Submitted:
15 July 2025
Posted:
16 July 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. Methods
2.2.1. SELEX Procedure
Preparation and Denaturation of Aptamer Library
Target Binding and Washing
Elution and Amplification
Asymmetric PCR and Iterative Selection
2.3. Cloning and Sequence Analysis
2.4. Docking and Structure Modeling
2.5. Synthesis and Characterization of AuNPs
2.7. Fabrication of LFIA
2.8. Sample Detection Procedure
3. Results and Discussion
3.1. Aptamer Enrichment and Characterization
3.2. Aptamer–AuNP Conjugation and Optimization
3.3. Performance of the Hybrid LFIA Strip
3.4. Specificity Evaluation
3.5. Advantages and Perspectives of Aptamer-Based LFIA
4. Conclusions
Supplementary Materials
Acknowledgments
References
- Balcht Aldona & Smith Raymond. Pseudomonas Aeruginosa: Infections and Treatment. Informa Health Care 1994. 83–84. ISBN 0-8247-9210-6.
- Archana Vishwakarma, Yogesan Meganathan & Mohandass Ramya. Aptamer-based assay for rapid detection, surveillance, and screening of pathogenic Leptospira in water samples, Scientific Reports 2023, 13:13379. [CrossRef]
- Ellington, A.D. , Szostak J.W., In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [PubMed]
- Alariqi R., Almansoob S., Senan A. M., Raj,A. K., Shah R., Shrewastwa M. K., & Kumal, J. P. P., Pseudomonas aeruginosa and related antibiotic resistance genes as indicators for wastewater treatment. Heliyon 2024, 10(9). [CrossRef]
- Gold Larry, “SELEX: How It Happened and Where It will Go”. Journal of Molecular Evolution 2015, 81 (5–6): 140–143. [CrossRef]
- Craig Tuerk, Gold Larry, Systematic Evolution of Ligands by Exponential Enrichment: RNA Ligands to Bacteriophage T4 DNA Polymerase. Science 1990, (249), N0 4968: 505-510. [CrossRef]
- Min Young Song, Dung Nguyen, Seok Won Hong, Byoung Chan Kim, Broadly reactive aptamers targeting bacteria belonging to different genera using a sequential toggle cell-SELEX, Scientific reports 2017, (7), 43641. [CrossRef]
- Li R. S.; Liu H.; Chen B. B.; Zhang H. Z.; Huang C. Z.; Wang J., Stable gold nanoparticles as a novel peroxidase mimic for colorimetric detection of cysteine. Analytical Methods, 2016, 8 (11), 2494–2501. [CrossRef]
- Kerpedjiev P., Hammer S., Hofacker I.L., Forna (force-directed RNA): Simple and effective online RNA secondary structure diagrams. Bioinformatics 2015, 31(20): 3377-9). [CrossRef]
- Iman Jeddi, Leonor Saiz, Three-dimensional modeling of single stranded DNA hairpins for aptamer-based biosensors. Scientific Report 2017, (7), 1178. [CrossRef]
- Yumeng Yan, Huanyu Tao, Jiahua He & Sheng-You Huang, The HDOCK server for integrated protein–protein docking, Nature Protocol 2020, 15, 1829–1852.
- The HDOCK server: http://hdock.phys.hust.edu.
- Thu Thao Pham Thien-Kim Le Nguyen, T. T Huyen, Nam Luyen Van, Tin Phan Nguy, Dai Lam Tran, Lien Truong T N, Staining-Enhanced Peroxidase-Mimicking Gold Nanoparticles in NanoELISA for Highly Sensitive Detection of Klebsiella pneumoniae. ACS omega 2023, 8.51, 8.51,49211–49217. [Google Scholar] [CrossRef]
- Abdulelah A Alrashoudi, Hamed I Albalawi, Ali H Aldoukhi, Manola Moretti, Panayiotis Bilalis, Malak Abedalthagafi, Charlotte A E Hauser, Fabrication of a Lateral Flow Assay for Rapid In-Field Detection of COVID-19 Antibodies Using Additive Manufacturing Printing Technologies, International Journal of Bioprinting 2021, 7(4), 399. [CrossRef]
- Ronny Lorenz, Stephan H. Bernhart, Christian Höner zu Siederdissen, Hakim Tafer, Christoph Flamm, Peter F. Stadler, and Ivo L. Hofacker, ViennaRNA package 2.0. Algorithms for Molecular Biology 2021, 6(1), 26. [CrossRef]
- Rudi Liu, Dr. Jiuxing Li, Prof. Dr. Bruno J. Salena, Prof. Dr. Yingfu Li (2024). Aptamer and DNAzyme Based Colorimetric Biosensors for Pathogen Detection. Angewandte Chemie International Edition, Volume 64, Issue 4. [CrossRef]
- Xuan Ding, Chao Xu, Bin Zheng, Hanyang Yu and Peng Zheng (2024). Molecular Mechanism of Interaction between DNA Aptamer and Receptor-Binding Domain of Severe Acute Respiratory Syndrome Coronavirus 2 Variants Revealed by Steered Molecular Dynamics Simulations, Molecules, 29, 2215. [CrossRef]
- Hong Li Zhang, Cong Lv, Zi Hua Li, Song Jiang, Dan Cai, Shao Song Liu, Ting Wang, Kun He Zhang, Analysis of aptamer-target binding and molecular mechanisms by thermofluorimetric analysis and molecular dynamics simulation, Frontiers in Chemistry 2023, 11:1144347. [CrossRef]
- Alexander Eisold, Dirk Labudde, Detailed Analysis of 17β-Estradiol-Aptamer Interactions: A Molecular Dynamics Simulation Study, Molecules 2018: 23(7), 1690. [CrossRef]
- Alan Fernando Rodríguez Serrano I-Ming Hsing, Prediction of Aptamer-Small-Molecule Interactions Using Metastable States from Multiple Independent Molecular Dynamics Simulations, Journal of Chemical Information and Modeling 2022, 62(19), 4799-4809. [CrossRef]
- Sullenger A.B, Gallardo H.F., Ungers G.E., Gilboa E., Overexpression of TAR sequences renders cells resistant to human immunodeficiency virus replication. Cell 1990, 63 (3) 601-608). [CrossRef]
- Kolm, C., Cervenka, I., Aschl, U.J. et al. DNA aptamers against bacterial cells can be efficiently selected by a SELEX process using state-of-the art qPCR and ultra-deep sequencing. Scientific Repots 2020, 10, 20917. [CrossRef]
- Duong Tuan Bao, Do Thi Hoang Kim, Hyun Park, Bui Thi Cuc et al., Rapid Detection of Avian Influenza Virus by Fluorescent Diagnostic Assay using an Epitope-Derived Peptide. Theranostics 2017. 10; 7(7): 1835-1846. [CrossRef]







| Apt name | Aptamer DNA sequence |
Docking score |
MFE (kcal/mol) |
Frequency (%) | Diversity score |
Predicted Secondary Structure (2D) Based on MFE Model |
Predicted Tertiary Structure (3D) Based on MFE Model |
|
| T1 | ATCCGTCACACCTGCTCTGTAAACACCTACGGTCTTAGCATACGGTATAAGCCGTAACCGGTTTTACCTAAACTGGTGTTGGCTCCCGTAT |
-453.85 |
-27.10 |
24.98 | 4.64 | ![]() |
![]() |
|
| T2 | ATCCGTCACACCTGCTCTCAAAGGTCATAGGGGCTTCTTGGCAGCGTAATGCCTTGCTCGCATTTTTCCCTCATGGTGTTGGCTCCCGTAT |
-366.23 |
-22,11 |
3.82 | 28.74 | ![]() |
![]() |
|
| T3 | ATCCGTCACACCTGCTCTCATCATGCCCGCGTTCTAATAACTGCTATATCCTTTATCGCCTCTATCCCTCCGTTGGTGTTGGCTCCCGTAT |
-409.72 |
-12.20 |
8.83 | 13.74 | ![]() |
![]() |
|
| T4 | ATCCGTCACACCTGCTCTGAGACTAGCAGTTTTTAACCAGAGTAAATAACTCCCCTCTTCCTAAAATTTCCCCTGGTGTTGGCTCCCGTAT |
-427.08 |
-15.86 |
21.23 |
8.54 |
![]() |
![]() |
|
| T5 | ATCCGTCACACCTGCTCTCGGTGGTCAGCATCTCACTTGCCTTCTGTCCTGACCTATCCATCCCTCGTCGTCATGGTGTTGGCTCCCGTAT |
-373.65 |
-18.11 |
1.15 | 19.52 | ![]() |
![]() |
|
| T6 | ATCCGTCACACCTGCTCTCAGTATACACCCGTTCTCCGTCTGGTCTACAGTCCCCCGGCTGAGCCCCTATTCGTGGTGTTGGCTCCCGTAT |
-378.06 |
-18,83 |
5.12 | 22.07 | ![]() |
![]() |
|
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).











