Submitted:
15 January 2025
Posted:
15 January 2025
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
3. Results
3.1. Molecular Analysis Results
3.2. Morphological Results
3.2.1. Coproptilia tawiensis Park, 2009
3.2.2. Coproptilia uniformis Yu, sp. nov. (Figure 3)
3.2.3. Coproptilia funiuensis Yu, sp. nov. (Figure 4)
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wang, Q.Y.; Li, H.H. Phylogeny of the superfamily Gelechioidea (Lepidoptera: Obtectomera), with an exploratory application on geometric morphometrics. Zoologica Scripta 2019, 00, 1–22. [Google Scholar] [CrossRef]
- Park, K.T.; Cho, S.; Koo, J.M. The subfamily Torodorinae of the world (Lepidoptera: Lecithoceridae); National Institute of Biological Resources: Incheon, South Korea, 2022; pp. 1–584. [Google Scholar]
- Gozmány, L. Lecithoceridae. In Microlepidoptera Palaearctica; Amsel, H.G., Reisser, H., Gregor, F., Eds.; Georg Fromme & Co.: Vienna, Austria, 1978; Volume 5, pp. 1–306. [Google Scholar]
- Common, I.F.B. Moths of Australia; Melbourne University Press: Melbourne, Australia, 1990; pp. 1–544. [Google Scholar]
- Komai, F.; Yoshiyasu, Y.; Nasu, Y.; Saito, T. A guide to the Lepidoptera of Japan; Tokai University Press: Tokyo, Japan, 2011; pp. 1–1308. [Google Scholar]
- Park, K.T.; Mey, W. A review of the genus Lecithocera Herrich-Schäffer, 1853 in the Philippines, with descriptions of seven new species (Lepidoptera: Lecithoceridae). SHILAP Revista Lepidopterolog 2016, 33, 339–352. [Google Scholar] [CrossRef]
- Snellen, P.C.T. Beschrjvingen van nieuwe exotische Tortricinen, Tincinen, en Pterophorinen benevens aanteekeningen over reeds bekend gemaakte soorten. Tikdschrift vorr Rntomologie 1903, 46, 25–26. [Google Scholar]
- Wu, C.S. The Lecithoeridae (Lepidoptera) of China, with descriptions of new taxa. Sinzoologica 1994, 11, 123–154. [Google Scholar]
- Park, K.T. Revision of the genus Coproptilia Snellen, with description of a new species from the Philippines (Lepidoptera: Lecithoceridae). Entomological Research 2009, 39, 239–242. [Google Scholar] [CrossRef]
- Wu, C.S. Fauna Sinica, Insecta, Lepidoptera, Lecithoceridae; Science Press: Beijing, China, 1997; pp. 1–306. [Google Scholar]
- Meyrick, E. Descriptions of Indian Micro-lepidoptera. Journal of the Bombay Natural History Society 1911, 20, 706–736. [Google Scholar]
- Park, K.T. A revision of the genus Nosphistica Meyrick (Lepidoptera, Lecithoceridae). Zoological Studies 2002, 4, 251–262. [Google Scholar]
- Yu, S.; Wang, S.X. Taxonomic study of the genus Nosphistica Meyrick, 1911 (Lepidoptera: Lecithoceridae) from China, with descriptions of seven new species. Zootaxa 2019, 4664, 497–517. [Google Scholar] [CrossRef] [PubMed]
- Sterling, M.J.; Lees, D.C.; Grundy, D. Xenotorodor stygioxanthus gen. nov., sp. nov. (Lepidoptera, Lecithoceridae, Torodorinae), described from an established population in Spain with discussion of taxonomic placement. Nota Lepidopterologica 2023, 46, 103–123. [Google Scholar] [CrossRef]
- Li, H.H. The Gelechiidae of China (I) (Lepidoptera: Gelechioidea); Nankai University Press: Tianjin, China, 2002. [Google Scholar]
- Folmer, O.; Black, M.B.; Hoch, W.; Lutz, R.A.; Vrijehock, R.C. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 1994, 3, 294–299. [Google Scholar] [PubMed]
- Cho, S.W.; Mitchell, A.; Regier, J.C.; Mitter, C.; Poole, R.W.; Friedlander, T.P.; Zhao, S.W. A highly conserved nuclear gene for low-level phylogenetics: Elongation factor-1α recovers morphology-based tree for heliothine moths. Molecular Biology and Evolution 1995, 12, 650–656. [Google Scholar] [PubMed]
- Brower, A.V.Z.; DeSalle, R. Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference. Insect Molecular Biology 1998, 7, 73–82. [Google Scholar] [CrossRef] [PubMed]
- Wahlberg, N.; Wheat, C.H. Genomic outposts serve the phylogenetic pioneers: designing novel nuclear markers for genomic DNA extractions of Lepidoptera. Systematic Biology 2008, 57, 231–242. [Google Scholar] [CrossRef] [PubMed]
- Hall, T.A. BioEdit: A user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp. Ser. 1999, 41, 95–98. [Google Scholar]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources 2020, 20, 348–355. [Google Scholar] [CrossRef]
- Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice across a Large Model Space. Systematic Biology 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: new methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Molecular Biology and Evolution 2017, 34, 772–773. [Google Scholar] [CrossRef] [PubMed]
- Meyrick, E. s. n. Exotic Microlepidoptera II; Thornhanger: Marlborough, Wilts, 1918; pp. 97–224. [Google Scholar]
- Yu, S.; Zhu, Y.M.; Wang, S.X. Eighteen new species and fifteen new records of the genus Torodora Meyrick (Lepidoptera: Lecithoceridae) from China. Zootaxa 2022, 5133, 1–39. [Google Scholar] [CrossRef] [PubMed]





| Gene region | Forward primer (5’ to 3’) | Reverse primer (5’ to 3’) | ||
|---|---|---|---|---|
| Elongation factor 1 alpha (EF-1α) | EF-1α-F | CCYGCCAAYATCACCACTGAAG | EF-1α-R | AGAGGHGGGAACTCYTGGAAGGA |
| Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | GAPDH-F | TCACTTGGAVGGTGGHGCCAAGAA | GAPDH-R | AGAGAGATACCAGCDGCAGCATC |
| Carbamoyl phosphate synthetase domain protein (CAD) | CAD-F | AGTTTRGACTACTGTGTAGTTAAAATA | CAD-R | TGATAAAATAACGCCATCAGGA |
| Cytosolic malate dehydrogenase (MDH) | MDH-F | TGTTGTCATGGAGCTTGCAGATT | MDH-R | CCCATATAACAACATTCTTWACATCC |
| Ribosomal protein S5 (RpS5) | RpS5-F | GCAGCATGGCCGTCGATAACAT | RpS5-R | TTGATGAACCCTTGGCAGCATTAAT |
| wingless | wingless-F | TGCACAGTGAAAACTTGCTGGAT | wingless-R | GTTACACCTTTCCACAACGAACATG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).