Submitted:
15 August 2024
Posted:
15 August 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Baker SE, Bennett JW. An Overview of the Genus Aspergillus. 2007 Dec 7;3–13.
- Paulussen C, Hallsworth JE, Álvarez-Pérez S, Nierman WC, Hamill PG, Blain D, et al. Ecology of aspergillosis: insights into the pathogenic potency of Aspergillus fumigatus and some other Aspergillus species. Microbial Biotechnology [Internet]. 2016 Jun 7;10(2):296–322. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5328810/. [CrossRef]
- Batista PP. Caracterização de linhagens do grupo Aspergillus flavus baseada em marcadores de DNA [Internet]. repositorio.ufpe.br. 2007. Available from: https://repositorio.ufpe.br/handle/123456789/6454.
- Egger M, Jenks JD, Hoenigl M, Prattes J. Blood Aspergillus PCR: The Good, the Bad, and the Ugly. Journal of Fungi [Internet]. 2020 Jan 27 [cited 2021 Feb 17];6(1). Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7151127/.
- Telles DR, Karki N, Marshall MW. Oral Fungal Infections: Diagnosis and Management. Dental Clinics of North America [Internet]. 2017 Apr 1;61(2):319–49. Available from: https://www.sciencedirect.com/science/article/abs/pii/S0011853216301380.
- Latgé JP, Chamilos G. Aspergillus fumigatus and Aspergillosis in 2019. Clinical Microbiology Reviews [Internet]. 2019 Nov 13;33(1). Available from: https://cmr.asm.org/content/cmr/12/2/310.full.pdf. [CrossRef]
- Knoke M, Bernhardt H, Schwesinger G. [Early description of a pulmonary aspergillosis 1847 from Greifswald]. Mycoses [Internet]. 2003;46 Suppl 1:37–41. Available from: https://pubmed.ncbi.nlm.nih.gov/12955852/.
- Bongomin F, Harris C, Foden P, Kosmidis C, Denning DW. Innate and Adaptive Immune Defects in Chronic Pulmonary Aspergillosis. Journal of Fungi. 2017 May 29;3(2):26. [CrossRef]
- Cadena J, Thompson GR, Patterson TF. Aspergillosis. Infectious Disease Clinics of North America. 2021 Jun;35(2):415–34.
- Elahe Sasani, Farzad Pakdel, Sadegh Khodavaisy, Salehi M, Salami A, Sohrabi M, et al. Mixed Aspergillosis and Mucormycosis Infections in Patients with COVID-19: Case Series and Literature Review. Mycopathologia. 2024 Jan 17;189(1). [CrossRef]
- Carvalho-Pereira J, Fernandes F, Araújo R, Springer J, Loeffler J, Buitrago MJ, et al. Multiplex PCR Based Strategy for Detection of Fungal Pathogen DNA in Patients with Suspected Invasive Fungal Infections. Journal of Fungi. 2020 Nov 23;6(4):308. [CrossRef]
- Lortholary O, Gangneux JP ., Sitbon K, Lebeau B, de Monbrison F, Le Strat Y, et al. Epidemiological trends in invasive aspergillosis in France: the SAIF network (2005–2007). Clinical Microbiology and Infection [Internet]. 2011 Dec;17(12):1882–9. Available from: http://onlinelibrary.wiley.com/doi/10.1111/j.1469-0691.2011.03548.x/full. [CrossRef]
- Migott GB, Santos FM dos, Pagnussat LR, Barbosa B, Barbosa GDL, Hahn SR. Perfil Clínico e Epidemiológico de Pacientes com Suspeita de Aspergilose Pulmonar em Hospital do Estado Rio Grande do Sul, Brasil. Revista de Epidemiologia e Controle de Infecção. 2017 Jan 16;7(1).
- Rai D, Shukla D, Bhola ND. Aspergillosis of Maxillary Sinus’s Diagnosis, Management, and Association With COVID-19: A Case Report. Cureus. 2022 Oct 11; 14(10).
- Gomes CC, Pinto LCC, Victor FL, da Silva EAB, Ribeiro A de A, Sarquis MI de M, et al. Aspergillus in endodontic infection near the maxillary sinus. Brazilian Journal of Otorhinolaryngology. 2015 Sep;81(5):527–32. [CrossRef]
- Sousa C, Romulo Antonio Pasini, Alessandro Pasqualotto, Marchiori E, Altmayer S, Irion K, et al. Imaging Findings in Aspergillosis: From Head to Toe. Mycopathologia. 2023 Jun 28;188(5):623–41. [CrossRef]
- Walsh TJ, Anaissie EJ, Denning DW, Herbrecht R, Kontoyiannis DP, Marr KA, et al. Treatment of aspergillosis: clinical practice guidelines of the Infectious Diseases Society of America. Clinical Infectious Diseases: An Official Publication of the Infectious Diseases Society of America [Internet]. 2008 Feb 1;46(3):327–60. Available from: https://pubmed.ncbi.nlm.nih.gov/18177225/.
- Caggiano G, Apollonio F, Consiglio M, Gasparre V, Trerotoli P, Diella G, et al. Tendency in Pulmonary Aspergillosis Investigation during the COVID-19 Era: What Is Changing? International Journal of Environmental Research and Public Health [Internet]. 2022 Jun 9 [cited 2024 Jun 12];19(12):7079. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9222563/.
- Steinbach WJ. Are We There Yet? Recent Progress in the Molecular Diagnosis and Novel Antifungal Targeting of Aspergillus fumigatus and Invasive Aspergillosis. Goldman WE, editor. PLoS Pathogens. 2013 Oct 24;9(10):e1003642.
- O’Gorman CM, Fuller HT, Dyer PS. Discovery of a sexual cycle in the opportunistic fungal pathogen Aspergillus fumigatus. Nature. 2009 Jan;457(7228):471–4. [CrossRef]
- S. Arunmozhi Balajee, Kano R, Baddley JW, Moser SA, Marr KA, Alexander BD, et al. Molecular Identification of Aspergillus Species Collected for the Transplant-Associated Infection Surveillance Network. Journal of Clinical Microbiology. 2009 Oct 1;47(10):3138–41. [CrossRef]
- Betil Ozhak-Baysan, Alastruey-Izquierdo A, Saba R, Dilara Ogunc, Gozde Ongut, Aysen Timuragaoglu, et al. Aspergillus alliaceusandAspergillus flavusco-infection in an acute myeloid leukemia patient. Medical Mycology [Internet]. 2010 Nov 1 [cited 2024 Mar 14];48(7):995–9. Available from: https://academic.oup.com/mmy/article/48/7/995/1056456. [CrossRef]
- Yang S, Rothman RE. PCR-based Diagnostics for Infectious diseases: uses, limitations, and Future Applications in acute-care Settings. The Lancet Infectious Diseases. 2004 Jun;4(6):337–48. [CrossRef]
- Abate MS, Battle LR, Emerson AN, Gardner JM, Shalin SC. Dermatologic Urgencies and Emergencies: What Every Pathologist Should Know. Archives of Pathology & Laboratory Medicine. 2019 Aug;143(8):919–42. [CrossRef]



| Species | Primer Sequence (5'-3') | Amplicon Size |
|---|---|---|
| A. fumigatus | F- GTCTGAGTTGATTATCGT | 312bp |
| R- GGCCTACAGAGCAGGTGAC | ||
| A. flavus | F- CACCACGAACTCTGTCTGATC | 373bp |
| R- GATTGATTTGCGTTCGGC | ||
| A. niger | F- GCCCAACCTCCCATCCGTG | 453bp |
| R- CAATCCTACAGAGCATGTG |
| Samples | Location | Sex | Age | PCR test results | ||
|---|---|---|---|---|---|---|
| A. niger | A. fumigatus | A. flavus | ||||
| 1 | Maxillary sinus | M | 79 | - | + | + |
| 2 | Maxillary sinus | M | 55 | - | - | + |
| 3 | Maxillary sinus | M | 49 | - | - | + |
| 4 | Upper gum | M | 56 | - | + | + |
| 5 | Frontal sinus | M | 57 | - | - | - |
| 6 | Maxillary sinus | M | 52 | - | - | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).