Submitted:
31 July 2025
Posted:
06 August 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Analysis of Colibactin Genes for Colon Cancer Patients
2.1.1. PCR Results of the Colon Tissue Specimens
2.1.2. Colibactin PCR Analysis for Single Colony Culture
2.1.3. Whole Genome Analysis
2.2. Analysis of H. Pylori Virulence Factors for Gastric Cancer Patients
3. Discussion
4. Materials and Methods
4.1. Sample Collection and Patient Cohort
4.2. Sample Preparation
4.2.1. Single Colony Streaking from Tissue Specimens
4.2.2. DNA/RNA Isolation from Tissue Specimens, Swab Samples and Bacterial Culture
4.3. Virulence Gene Screening for Cancer Patients
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| clb | Colibactin |
| SD | Standart Deviation |
| WGS | Whole Genome Sequencing |
| PCR | Polymerase Chain Reaction |
| CC | Colon Cancer |
| K | Colony |
| GN | Gastric Normal |
| GC | Gastric Cancer |
| GH | Gastric Healthy |
References
- Williams, G.H.; Stoeber, K. The Cell Cycle and Cancer. The Journal of Pathology 2012, 226, 352–364. [CrossRef]
- Glaviano A., Singh S.K., Lee E.H.C., Okina E., Lam H.Y., Carbone D., Reddy E.P., O’Connor M.J., Koff A., Singh G., Stebbing J., Sethi G., Crasta K.C., Diana P., Keyomarsi K., Yaffe M.B., Hunt K.K. Cell cycle dysregulation in cancer. Pharmacol. Rev. 2025, 77(2), 100030. [CrossRef]
- World Health Organization. Cancer. Available online: https://www.who.int/news-room/fact-sheets/detail/cancer (accessed on 30 July 2025).
- Byrne, S.; Boyle, T.; Ahmed, M.; Lee, S.H.; Benyamin, B.; Hyppönen, E. Lifestyle, Genetic Risk and Incidence of Cancer: A Prospective Cohort Study of 13 Cancer Types. International Journal of Epidemiology 2023, 52, 817–826. [CrossRef]
- Khan, N.; Afaq, F.; Mukhtar, H. Lifestyle as Risk Factor for Cancer: Evidence from Human Studies. Cancer Letters 2010, 293, 133–143. [CrossRef]
- Eser, S.; Örün, H.; Hamavioğlu, E.; Lofti, F. Cancer Incidence, Mortality and Survival in Türkiye as of 2020. bccr 2023. [CrossRef]
- Grady, W.M.; Carethers, J.M. Genomic and Epigenetic Instability in Colorectal Cancer Pathogenesis. Gastroenterology 2008, 135, 1079–1099. [CrossRef]
- Delgado J.M., Shepard L.W., Lamson S.W., Liu S.L., Shoemaker C.J.; The ER membrane protein complex restricts mitophagy by controlling BNIP3 turnover. Journal of Cellular Physiology 2024, 239(12), e31418. [CrossRef]
- Wu, C.-Y.; Ye, K. Risk Factors for the Prognosis of Colon Cancer. World J Gastrointest Oncol 2024, 16, 3738–3740. [CrossRef]
- Aggarwal, N.; Kitano, S.; Puah, G.R.Y.; Kittelmann, S.; Hwang, I.Y.; Chang, M.W. Microbiome and Human Health: Current Understanding, Engineering, and Enabling Technologies. Chem. Rev. 2023, 123, 31–72. [CrossRef]
- Hou, K.; Wu, Z.-X.; Chen, X.-Y.; Wang, J.-Q.; Zhang, D.; Xiao, C.; Zhu, D.; Koya, J.B.; Wei, L.; Li, J.; et al. Microbiota in Health and Diseases. Sig Transduct Target Ther 2022, 7, 135. [CrossRef]
- Ogunrinola, G.A.; Oyewale, J.O.; Oshamika, O.O.; Olasehinde, G.I. The Human Microbiome and Its Impacts on Health. International Journal of Microbiology 2020, 2020, 1–7. [CrossRef]
- Afzaal, M.; Saeed, F.; Shah, Y.A.; Hussain, M.; Rabail, R.; Socol, C.T.; Hassoun, A.; Pateiro, M.; Lorenzo, J.M.; Rusu, A.V.; et al. Human Gut Microbiota in Health and Disease: Unveiling the Relationship. Front. Microbiol. 2022, 13, 999001. [CrossRef]
- Kim, J.; Lee, H.K. Potential Role of the Gut Microbiome In Colorectal Cancer Progression. Front. Immunol. 2022, 12, 807648. [CrossRef]
- Wong C.C., Yu J. Gut microbiota in colorectal cancer development and therapy. Nat. Rev. Clin. Oncol. 2023, 20(7), 429–452. [CrossRef]
- Rebersek, M. Gut Microbiome and Its Role in Colorectal Cancer. BMC Cancer 2021, 21, 1325. [CrossRef]
- Clermont, O.; Christenson, J.K.; Denamur, E.; Gordon, D.M. The Clermont Escherichia coli phylo-typing method revisited: Improvement of specificity and detection of new phylo-groups. Environ. Microbiol. Rep. 2013, 5 (1), 58–65. [CrossRef]
- Martin, P.; Tronnet, S.; Garcie, C.; Oswald, E. Interplay between Siderophores and Colibactin Genotoxin in Escherichia Coli. IUBMB Life 2017, 69, 435–441. [CrossRef]
- Royer, G.; Clermont, O.; Marin, J.; Condamine, B.; Dion, S.; Blanquart, F.; Galardini, M.; Denamur, E. Epistatic Interactions between the High Pathogenicity Island and Other Iron Uptake Systems Shape Escherichia Coli Extra-Intestinal Virulence. Nat Commun 2023, 14, 3667. [CrossRef]
- Faïs, T.; Delmas, J.; Barnich, N.; Bonnet, R.; Dalmasso, G. Colibactin: More Than a New Bacterial Toxin. Toxins 2018, 10, 151. [CrossRef]
- Lv, C.; Abdullah, M.; Su, C.-L.; Chen, W.; Zhou, N.; Cheng, Z.; Chen, Y.; Li, M.; Simpson, K.W.; Elsaadi, A.; et al. Genomic Characterization of Escherichia Coli with a Polyketide Synthase (Pks) Island Isolated from Ulcerative Colitis Patients. BMC Genomics 2025, 26, 19. [CrossRef]
- Suresh, A.; Ranjan, A.; Jadhav, S.; Hussain, A.; Shaik, S.; Alam, M.; Baddam, R.; Wieler, L.H.; Ahmed, N. Molecular Genetic and Functional Analysis of Pks-Harboring, Extra-Intestinal Pathogenic Escherichia Coli From India. Front. Microbiol. 2018, 9, 2631. [CrossRef]
- Balskus, E.P. Colibactin: Understanding an Elusive Gut Bacterial Genotoxin. Nat. Prod. Rep. 2015, 32, 1534–1540. [CrossRef]
- Sadeghi, M.; Mestivier, D.; Sobhani, I. Contribution of Pks+ Escherichia Coli (E. Coli) to Colon Carcinogenesis. Microorganisms 2024, 12, 1111. [CrossRef]
- Zhang, G.; Sun, D. The Synthesis of the Novel Escherichia Coli Toxin—Colibactin and Its Mechanisms of Tumorigenesis of Colorectal Cancer. Front. Microbiol. 2024, 15, 1501973. [CrossRef]
- Yamaoka, Y.; Graham, D.Y. Helicobacter pylori virulence and cancer pathogenesis. Helicobacter 2021, 26(S1), e12771. [CrossRef]
- Jones, K.R.; Whitmire, J.M.; Merrell, D.S. A Tale of Two Toxins: Helicobacter Pylori CagA and VacA Modulate Host Pathways That Impact Disease. Front. Microbio. 2010, 1. [CrossRef]
- Link A, Langner C, Schirrmeister W, Habendorf W, Weigt J, Venerito M, Tammer I, Schlüter D, Schlaermann P, Meyer TF, Wex T, Malfertheiner P. Helicobacter pylori vacA genotype is a predominant determinant of immune response to Helicobacter pylori CagA. World J. Gastroenterol. 2017, 23(26), 4712–4723. [CrossRef]
- Johnson JR, Johnston B, Kuskowski MA, Nougayrède J P, Oswald É. Molecular epidemiology and phylogenetic distribution of the Escherichia coli pks genomic island. J Clin Microbiol. 2008, 46(12), 3906–3911. [CrossRef]
- Chen, J.; Griffiths, M.W. PCR differentiation of Escherichia coli from other Gram-negative bacteria using primers derived from the nucleotide sequences flanking the gene encoding the universal stress protein (uspA). Lett. Appl. Microbiol. 1998, 27 (6), 369–371. [CrossRef]
- Heijnen L., Medema G. Quantitative detection of Escherichia coli, E. coli O157, and other Shiga-toxin-producing E. coli in water using a combined culture and PCR method. J. Water Health 2006, 4(4), 487–498. https://pubmed.ncbi.nlm.nih.gov/17176819/.
- Godambe S.L., Bhowmik A.K., Hossain M.A., et al. Molecular detection and phylogenetic characterization of Escherichia coli isolates from Indian street foods using uspA and uidA primer sets. J. Microbiol. Biotechnol. Food Sci. 2017, 6 (Issue 1), 15–23. [CrossRef]
- Oktem Okullu, S.; Cekic Kipŗiţci, Z.; Kiliç, E.; Seymen, N.; Mansur Özen, N.; Sezerman, U.; Gurol, Y. Analysis of correlation between the seven important Helicobacter pylori virulence factors and drug resistance in patients with gastritis. Gastroenterology Research and Practice 2020, 2020, 3956838. [CrossRef]
- Akinduti, P.A.; Izevbigie, O.O.; Akinduti, O.A.; Enwose, E.O.; Amoo, E.O. Fecal Carriage of Colibactin-Encoding Escherichia Coli Associated With Colorectal Cancer Among a Student Populace. Open Forum Infectious Diseases 2024, 11, ofae106. [CrossRef]
- Tariq, H.; Noreen, Z.; Ahmad, A.; Khan, L.; Ali, M.; Malik, M.; Javed, A.; Rasheed, F.; Fatima, A.; Kocagoz, T.; et al. Colibactin Possessing E. Coli Isolates in Association with Colorectal Cancer and Their Genetic Diversity among Pakistani Population. PLoS ONE 2022, 17, e0262662. [CrossRef]
- Yalçın, S. Gastric cancer in Turkey—a bridge between West and East: epidemiology, histopathology, and survival data. Gastrointest. Cancer Res. 2009, 3 (1), 29–32. Available online: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2661126/.
- Liou, J.-M.; Malfertheiner, P.; Lee, Y.-C.; Sheu, B.-S.; Sugano, K.; Cheng, H.-C.; Yeoh, K.-G.; Hsu, P.-I.; Goh, K.-L.; Mahachai, V.; et al. Screening and Eradication of Helicobacter Pylori for Gastric Cancer Prevention: The Taipei Global Consensus. Gut 2020, 69, 2093–2112. [CrossRef]
- Xu, X.; Hu, Y.; Lv, N.; Eradication of Helicobacter Pylori Reduces Gastric Cancer Risk by Preventing Gastric Mucosal Atrophy and Intestinal Metaplasia. Cancer Screen Prev 2024, 3, 227–229. [CrossRef]
- Massip C.; Branchu P.; Bossuet Greif N.; Chagneau C.V.; Gaillard D.; Martin P., et al.; Deciphering the interplay between the genotoxic and probiotic activities of Escherichia coli Nissle 1917. PLoS Pathog. 2019, 15(9), e1008029. [CrossRef]
- Nougayrède J.P.; Chagneau C.V., et al.; Genotoxic activity of probiotic strain Escherichia coli Nissle 1917. mSphere 2021, 6(4), e00624 21. [CrossRef]
- Falzone L.; Lavoro A.; Candido S.; Salmeri M.; Zanghì A.; Libra M.; Benefits and concerns of probiotics: an overview of the potential genotoxicity of the colibactin-producing Escherichia coli Nissle 1917 strain. Gut Microbes 2024, 16(1), 2397874. [CrossRef]
- Lv, C.; Abdullah, M.; Su, C.-L.; Chen, W.; Zhou, N.; Cheng, Z.; Chen, Y.; Li, M.; Simpson, K.W.; Elsaadi, A.; et al. Genomic Characterization of Escherichia Coli with a Polyketide Synthase (Pks) Island Isolated from Ulcerative Colitis Patients. BMC Genomics 2025, 26, 19. [CrossRef]
- Sonnenborn U.; Escherichia coli Nissle 1917 from bench to bedside and back: history of a special E. coli strain with probiotic properties. FEMS Microbiol. Lett. 2016, 363(19), fnw212.
- Bourgieux, A.; Deneys, V.; Maji, J. Citrobacter spp. are Gram-negative bacilli in the Enterobacteriaceae family, ferment glucose, and grow well on selective enteric media. ScienceDirect Topics (2025).
- Kostic A.D.; Gevers D.; et al. Association of Fusobacterium nucleatum in colorectal carcinoma and its clinical implications. Oncology 2019, 12(3), 368. [CrossRef]
- Vaqueiro P.; et al. Intratumoural pks+ E. coli as a risk factor for metachronous colorectal cancer in Lynch syndrome patients. EBioMedicine 2025, 58, 103421. [CrossRef]
- Jabeen, I.; Islam, S.; Hassan, A.K.M.I.; Tasnim, Z.; Shuvo, S.R. A Brief Insight into Citrobacter Species - a Growing Threat to Public Health. Front. Antibiot. 2023, 2, 1276982. [CrossRef]


| Samples | clbA | clbB | clbN | clbQ |
|---|---|---|---|---|
| CC1 | + | + | + | - |
| CC2 | - | - | + | - |
| CC3 | - | - | - | - |
| CC4 | - | - | - | - |
| CC5 | - | - | - | - |
| CC6 | - | - | - | - |
| CC7 | - | - | - | - |
| CC8 | - | - | - | - |
| CC9 | - | - | - | - |
| CC10 | + | + | + | + |
| CC11 | - | - | - | - |
| CC12 | - | - | - | - |
| CC13 | - | - | - | - |
| CC14 | - | - | - | - |
| CC15 | - | - | - | - |
| CC16 | - | - | - | - |
| CC17 | - | - | - | - |
| CC18 | - | - | - | - |
| CC19 | + | + | + | + |
| Genes | Location |
|---|---|
| csgA | 127706-128164 |
| csgB | 128205-128687 |
| csgC | 127317-127649 |
| csgF | 130477-130893 |
| csgG | 130920-131753 |
| fimD | 134318-136423 |
| fmlA | 137535-138146 |
| Ag43 | 60497-60685 |
| bolA | 207039-207356 |
| luxS | 667797-668312 |
| Genes | Location |
|---|---|
| vexA | 993.552-994463 |
| vexB | 994473-994844 |
| vexC | 995294-995989 |
| tviB | 986775-987269 |
| tviE | 991924-993351 |
| fimA | 3697775-3698353 |
| fimI | 367164-3697697 |
| fimC | 3696430-3697122 |
| fimH | 3692795-3693646 |
| csgA | 3138108-3138-557 |
| csgE | 3140439-3140855 |
| csgG | 3141318-3142151 |
| Sample | ureA | ureB | dupA | hpaA | napA | cagA | vacA(s1s2) |
|---|---|---|---|---|---|---|---|
| GH1 | - | - | - | - | - | ||
| GH2 | - | - | - | - | - | ||
| GH3 | + | + | + | + | + | + | + |
| GH4 | - | - | - | - | - | ||
| GH5 | - | - | - | - | - | ||
| GH6 | - | - | - | - | - | ||
| GH7 | - | - | - | - | - | ||
| GH8 | - | - | - | - | - | ||
| GH9 | - | - | - | - | - | ||
| GC1 | + | + | - | + | + | + | + |
| GC2 | - | - | - | + | + | + | + |
| GC3 | - | - | - | + | + | ||
| GC4 | - | - | - | - | - |
| Primer Name | Forward Sequence (5’-3’) | Reverse Sequence (5’-3’) | Product Size (bp) | Reference |
|---|---|---|---|---|
| clbA (E. coli) | CTAGATTATCCGTGGCGATTC | CAGATACACAGATACCATTCA | 1002 | [29] |
| clbB (E. coli) | GATTTGGATACTGGCGATAACCG | CCATTTCCCGTTTGAGCACAC | 579 | [29] |
| clbN (E. coli) | GTTTTGCTCGCCAGATAGTCATTC | CAGTTCGGGTATGTGTGGAAGG | 733 | [29] |
| clbQ (E. coli) | CTTGTATAGTTACACAACTATTTC | TTATCCTGTTAGCTTTCGTTC | 821 | [29] |
| uspA (E. coli) | CCGATACGCTGCCAATCAGT | ACGCAGACCGTAGGCCAGAT | 884 | [30] |
| uidA (E. coli) | TATGGAATTTCGCCGATTTT | TGTTTGCCTCCCTGCTGCGG | 166 | [31,32] |
| ureA (H. pylori) | TGATGGGACCAACTCGTAACCGT | CGCAATGTCTAAGCGTTTGCCGAA | 244 | [33] |
| ureB (H. pylori) | AGTAGCCCGGTGAACACAACATCCT | ATGCCTTTGTCATAAGCCGCTTGG | 645 | [33] |
| dupA (H. pylori) | TGAGCGTGGTAGCTCTTGAC | GAGCGCGTTAGCGATATAGG | 584 | [33] |
| hpaA (H. pylori) | TAGTGGGATGCAGCCCGCATATTA | CGCTATGGCTTGAATGGGTGGTTT | 534 | [33] |
| napA (H. pylori) | GAATGTGAAAGGCACCGATT | ATCGTCCGCATAAGTTACGG | 304 | [33] |
| cagA (H. pylori) | AGAGCAAGCGTTAGCGATCTCAA | TTTCCCTACACCACCCAAACCACT | 415 | [33] |
| vacAs1s2 (H. pylori) | ATGGAAATACAACAAACACAC | CTGCTTGAATGCGCCAAAC | 259/286 | [33] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).