Submitted:
29 July 2024
Posted:
30 July 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Melissopalynological Analysis
2.3. DNA Extraction and Amplification
2.4. Bioinformatics and Data Analysis
3. Results
3.1. Melissopalynological Analysis
3.1. Metabarcoding
3.1. Differences between Foraging Preferences of Bees in Different Ecological Zones: Alpha and Beta Diversity
3.1. Comparison of Metabarcoding and Melissopalynology Data
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khalifa, A.M.; Elshafiey, E.H.; Shetaia, A.A.; El-Wahed, A.A.; Algethami, A.F.; Musharraf, S.G.; AlAjmi, M.F.; Zhao, C.; Masry, S.H.D.; Abdel-Daim, M.M.; et al. Overview of Bee Pollination and Its Economic Value for Crop Production. Insects 2021, 12, 688. [Google Scholar] [CrossRef] [PubMed]
- Belsky, J.; Joshi, N.K. Effects of Fungicide and Herbicide Chemical Exposure on Apis and Non-Apis Bees in Agricultural Landscape. Front. Environ. Sci. 2020, 8, 81. [Google Scholar] [CrossRef]
- Zewdie, A.; Amssalu, B.; Alemayehu, G.; Asaminew, T. Evaluating the Impact of Commonly Used Pesticides on Honeybees (Apis mellifera) in North Gonder of Amhara Region, Ethiopia. Journal of Toxicology 2023, 2634158, 13. [Google Scholar]
- Landaverde, R.; Rodriguez, M.T.; Parrella, J.A. Honey Production and Climate Change: Beekeepers’ Perceptions, Farm Adaptation Strategies, and Information Needs. Insects 2023, 14, 493. [Google Scholar] [CrossRef] [PubMed]
- Dolezal, A.G.; St. Clair, A.L.; Zhang, G.; Toth, A.L.; O’Neal, M.E. Native habitat mitigates feast–famine conditions faced by honey bees in an agricultural landscape. PNAS 2019, 116, 25147–25155. [Google Scholar] [CrossRef] [PubMed]
- Machado, T.; Viana, B.F.; da Silva, C.I.; Boscolo, D. How landscape composition affects pollen collection by stingless bees? Landscape Ecol. 2020, 35, 747–759. [Google Scholar] [CrossRef]
- Millard, J.; Outhwaite, C.L.; Kinnersley, R.; Freeman, R.; Gregory, R.D.; Adedoja, O.; Gavini, S.; Kioko, E.; Kuhlmann, M.; Ollerton, J.; et al. Global effects of land-use intensity on local pollinator biodiversity. Nat Commun. 2021, 12, 2902. [Google Scholar] [CrossRef] [PubMed]
- De Landa, F.G.; Alberoni, D.; Baffoni, L.; et al. The gut microbiome of solitary bees is mainly affected by pathogen assemblage and partially by land use. Environmental Microbiome 2023, 18, 38. [Google Scholar]
- Insolia, L.; Molinari, R.; Rogers, S.R.; et al. Honey bee colony loss linked to parasites, pesticides and extreme weather across the United States. Sci. Rep. 2022, 12, 20787. [Google Scholar] [CrossRef]
- Laha, R.C.; de Mandal, S.; Ralte, L.; et al. Meta-barcoding in combination with palynological inference is a potent diagnostic marker for honey floral composition. AMB Expr. 2017, 7, 132. [Google Scholar] [CrossRef]
- de Vere, N.; Jones, E.L.; Gilmore, T.; Moscrop, J.; Lowe, A.; Smith, D.; Herarty, M.J.; Creer, S.; Ford, C.R. Using DNA metabarcoding to investigate honey bee foraging reveals limited flower use despite high floral availability. Scientific RepoRts 2017, 7, 42838. [Google Scholar] [CrossRef] [PubMed]
- Millard, J.; Outhwaite, C.L.; Kinnersley, R.; Freeman, R.; Gregory, R.D.; Adedoja, O.; Gavini, S.; Kioko, E.; Kuhlmann, M.; Ollerton, J.; et al. Global effects of land-use intensity on local pollinator biodiversity. Nat Commun. 2021, 12, 2902. [Google Scholar] [CrossRef] [PubMed]
- Silliman, M.R.; Schürch, R.; Malone, S.; Taylor, S.V.; Couvillon, M.J. Row crop fields provide mid-summer forage for honey bees. Ecology and Evolution 2022, 12. [Google Scholar] [CrossRef] [PubMed]
- St Clair, A.L.; Zhang, G.; Dolezal, A.G.; O’Neal, M.E.; Toth, A.L. ; Diversified Farming in a Monoculture Landscape: Effects on Honey Bee Health and Wild Bee Communities. Environmental Entomology 2020, 49, 753–764. [Google Scholar] [CrossRef] [PubMed]
- Querejeta, M.; Marchal, L.; Pfeiffer, P.; Roncoroni, M.; Bretagnolle, V.; Gaba, S.; Boyer, S. ; Environmental variables and species traits as drivers of wild bee pollination in intensive agroecosystems—A metabarcoding approach. Environmental DNA. 2023, 00, 1–14. [Google Scholar] [CrossRef]
- Sponsler, B.D.; Matcham, E.G.; Lin, C.-H.; Lanterman, L.J.; Johnson, R.M. ; Spatial and taxonomic patterns of honey bee foraging: A choice test between urban and agricultural landscapes. Journal of Urban Ecology 2017, 1–7. [Google Scholar] [CrossRef]
- Couvillon, M.J.; Schürch, R.; Ratnieks, F.L.W. Dancing bees communicate a foraging preference for rural lands in high level agri-environment schemes. Curr. Biol. 2014, 24, 1212–1215. [Google Scholar] [CrossRef] [PubMed]
- McMinn-Sauder, H.; Lin, C.-H.; Eaton, T.; Johnson, R. ;. A Comparison of Springtime Pollen and Nectar Foraging in Honey Bees Kept in Urban and Agricultural Environments. Front. Sustain. Food Syst. 2022, 6, 825137. [Google Scholar] [CrossRef]
- Lucek, K.; Galli, A.; Gurten, S.; et al. Metabarcoding of honey to assess differences in plant-pollinator interactions between urban and non-urban sites. Apidologie 2019, 50, 317–329. [Google Scholar] [CrossRef]
- Tanaka, K.; Nozaki, A.; et al. Using pollen DNA metabarcoding to profle nectar sources of urban beekeeping in Kōtō-ku, Tokyo. BMC Res Notes 2020, 13, 515. [Google Scholar] [CrossRef]
- Rutschmann, B.; Kohl, P.L.; Steffan-Dewenter, I. Foraging distances, habitat preferences and seasonal colony performance of honeybees in Central European forest landscapes. Journal of Applied Ecology 2023, 60, 1056–1066. [Google Scholar] [CrossRef]
- Leponiemi, M.; Freitak, D.; Moreno-Torres, M.; et al. Honeybees’ foraging choices for nectar and pollen revealed by DNA metabarcoding. Sci Rep 2023, 13, 14753. [Google Scholar] [CrossRef] [PubMed]
- Park, B.; Nieh, J.C. Seasonal trends in honey bee pollen foraging revealed through DNA barcoding of bee-collected pollen. Insect. Soc. 2017, 64, 425–437. [Google Scholar] [CrossRef]
- Jones, L.; Lowe, A.; Ford, R.C.; Christie, L.; Creer, S.; de Vere, N. Temporal Patterns of Honeybee Foraging in a Diverse Floral Landscape Revealed Using Pollen DNA Metabarcoding of Honey. Integrative and Comparative Biology 2022, 62, 199–210. [Google Scholar] [CrossRef] [PubMed]
- Bell, K.L.; de Vere, N.; Keller, A.; Richardson, R.T.; Gous, A.; Burgess, K.S.; Brosi, B.J. Pollen DNA barcoding: Current applications and future prospects. Genome 2016, 59, 629–640. [Google Scholar] [CrossRef]
- Bänsch, S.; Tscharntke, T.; Wünschiers, R.; Netter, L.; Brenig, B.; Gabriel, D.; Westphal, C. Using ITS2 metabarcoding and microscopy to analyse shifts in pollen diets of honey bees and bumble bees along a mass-flowering crop gradient. Mol Ecol. 2020, 29, 5003–5018. [Google Scholar] [CrossRef]
- Ptaszyn ́ska, A.A.; Latoch, P.; Hurd, P.J.; Polaszek, A.; Michalska-Madej, J.; Grochowalski, Ł.; Strapagiel, D.; Gnat, S.; Załuski, D.; Gancarz, M.; et al. Amplicon Sequencing of Variable 16S rRNA from Bacteria and ITS2 Regions from Fungi and Plants, Reveals Honeybee Susceptibility to Diseases Results from Their Forage Availability under Anthropogenic Landscapes. Pathogens 2021, 10, 381. [Google Scholar] [CrossRef] [PubMed]
- Wirta, H.; Abrego, N.; Miller, K.; Roslin, T.; Vesterinen, E. DNA traces the origin of honey by identifying plants, bacteria and fungi. Scientific Reports 2021, 11, 4798. [Google Scholar] [CrossRef]
- Daugaliyeva, A.; Daugaliyeva, S.; Ashanin, A.; Beltramo, C.; Mamyrova, L.; Yessembekova, Z.; Peletto, S. Prokaryotic Diversity of Ruminal Content and Its Relationship with Methane Emissions in Cattle from Kazakhstan. Life 2022, 12, 1911. [Google Scholar] [CrossRef]
- Lowe, A.; Jones, L.; Witter, L.; Creer, S.; de Vere, N. Using DNA Metabarcoding to Identify Floral Visitation by Pollinators. Diversity 2022, 14, 236. [Google Scholar] [CrossRef]
- Khansaritoreh, E.; Salmaki, Y.; Ramezani, E.; Azirani, T.A.; Keller, A.; Neumann, K.; Alizadeh, K.; Zarre, S.; Beckh, G.; Behling, H. Employing DNA metabarcoding to determine the geographical origin of honey. Heliyon 2020, 6, e05596. [Google Scholar] [CrossRef] [PubMed]
- Chiara, B.; Cerutti, F.; Brusa, F.; Mogliotti, P.; Garrone, A.; Squadrone, S.; Acutis, P.L.; Peletto, S. Exploring the botanical composition of polyfloral and monofloral honeys through DNA metabarcoding. Food Control. 2021, 128. [Google Scholar] [CrossRef]
- Smart, M.D.; Cornman, R.S.; Iwanowicz, D.D.; McDermott-Kubeczko, M.; Pettis, J.S.; Spivak, M.S.; Otto, C.R.V. A Comparison of Honey Bee-Collected Pollen From Working Agricultural Lands Using Light Microscopy and ITS Metabarcoding. Environmental Entomology 2017, 46, 38–49. [Google Scholar] [CrossRef]
- Milla, L.; Schmidt-Lebuhn, A.; Bovill, J.; Encinas-Viso, F. Monitoring of honey bee floral resources with pollen DNA metabarcoding as a complementary tool to vegetation surveys. Ecological Solutions and Evidence 2022, 3, e12120. [Google Scholar] [CrossRef]
- Sickel, W.; Ankenbrand, M.J.; Grimmer, G.; Holzschuh, A.; Härtel, S.; Lanzen, J. ; Increased efficiency in identifying mixed pollen samples by meta - barcoding with a dual - indexing approach. BMC Ecol. 2015, 15, 1–9. [Google Scholar] [CrossRef]
- Murthy, K.M.; Khandayataray, P.; Ralte, L.; Laha, R.; Samal, D. Identification of plant species in multi flower honey by using Ribulose-Bisphosphate carboxylase gene (RBCL) coding region as barcode marker, Mizoram, Northeast India: An Indo: Burma hotspot region. Journal of Entomology and Zoology Studies. 2019, 7, 1475–1483. [Google Scholar]
- Bell, K.L.; Loeffler, V.M.; Brosi, B.J. An rbcL reference library to aid in the identification of plant species mixtures by DNA metabarcoding. Applications in Plant Sciences. 2017, 5, 1600110. [Google Scholar] [CrossRef]
- Saravanan, M.; Mohanapriya, G.; Laha, R.; Sathishkumar, R. DNA barcoding detects floral origin of Indian honey samples. Genome. 2019, 62, 341–348. [Google Scholar] [CrossRef]
- von Der Ohe, W.; Oddo, L.P.; Piana, M.L.; Morlot, M.; Martin, P. Harmonized methods of melissopalynology. Apidologie 2004, 35, S18–S25. [Google Scholar] [CrossRef]
- Karpovich, I.V.; Drebezgina, E.S.; Elovikova, E.A.; Legotkina, G.I.; Zubova, E.N.; Kuzjaev, R.Z.; Hismatullin, R.G. Atlas pyl’cevyh zeren/Pollen atlas/. Ekaterinburg Ural’skij rabochij 2015, 320. http://www.apiworld.ru/1453835538.html.
- Chen, S.; Yao, H.; Han, J.; Liu, C.; Song, J.; Shi, L.; et al. Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE 2010, 5, e8613. [Google Scholar] [CrossRef] [PubMed]
- https://github.com/apallavicini/bc4q; https://github.com/apallavicini/PLANiTS.
- Banchi, E.; Ametrano, C.G.; Greco, S.; et al. PLANiTS: a curated sequence reference dataset for plant ITS DNA metabarcoding. Database 2020, 2020, baz155. [Google Scholar] [CrossRef] [PubMed]
- de Melo Moura, C.C.; Setyaningsih, C.A.; Li, K.; et al. Biomonitoring via DNA metabarcoding and light microscopy of bee pollen in rainforest transformation landscapes of Sumatra. BMC Ecol Evo 2022, 22, 51. [Google Scholar] [CrossRef] [PubMed]
- Martin, S.G.; Hautier, L.; Mingeot, D.; Dubois, B. How reliable is metabarcoding for pollen identification? An evaluation of different taxonomic assignment strategies by cross-validation. PeerJ 2024, 12, e16567. [Google Scholar] [CrossRef] [PubMed]
- Noël, G.; Mestrez, A.; Lejeune, P.; Francis, F.; Miwa, M.; Uehara, K.; Nagase, A. Pollen meta-barcoding reveals foraging preferences of honeybees (Apis mellifera L.) along space-time gradient in Japan. bioRxiv, preprint. 2021. [Google Scholar]







| Primer name | Nucleotide sequence | Amplification mode and product length in nucleotide pairs | Source |
|---|---|---|---|
| rbcLaf + adaptor | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGTCACCACAAACAGAGACTAAAGC | Thermal cycling conditions were: 95 °C for 2 minutes; 95 °C for 30 seconds, 50 °C for 1 minute 30 seconds, 72 °C for 40 seconds (35 cycles); 72 °C for 5 minutes, 30 °C for 10 seconds. ~704 bp. |
de Vere, N. et al. Using DNA metabarcoding to investigate honey bee foraging reveals limited flower use despite high floral availability. Sci. Rep. 7, 42838; doi: 10.1038/srep42838 (2017). [11] |
| rbcLr506 + adaptor | GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGAGGGGACGACCATACTTGTTCA | ||
| ITS2 S2F | TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGCGATACTTGGTGTGAAT | Thermal cycling conditions were: 94℃ 5 min. 94℃ 30 sec, 56℃ 30 sec, 72℃ 45 sec, 40 cycles.72℃ 10 min ~350-500 (size range) in bp. |
Chen S, Yao H, Han J, Liu C, Song J, Shi L, et al. (2010) Validation of the ITS2 Region as a Novel DNA Barcode for Identifying Medicinal Plant Species. PLoS ONE 5(1): e8613. https://doi.org/10.1371/journal.pone.0008613 [41] |
| ITS2 S3R |
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACGCTTCTCCAGACTACAAT |
||
| Note: the Illumina adapter area is highlighted in bold. | |||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).