog Dis. 2015;12(9):770-7;. [CrossRef]
  60. Pai H, Seo MR, Choi TY. Association of QnrB determinants and production of extended-spectrum beta-lactamases or plasmid-mediated AmpC beta-lactamases in clinical isolates of Klebsiella pneumoniae. Antimicrob Agents Chemother. 2007;51(1):366-8;. [CrossRef]
  61. Yan JJ, Hong CY, Ko WC, Chen YJ, Tsai SH, Chuang CL, et al. Dissemination of blaCMY-2 among Escherichia coli isolates from food animals, retail ground meats, and humans in southern Taiwan. Antimicrob Agents Chemother. 2004;48(4):1353-6;. [CrossRef]
  62. Weill FX, Demartin M, Tande D, Espie E, Rakotoarivony I, Grimont PA. SHV-12-like extended-spectrum-beta-lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J Clin Microbiol. 2004;42(6):2432-7;. [CrossRef]
  63. Brinas L, Moreno MA, Teshager T, Saenz Y, Porrero MC, Dominguez L, et al. Monitoring and characterization of extended-spectrum beta-lactamases in Escherichia coli strains from healthy and sick animals in Spain in 2003. Antimicrob Agents Chemother. 2005;49(3):1262-4;. [CrossRef]
  64. Liu JH, Wei SY, Ma JY, Zeng ZL, Lu DH, Yang GX, et al. Detection and characterisation of CTX-M and CMY-2 beta-lactamases among Escherichia coli isolates from farm animals in Guangdong Province of China. Int J Antimicrob Agents. 2007;29(5):576-81;. [CrossRef]
  65. Colom K, Pérez J, Alonso R, Fernández-Aranguiz A, Lariño E, Cisterna Rn. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiology Letters. 2003;223(2):147-51;. [CrossRef]
  66. Sun N, Liu JH, Yang F, Lin DC, Li GH, Chen ZL, et al. Molecular characterization of the antimicrobial resistance of Riemerella anatipestifer isolated from ducks. Vet Microbiol. 2012;158(3-4):376-83;. [CrossRef]
  67. Park CH, Robicsek A, Jacoby GA, Sahm D, Hooper DC. Prevalence in the United States of aac(6’)-Ib-cr encoding a ciprofloxacin-modifying enzyme. Antimicrob Agents Chemother. 2006;50(11):3953-5;. [CrossRef]
  68. Chen S, Zhao S, White DG, Schroeder CM, Lu R, Yang H, et al. Characterization of multiple-antimicrobial-resistant salmonella serovars isolated from retail meats. Appl Environ Microbiol. 2004;70(1):1-7;. [CrossRef]
Figure 1. Geographical distribution of the farms where the experimental samples were collected. Farms represent the different farms where samples were collected and the number of samples; Wuhan (82), Xiangyang (37), Yichang (14), Suizhou (15).
Figure 1. Geographical distribution of the farms where the experimental samples were collected. Farms represent the different farms where samples were collected and the number of samples; Wuhan (82), Xiangyang (37), Yichang (14), Suizhou (15).
Preprints 189242 g001
Figure 2. Antimicrobial susceptibility results of E. coli (n=148) isolates. (A) Antimicrobial resistance profiles of E. coli isolates to 17 agents. (B) Analysis of multidrug resistance. X-axis indicates multidrug resistance of the isolates to 17 agents. (Preprints 189242 i001 drug resistance rate; Preprints 189242 i002drug intermediation rate; Preprints 189242 i003 drug sensitivity rate).
Figure 2. Antimicrobial susceptibility results of E. coli (n=148) isolates. (A) Antimicrobial resistance profiles of E. coli isolates to 17 agents. (B) Analysis of multidrug resistance. X-axis indicates multidrug resistance of the isolates to 17 agents. (Preprints 189242 i001 drug resistance rate; Preprints 189242 i002drug intermediation rate; Preprints 189242 i003 drug sensitivity rate).
Preprints 189242 g002
Figure 3. Heatmap showing the percentage of pig farm E. coli isolates resistant to each of the antibiotics tested. The resistance rate of E. coli isolates to 17 agents. CXM, cefuroxime; CRO, ceftriaxone; CEP, cephalothin; CTX, cefotaxime; AMP, ampicillin; AMX, amoxicillin; MY, lincomycin; DOC, doxycycline; TET, tetracycline; KMC, kanamycin; CEN, gentamicin; AMK, amikacin; CIP, ciprofloxacin; ENO, enoxacin; LOM, lomefloxacin; AZM, azithromycin; SFN, sulfafurazole.
Figure 3. Heatmap showing the percentage of pig farm E. coli isolates resistant to each of the antibiotics tested. The resistance rate of E. coli isolates to 17 agents. CXM, cefuroxime; CRO, ceftriaxone; CEP, cephalothin; CTX, cefotaxime; AMP, ampicillin; AMX, amoxicillin; MY, lincomycin; DOC, doxycycline; TET, tetracycline; KMC, kanamycin; CEN, gentamicin; AMK, amikacin; CIP, ciprofloxacin; ENO, enoxacin; LOM, lomefloxacin; AZM, azithromycin; SFN, sulfafurazole.
Preprints 189242 g003
Figure 4. Detection rate of antibiotic resistance genes in E. coli isolates. (A) Heat map showing detected antimicrobial resistance genes carried by the isolates. Small rectangles marked in red and green represent positive and negative. (B) The bar graph showing numbers of positive strains for different detected antibiotic resistance genes. Antimicrobial resistance genes accounting for resistance to the same class of antibiotics are marked with bars in the same color. (C) Genetic compositions of extended-spectrum β-lactamase strains. Left column: multiple gene strains, Right column: single gene strains. (D) Genetic compositions of aminoglycoside-modifying enzyme strains. Left column: multiple gene strains, Right column: single gene strains.
Figure 4. Detection rate of antibiotic resistance genes in E. coli isolates. (A) Heat map showing detected antimicrobial resistance genes carried by the isolates. Small rectangles marked in red and green represent positive and negative. (B) The bar graph showing numbers of positive strains for different detected antibiotic resistance genes. Antimicrobial resistance genes accounting for resistance to the same class of antibiotics are marked with bars in the same color. (C) Genetic compositions of extended-spectrum β-lactamase strains. Left column: multiple gene strains, Right column: single gene strains. (D) Genetic compositions of aminoglycoside-modifying enzyme strains. Left column: multiple gene strains, Right column: single gene strains.
Preprints 189242 g004
Figure 5. Distribution and category of E. coli isolates positive for virulence-associated genes. (A) Heat map showing detected virulence genes carried by the isolates. Small rectangles marked in red and green represent positive and negative. (B) The bar graph showing numbers of positive strains for different detected virulence genes. (C) Genetic compositions of virulence-associated strains. Left column: multiple gene strains, Right column: single gene strains.
Figure 5. Distribution and category of E. coli isolates positive for virulence-associated genes. (A) Heat map showing detected virulence genes carried by the isolates. Small rectangles marked in red and green represent positive and negative. (B) The bar graph showing numbers of positive strains for different detected virulence genes. (C) Genetic compositions of virulence-associated strains. Left column: multiple gene strains, Right column: single gene strains.
Preprints 189242 g005
Figure 6. Dendrogram of multilocus sequence typing (MLST) profiles among the E. coli isolates.
Figure 6. Dendrogram of multilocus sequence typing (MLST) profiles among the E. coli isolates.
Preprints 189242 g006
Table 1. Primers used in this study to amplify E. coli drug resistance genes.
Table 1. Primers used in this study to amplify E. coli drug resistance genes.
Genes Primer sequence (5 ʹ -3 ʹ) Size of product (base pairs) Reference
blaDHA F: AACTTTCACAGGTGTGCTGT
R: CCGTACGCATACTGGCTTTC
387 Pai, Seo & Choi, 2007[60]
blaCMY-2 F: ATGATGAAAAAATCGTTATGC
R: TTGCAGCTTTTCAAGAATGCG
1143 Yan et al. 2004[61]
blaTEM F: ATAAAATTCTTGAAGACGAAA
R: GACAGTTACCAATGCTTAATC
1080 Weill et al. 2004[62]
blaSHV F: CACTCAAGGATGTATTGTG
R: TTAGCGTTGCCAGTGCTCG
885 Brinas et al. 2005[63]
blaCTX-M-1G F: CTTCCAGAATAAGGAATCCC
R: CGTCTAAGGCGATAAACAAA
949 Liu et al. 2007[64]
blaCTX-M-9G F: TGACCGTATTGGGAGTTTG
R: ACCAGTTACAGCCCTTCG
902 Liu et al. 2007[64]
blaOXA F: ATATCTCTACTGTTGCATCTCC
R: AAACCCTTCAAACCATCC
619 Colom et al. 2003[65]
aac(3′)-Ia F: TTACGCAGCAGCAACGATGT
R: GTTGGCCTCATGCTTGAGGA
402 Sun et al. 2012[66]
aac(3′)-IIc F: AACCGGTGACCTATTGATGG
R: TGTGCTGGCACGATCGGAGT
774 Sun et al. 2012[66]
aac(3′)-IV F: GGCCACTTGGACTGATCGAG
R: GCGGATGCAGGAAGATCAAC
609 Sun et al. 2012[66]
aac(6′)-Ib F: TTGCGATGCTCTATGAGTGGCTA
R: CTCGAATGCCTGGCGTGTTT
482 Park et al. 2006[67]
aadA1 F: AGGTAGTTGGCGTCATCGAG
R: CAGTCGGCAGCGACATCCTT
589 Sun et al. 2012[66]
aadA2 F: GGTGCTAAGCGTCATTGAGC
R: GCTTCAAGGTTTCCCTCAGC
470 Sun et al. 2012[66]
rmtA F: CTAGCGTCCATCCTTTCCTC
R: TTGCTTCCATGCCCTTGCC
635 Chen et al. 2004[68]
rmtB F: ACATCAACGATGCCCTCAC
R: AAGTTCTGTTCCGATGGTC
724 Chen et al. 2004[68]
mcr-1 F: CGGTCAGTCCGTTTGTTC
R: CTTGGTCGGTCTGTAGGG
309 Liu et al. 2016[53]
Table 2. Primers used in this study to amplify E. coli virulence-associated genes.
Table 2. Primers used in this study to amplify E. coli virulence-associated genes.
Virulence factors Primer sequence (5 ʹ -3 ʹ) Size of product (base pairs)
LT-1 F: TAGAGACCGGTATTACAGAAATCTGA 282
R: TCATCCCGAATTCTGTTATATATGTC
STa F: GGGTTGGCAATTTTTATTTCTGTA 183
R: ATTACAACAAAGTTCACAGCAGTA
STb F: ATGTAAATACCTACAACGGGTGAT 300
R: TATTTGGGCGCCAAAGCATGCTCC
EAST1 F: ATGCCATCAACACAGTATATC 117
R: TCAGGTCGCGAGTGACGG
irp2 F: AAGGATTCGCTGTTACCGGAC 301
R: TCGTCGGGCA GCGTTTCTTCT
fyuA F: TGATTAACCCCGCGACGGGAA 787
R: CGCAGTAGGCACGATGTTGTA
K88 F: GATGAAAAAGACTCTGATTGCA 841
R: GATTGCTACGTTCAGCGGAGCG
K99 F: CTGAAAAAAACACTGCTAGCTATT 543
R: CATATAAGTGACTAAGAAGGATGC
987P F: GTTACTGCCAGTCTATGCCAAGTG 463
R: TCGGTGTACCTGCTGAACGAATAG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.
Prerpints.org logo

Preprints.org is a free preprint server supported by MDPI in Basel, Switzerland.

Subscribe

Disclaimer

Terms of Use

Privacy Policy

Privacy Settings

© 2026 MDPI (Basel, Switzerland) unless otherwise stated