Submitted:
21 June 2025
Posted:
23 June 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
Study Design, Duration and Setting
Study Population and Data Collection
Recovery of Bacteria Isolates, Autoclaving and PCR Amplification
PCR Amplification and Detection of ESBL Genes
Quality Control
3. Results
Viability and Stability Status of Bacteria and ARG’s After Autoclaving

4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| AMR | Antimicrobial Resistance |
| ARGs | Antimicrobial Resistance Genes |
| CTX-M | Cefotaxime-Munich |
| CUHAS | Catholic University of Health and Allied Sciences |
| DNA | Deoxyribonucleic Acid |
| ESBL | Extended Spectrum Beta Lactamase |
| HGT | Horizontal Gene Transfer |
| MCA | MacConkey Agar |
| MCA-C | MacConkey Agar-Cefotaxime |
| MDR | Multi Drug Resistance |
| PCR | Polymerase Chain Reaction |
| RPM | Revolutions per minute |
| SHV | Sulfhydryl variable |
| TEM | Temoneira |
| WHO | World Health Organization |
References
- O’Neill J: Tackling drug-resistant infections globally: final report and recommendations. 2016.
- Aljeldah MM: Antimicrobial resistance and its spread is a global threat. Antibiotics 2022, 11(8):1082.
- Fouz N, Pangesti KN, Yasir M, Al-Malki AL, Azhar EI, Hill-Cawthorne GA, Abd El Ghany M: The contribution of wastewater to the transmission of antimicrobial resistance in the environment: implications of mass gathering settings. Tropical medicine and infectious disease 2020, 5(1):33.
- Despotovic M, de Nies L, Busi SB, Wilmes P: Reservoirs of antimicrobial resistance in the context of One Health. Current opinion in microbiology 2023, 73:102291.
- Hossain MS, Balakrishnan V, Rahman NNNA, Sarker MZI, Kadir MOA: Treatment of clinical solid waste using a steam autoclave as a possible alternative technology to incineration. International journal of environmental research and public health 2012, 9(3):855-867.
- Garibaldi BT, Reimers M, Ernst N, Bova G, Nowakowski E, Bukowski J, Ellis BC, Smith C, Sauer L, Dionne K: Validation of autoclave protocols for successful decontamination of category a medical waste generated from care of patients with serious communicable diseases. Journal of clinical microbiology 2017, 55(2):545-551. [CrossRef]
- Biological Waste Management [https://ehs.oregonstate.edu/biological-waste-management].
- Harris S, Morris C, Morris D, Cormican M, Cummins E: Antimicrobial resistant Escherichia coli in the municipal wastewater system: effect of hospital effluent and environmental fate. Science of the total environment 2014, 468:1078-1085. [CrossRef]
- Marschang S, de Stefani E: Waste disposal in healthcare and effects on AMR.
- Liu G, Thomsen LE, Olsen JE: Antimicrobial-induced horizontal transfer of antimicrobial resistance genes in bacteria: A mini-review. Journal of Antimicrobial Chemotherapy 2022, 77(3):556-567. [CrossRef]
- Lerminiaux NA, Cameron AD: Horizontal transfer of antibiotic resistance genes in clinical environments. Canadian journal of microbiology 2019, 65(1):34-44.
- Cosgrove SE: The relationship between antimicrobial resistance and patient outcomes: mortality, length of hospital stay, and health care costs. Clinical Infectious Diseases 2006, 42(Supplement_2):S82-S89.
- Monstein HJ, Östholm-Balkhed Å, Nilsson M, Nilsson M, Dornbusch K, Nilsson L: Multiplex PCR amplification assay for the detection of blaSHV, blaTEM and blaCTX-M genes in Enterobacteriaceae. Apmis 2007, 115(12):1400-1408.
- Boyd DA, Tyler S, Christianson S, McGeer A, Muller MP, Willey BM, Bryce E, Gardam M, Nordmann P, Mulvey MR: Complete nucleotide sequence of a 92-kilobase plasmid harboring the CTX-M-15 extended-spectrum beta-lactamase involved in an outbreak in long-term-care facilities in Toronto, Canada. Antimicrobial agents and chemotherapy 2004, 48(10):3758-3764. [CrossRef]
- Calderón-Franco D, Lin Q, Van Loosdrecht MC, Abbas B, Weissbrodt DG: Anticipating xenogenic pollution at the source: impact of sterilizations on DNA release from microbial cultures. Frontiers in bioengineering and biotechnology 2020, 8:171. [CrossRef]
- Harjanti DW, Wahyono F, Ciptaningtyas VR: Effects of different sterilization methods of herbal formula on phytochemical compounds and antibacterial activity against mastitis-causing bacteria. Veterinary world 2020, 13(6):1187. [CrossRef]
- Von Wintersdorff CJ, Penders J, Van Niekerk JM, Mills ND, Majumder S, Van Alphen LB, Savelkoul PH, Wolffs PF: Dissemination of antimicrobial resistance in microbial ecosystems through horizontal gene transfer. Frontiers in microbiology 2016, 7:173.
| Primer name | Sequence (5′-3′direction) |
TM in ℃ | Amplicon size in bp | Reference |
|---|---|---|---|---|
| TEM-F TEM-R |
TCGCCGCATACACTATTCTCAGAATGA ACGCTCACCGGCTCCAGATTTAT |
53 52 |
445 kb | [13] |
| CTX-M-F CTX-M-R |
ATGTGCAGYACCAGTAARGTKATGGC TGGGTRAARTARGTSACCAGAAYCAGCGG |
54 58 |
593 kb | [14] |
| Autoclave time (minutes) | 5’ | 10’ | 15’ | 20’ | 25’ | 30’ |
| PCR detection of blaTEM | YES | YES | YES | YES | YES | YES |
| PCR detection of blaCTX-M | YES | YES | YES | YES | YES | YES |
| PCR detection of blaCTX-M & blaTEM from neg control | NO | NO | NO | NO | NO | NO |
| Growth of E. coli on MCA | NO | NO | NO | NO | NO | NO |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).