Submitted:
23 July 2025
Posted:
23 July 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Host Species Identification
2.3. Sample Processing and Pooling Strategy
2.4. Tick Surface Decontamination and Homogenization
2.5. Nucleic Acid Extraction
2.6. Molecular Detection of Pathogens
2.7. Bacterial Culture and Identification
2.8. Phylogenetic and Data Analysis
3. Results
3.1. Sample Collection and Host Identification
3.2. Pathogen Prevalence
3.3. Supplementary Culture-Based Findings
3.4. Phylogenetic Analysis of Detected Pathogens


4. Discussion
5. Conclusion
Funding
Institutional Review Board Statement
Data Availability Statement
Declaration of Competing Interest
Ethics and Consent to Participate declarations
References
- Zhao, G.P.; Wang, Y.X.; Fan, Z.W.; Ji, Y.; Liu, M.; Zhang, W.H.; Li, X.L.; Zhou, S.X.; Li, H.; Liang, S.; et al. Mapping Ticks and Tick-Borne Pathogens in China. Nat. Commun. 2021, 12, 1075. [Google Scholar] [CrossRef]
- Zhao, L.; Li, J.; Cui, X.; Jia, N.; Wei, J.; Xia, L.; Wang, H.; Zhou, Y.; Wang, Q.; Liu, X.; et al. Distribution of Haemaphysalis Longicornis and Associated Pathogens: Analysis of Pooled Data from a China Field Survey and Global Published Data. Lancet Planet. Health 2020, 4, e320–e329. [Google Scholar] [CrossRef]
- Beard, C.B.; Occi, J.; Bonilla, D.L.; Egizi, A.M.; Fonseca, D.M.; Mertins, J.W.; Backenson, B.P.; Bajwa, W.I.; Barbarin, A.M.; Bertone, M.A.; et al. Multistate Infestation with the Exotic Disease–Vector Tick Haemaphysalis Longicornis — United States, August 2017–September 2018. MMWR Morb. Mortal. Wkly. Rep. 2018, 67, 1310–1313. [Google Scholar] [CrossRef] [PubMed]
- Rainey, T.; Occi, J.L.; Robbins, R.G.; Egizi, A. Discovery of Haemaphysalis Longicornis (Ixodida: Ixodidae) Parasitizing a Sheep in New Jersey, United States. J. Med. Entomol. 2018, 55, 757–759. [Google Scholar] [CrossRef] [PubMed]
- Teng, Z.; Gong, P.; Wang, W.; Zhao, N.; Jin, X.; Sun, X.; Lu, J.; Lin, X.; Zhou, H.; Wen, B.; et al. The increasing prevalence of Japanese spotted fever in China: A dominant rickettsial threat. J. Infect. 2024, 90, 106387. [Google Scholar] [CrossRef] [PubMed]
- Kasama, K.; Fujita, H.; Yamamoto, S.; Ooka, T.; Gotoh, Y.; Ogura, Y.; Ando, S.; Hayashi, T. Genomic Features of Rickettsia Heilongjiangensis Revealed by Intraspecies Comparison and Detailed Comparison With Rickettsia Japonica. Front. Microbiol. 2019, 10, 2787. [Google Scholar] [CrossRef]
- Sun, Y.; Liu, G.; Lin, H.; Wang, X.; Liu, W.; Wang, T.; Liu, H.; Wang, Y.; Wu, A.; Wang, Y.; et al. The ecological study of Daurian ground squirrel (Spermophilus dauricus) in the agricultural ecosystem of northern China. Acta Theriol. Sin. 2012, 32, 248–253. [Google Scholar]
- Wu, D.L.; Li, C.; Bai, Q.M.; Li, Y.J.; Zhang, Y.Z.; Yang, H.Y.; He, J.Y.; Yan, Y.F.; Hai, R.; Yu, X.J. Plague surveillance in Spermophilus dauricus in Inner Mongolia, China. Vector Borne Zoonotic Dis. 2013, 13, 197–200. [Google Scholar]
- Carey, H.V.; Walters, W.A.; Knight, R. Seasonal restructuring of the ground squirrel gut microbiota over the annual hibernation cycle. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2013, 304, R33–R42. [Google Scholar] [CrossRef]
- Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Mar. Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
- Moutailler, S.; Popovici, I.; Devillers, E.; Vayssier-Taussat, M.; Eloit, M.; Ferte, H. Diversity of the tick-associated bacterial communities: impact of the sterilization method. Ticks Tick-Borne Dis. 2016, 7, 140–150. [Google Scholar] [CrossRef]
- Binetruy, F.; Buysse, M.; Lejal, E.; Koadima, O.; Diancourt, L.; Santos, A.; Rose, T.; Durand, P.; Mediannikov, O.; Paddock, C.D.; et al. Ticks (Acari: Ixodida) of the genus Amblyomma, vectors of Rickettsia species in the French Antilles. PLoS Negl. Trop. Dis. 2019, 13, e0007424. [Google Scholar] [CrossRef]
- Sprong, H.; Fonville, M.; van Leeuwen, A.D.; van der-Lelie, D.; van Wieren, S.E.; Gort, G.; Takken, W.; Heyman, P.; van-Vliet, A.J.H. Ticks and tick-borne pathogens in the expanding range of wild boar (Sus scrofa) in the Netherlands. Vector Borne Zoonotic Dis. 2014, 14, 640–647. [Google Scholar] [CrossRef]
- Wen, H.-L.; Zhao, L.; Zhai, S.; Chi, Y.; Cui, F.; Wang, D.; Wang, L.; Wang, Z.; Wang, Q.; Zhang, S.; et al. Severe Fever with Thrombocytopenia Syndrome, Shandong Province, China, 2011. Emerg. Infect. Dis. 2014, 20, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [PubMed]
- Srinivasan, R.; Karaoz, U.; Volegova, M.; MacKichan, J.; Kato-Maeda, M.; Miller, S.; Lynch, K. Use of 16S rRNA Gene for Identification of a Broad Range of Clinically Relevant Bacterial Pathogens. PLoS ONE 2015, 10, e0117617. [Google Scholar] [CrossRef]
- Lv, J.Z.; Wu, S.Q.; Zhang, Y.N.; Chen, Y.; Feng, C.Y.; Yuan, X.F.; Jia, G.L.; Deng, J.H.; Wang, C.X.; Wang, Q.; et al. Assessment of four DNA fragments (COI, 16S rDNA, ITS2, 12S rDNA) for species identification of the Ixodida (Acari: Ixodida). Parasit. Vectors 2014, 7, 93. [Google Scholar] [CrossRef]
- Borsoi, A.B.P.; Bitencourth, K.; De Oliveira, S.V.; Amorim, M.; Gazêta, G.S. Human Parasitism by Amblyomma Parkeri Ticks Infected with Candidatus Rickettsia Paranaensis, Brazil. Emerg. Infect. Dis. 2019, 25, 2339–2341. [Google Scholar] [CrossRef]
- Li, H.; Zhang, P.H.; Huang, Y.; Du, J.; Cui, N.; Yang, Z.D.; Tang, F.; Fu, F.X.; Li, X.M.; Cui, X.M.; et al. Isolation and Identification of Rickettsia Raoultii in Human Cases: A Surveillance Study in 3 Medical Centers in China. Clin. Infect. Dis. 2018, 66, 1109–1115. [Google Scholar] [CrossRef]
- Noh, Y.; Lee, Y.S.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Jiang, J.; Richards, A.L.; Lee, H.K.; Kim, S.Y. Molecular Detection of Rickettsia Species in Ticks Collected from the Southwestern Provinces of the Republic of Korea. Parasit. Vectors 2017, 10, 20. [Google Scholar] [CrossRef]
- Jiang, J.; An, H.; Lee, J.S.; O’Guinn, M.L.; Kim, H.C.; Chong, S.T.; Zhang, Y.; Song, D.; Burrus, R.G.; Bao, Y.; et al. Molecular Characterization of Haemaphysalis Longicornis-Borne Rickettsiae, Republic of Korea and China. Ticks Tick Borne Dis. 2018, 9, 1606–1613. [Google Scholar] [CrossRef]
- Duron, O.; Noël, V.; McCoy, K.D.; Bonazzi, M.; Sidi-Boumedine, K.; Morel, O.; Vavre, F.; Zenner, L.; Jourdain, E.; Durand, P.; et al. The Recent Evolution of a Maternally-Inherited Endosymbiont of Ticks Led to the Emergence of the Q Fever Pathogen, Coxiella Burnetii. PLoS Pathog. 2015, 11, e1004892. [Google Scholar] [CrossRef] [PubMed]
- Pascale, M.R.; Salaris, S.; Mazzotta, M.; Girolamini, L.; Fregni Serpini, G.; Manni, L.; Grottola, A.; Cristino, S. New Insight Regarding Legionella Non-Pneumophila Species Identification: Comparison between the Traditional Mip Gene Classification Scheme and a Newly Proposed Scheme Targeting the rpoB Gene. Microbiol. Spectr. 2021, 9, e01161-21. [Google Scholar] [CrossRef] [PubMed]
- Gaia, V.; Fry, N.K.; Harrison, T.G.; Peduzzi, R. Sequence-Based Typing of Legionella pneumophila Serogroup 1 Offers the Potential for True Portability in Legionellosis Outbreak Investigation. J. Clin. Microbiol. 2003, 41, 2932–2939. [Google Scholar] [CrossRef]
- He, M.; Zhang, L.; Hu, H.; Liu, X.; Zhang, C.; Xin, Y.; Liu, B.; Chen, Z.; Xu, K.; Liu, Y. Genetic and Phylogenetic Characterization of Spotted Fever Group Rickettsiae in Ticks from Jiangsu Province, Eastern China. Front. Cell. Infect. Microbiol. 2022, 12, 954785. [Google Scholar] [CrossRef]
- Zhang, X.; Lv, W.; Teng, Z.; Zhao, N.; Zhou, Y.; Ma, D.; Ma, L.; Cheng, Y.; Wei, J.; He, J.; et al. Molecular Detection of Rickettsiales and a Potential Novel Ehrlichia Species Closely Related to Ehrlichia Chaffeensis in Ticks (Acari: Ixodidae) from Shaanxi Province, China, in 2022 to 2023. Front. Microbiol. 2023, 14, 1331434. [Google Scholar] [CrossRef]
- He, M.; Zhang, L.; Hu, H.; Liu, X.; Zhang, C.; Xin, Y.; Liu, B.; Chen, Z.; Xu, K.; Liu, Y. Complete Genome Sequencing and Comparative Genomic Analyses of a New Spotted-Fever Rickettsia Heilongjiangensis Strain B8. Emerg. Microbes Infect. 2023, 12, 2153085. [Google Scholar] [CrossRef]
- Duan, C.; Zhang, J.; Wang, Y.; Wen, B. Complete Genome Sequence of Rickettsia heilongjiangensis. J. Bacteriol. 2011, 193, 4284–4285. [Google Scholar] [CrossRef]
- Li, J.; Liu, W.; Jia, Z.; Wang, X.; Huo, Q.; Wang, Y.; Liu, Q. A meta-analysis of the prevalence of spotted fever group rickettsiae in ticks in China. PLoS Negl. Trop. Dis. 2024, 18, e0012550. [Google Scholar] [CrossRef]
- Lu, M.; Meng, C.; Zhang, B.; Wang, X.; Tian, J.H.; Tang, G.P.; Wang, W.; Li, N.; Li, M.Y.; Xu, X.Y.; et al. High Diversity and Prevalence of Rickettsial Agents in Rhipicephalus microplus Ticks from Livestock in Karst Landscapes of Southwest China. Microorganisms 2024, 12, 1135. [Google Scholar] [CrossRef]
- Rowbotham, T.J. Preliminary Report on the Pathogenicity of Legionella Pneumophila for Freshwater and Soil Amoebae. J. Clin. Pathol. 1980, 33, 1179–1183. [Google Scholar] [CrossRef] [PubMed]
- Blatt, S.P.; Parkinson, M.D.; Pace, E.; Hoffman, P.; Dolan, D.; Lauderdale, P.; Zajac, R.A.; Melcher, G.P. Nosocomial Legionnaires’ Disease: Aspiration as a Primary Mode of Disease Acquisition. Am. J. Med. 1993, 95, 16–22. [Google Scholar] [CrossRef]
- Fields, B.S. The molecular ecology of legionellae. Trends Microbiol. 1996, 4, 286–290. [Google Scholar] [CrossRef]
- Abu Kwaik, Y.; Gao, L.Y.; Stone, B.J.; Venkataraman, C.; Harb, O.S. Invasion of Protozoa by Legionella Pneumophila and Its Role in Bacterial Ecology and Pathogenesis. Appl. Environ. Microbiol. 1998, 64, 3127–3133. [Google Scholar] [CrossRef] [PubMed]
- Fields, B.S.; Benson, R.F.; Besser, R.E. Legionella and Legionnaires' Disease: 25 Years of Investigation. Clin. Microbiol. Rev. 2002, 15, 506–526. [Google Scholar] [CrossRef] [PubMed]
- Winn, W.C., Jr. Legionella and the Clinical Microbiologist. Infect. Control 1986, 7, 195–203. [Google Scholar] [CrossRef]
- Baskerville, A.; Fitzgeorge, R.B.; Broster, M.; Hambleton, P.; Dennis, P.J. Experimental Transmission of Legionnaires' Disease by Aerosol Infection in Guinea-Pigs. J. Hyg. 1978, 80, 389–400. [Google Scholar]
- Winn, W.C., Jr.; Glavin, F.L.; Vogl, D.P.; Jones, G.L.; Beaty, H.N. The Pathology of Legionnaires' Disease. Fourteen Fatal Cases from the 1977 Outbreak in Vermont. Arch. Pathol. Lab. Med. 1979, 103, 269–273. [Google Scholar]
- Fraser, D.W.; Tsai, T.R.; Orenstein, W.; Parkin, W.E.; Beecham, H.J.; Sharrar, R.G.; Harris, J.; Mallison, G.F.; Martin, S.M.; McDade, J.E.; et al. Legionnaires' Disease: Description of an Epidemic of Pneumonia. N. Engl. J. Med. 1977, 297, 1189–1197. [Google Scholar] [CrossRef]
- van Heijnsbergen, E.; Schalk, J.A.C.; Euser, S.M.; Brandsema, P.S.; den Boer, J.W.; de Roda Husman, A.M. Confirmed and Potential Sources of Legionella Reviewed. Environ. Sci. Technol. 2015, 49, 4797–4815. [Google Scholar] [CrossRef]
- Centers for Disease Control and Prevention (CDC). Legionellosis Associated with Potting Soil---California, Oregon, and Washington, May--June 2000. MMWR Morb. Mortal. Wkly. Rep. 2000, 49, 777–778. [Google Scholar]
- NSW Health. Stay safe from legionnaires' disease when gardening. Available online: https://www.health.nsw.gov.au/news/Pages/20221126_00.aspx (accessed on 21 July 2025).
- Casati, S.; Gioria-Guscio, M.; Gaia, V.; Tonolla, M.; Peduzzi, R. Legionella spp. and Free-Living Amoebae in Composts from a Wide Variety of Sources. PLoS ONE 2013, 8, e75587. [Google Scholar] [CrossRef]



| Organism | Gene Target | Primer Name | Sequence (5'-3') | PCR Type | Amplicon (bp) | Reference |
|---|---|---|---|---|---|---|
| Dabie bandavirus (SFTSV) | S segment | S-F1/S-R1 | CAGCCACTTTACCCGAACAT / GGAAAGACGCAAAGGAGTGA | Conv. | 679 | [14] |
| S-F2/S-R2 | CTGGTCTCTGCCCTCTCAAC / GGATTGCAGTGGAGTTTGGTG | Nested | 560 | |||
| Universal Bacteria | 16S rRNA | 27F/1492R | AGAGTTTGATCMTGGCTCAG / GGTTACCTTGTTACGACTT | Nested | ~1500 | [17] |
| Rickettsia spp. | rrs (16S rRNA) | rrs-F/rrs-R | YTACGGAATAACTTTTAGAAA / CATGATGACTTGACRTCGT | Nested | ~900 | [18] |
| gltA | Ric-glt-F/Ric-glt-R | ACTTAYGAYCCGGGCTTTAT / AGCTGTCTAGGTCTGCTGATT | Nested | ~1100 | [19] | |
| 17kDa | R-17kD-F/R-17kD-R | GCTCTTGCAACTTCTATGTT / CATTGTTCGTCAGGTTGGCG | Nested | ~434 | [19] | |
| ompA | R-ompA-F/R-ompA-R | ATGGCGAATATTTCTCCAAAA / AGTGCAGCATTCGCTCCCCCT | Nested | ~862 | [20] | |
| ompB | R-ompB-F/R-ompB-R | GTAACCGGAAGTAATCGTTTCGTAA / CTTTATAACCAGCTAAACCACC | Nested | ~769 | [18] | |
| sca4 | Ric-sca4-F/Ric-sca4-R | ATGAGTAAAGACGGTAACCT / AAGCTATTGCGTCATCTCCG | Nested | ~928 | [21] | |
| Coxiella-like Endosymbiont (CLE) | 16S rRNA | Cox-F/Cox-R | ACTYYCCAACAGCTAGTTCTCA / GTAGGAATCTACCTTRTAGWGG | Nested | ~600 | [22] |
| groEL | Cox-gro-F/Cox-gro-R | CTCAAGTCCCGAACCATCT / AGCCAACGCAGTCAAAGTA | Nested | ~494 | [22] | |
| rpoB | Cox-rpo-F/Cox-rpo-R | TTTCTCCTTTCGGTGTTAC / GATGCTTCACGGATTGTTA | Nested | ~496 | [22] | |
| Legionella spp. | mip | L-mip-F/L-mip-R | GCTGCAACCGATGCCAC / CATATGCAAGACCTGAGGGAAC | Nested | ~542 | [23] |
| groEL | L-gro-F/L-gro-R | TGCTGCAGTAGAAGAAGG / GTTGGATCAAGAATACC | Nested | ~763 | [24] | |
| Tick/Rodent Host | COI | LCO1490/HCO2198 | GGTCAACAAATCATAAAGATATTGG / TAAACTTCAGGGTGACCAAAAAATCA | Nested | ~650 | [17] |
| Pathogen | Host | Location | No. Positive Pools/Samples | Total Ticks/Samples | Prevalence (%) |
|---|---|---|---|---|---|
| SFGR | |||||
| Ca. R. jingxinensis | H. longicornis | Liaoning | 12 | 1004 (in 594 pools) | 2.0 (MIR) |
| R. heilongjiangensis | H. longicornis | Anhui | 2 | 122 (in 76 pools) | 2.6 (MIR) |
| Endosymbiont | |||||
| Coxiella-like Endosymbiont (CLE) | H. longicornis | Liaoning | 7 | 1004 (in 594 pools) | 1.2 (MIR) |
| H. longicornis | Anhui | 13 | 122 (in 76 pools) | 17.1 (MIR) | |
| Other Bacteria | |||||
| L. pneumophila | S. dauricus | Heilongjiang | 2 | 42 | 4.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).