Identification and Pathogenicity of Pestalotioid Species on Alpinia oxyphylla in Hainan Province, China

Xiufen Cui; Zhigang Hao; Menghuai Chen; Shuang Song; Jinan Zhang; Yingbin Li; Jianqiang Li; Yixiang Liu; Laixin Luo

doi:10.20944/preprints202404.1382.v1

Submitted:

19 April 2024

Posted:

22 April 2024

You are already at the latest version

Abstract

Alpinia oxyphylla is a traditional Chinese medicinal plant, with a medicinal history of more than 1,700 years. Ring leaf blight (RLB) disease, caused by pestalotioid species, is an important disease of A. oxyphylla, seriously affecting the yield and quality of fruits. The causal agent of RLB disease has not been systematically identified and characterized so far. In this study, thirty-six pestalotioid strains were isolated from the leaves and stems of A. oxyphylla collected from 6 cities of Hainan province, China. Based on multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristics analyses, seventeen species belonging to three genera (Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis) were identified and six new species (N. baotingensis, N. oblatespora, N. olivaceous, N. oxyphylla, N. wuzhishanensis and N. yongxunensis) were described. Pathogenicity tests revealed that strains of Neopestalotiopsis species caused more severe ring leaf blight on A. oxyphylla than strains of Pestalotiopsis and Pseudopestalotiopsis under wounded inoculation conditions.

Keywords:

Pestalotioid species

;

New taxa

;

Alpinia oxyphylla

;

Ring leaf blight

;

Pathogenicity

Subject:

Biology and Life Sciences - Agricultural Science and Agronomy

1. Introduction:

Alpinia oxyphylla is an important Chinese herbal plant, with a medicinal history dating back to 1,700 years ago [1]. As an edible herb, the traditional medicinal effects of A. oxyphylla mainly include warming the kidney, solidifying spermatorrhea, arresting polyuria, warming the spleen as well as stopping diarrhea and saliva [2,3]. Moreover, the essential oil of A. oxyphylla has various effects including antibacteria, anticancer, antioxidant, vasodilation and improve immunity [4]. A. oxyphylla likes to grow in warm and humid environmental conditions and is commonly planted under rubber tree, areca tree and other economic forests as a semi-shade plant [5,6,7]. A. oxyphylla is mainly distributed in southern China, such as Hainan, Guangdong and Guangxi province. Among them, Hainan is the most important planting area for A. oxyphylla, accounting for 90% of the total output in China [8,9,10].

The occurrence of diseases causes serious losses to the production and quality of A. oxyphylla. Ring leaf blight (RLB) is an important disease of A. oxyphylla, occurring from seedling to fruiting stage, mainly infecting the old leaves. The disease often extends from the leaf edge or tip, forming irregular, reddish-brown spots with alternating dark and light brown, wavy concentric rings and obvious yellow halos around the periphery of the disease spots, on which scattered numerous small black conidiomata of the pathogen. The high temperature and rainy season contribute to the occurrence of RLB disease, and the high incidence of this disease is from August to September. Under suitable conditions, the proportion of diseased plants can reach more than 50%, and the area of the diseased spots can reach 1/3~1/2 of the leaf surface, even the entire leaf, which has an impressive impact to the growth of A. oxyphylla [11,12].

The pathogen of RLB disease was first reported as Pestalotia palmarum in 1986[11]. Subsequently, the classification status of P. palmarum was adjusted to the genus of Pestalotiopsis, while the genus of Pestalotia and Pestalotiopsis was used confusingly in description of A. oxyphylla diseases [13]. The ring brown spot (RBS) disease of A. oxyphylla was caused by Pestalosphaeria alpinia, a species of sexual morphs of pestalotioid fungi [25]. As asexual fungi, most pestalotioid species lack the sexual morphs, Pestalosphaeria[26]. Most of pestalotioid species are important plant pathogens, and are also found as commonly endophytes or saprophytes, mainly distributed throughout tropical and temperate regions [14,15,16]. Pestalotioid species can infect leaves, shoots, flowers, fruits, or other parts of plants, and cause a variety of diseases of multiple economic crops, including leaf spot, gray blight, shoot dieback, trunk diseases, dry flower and fruit rot [15,17,18,19,20,21,22,23,24]. Hence, pestalotioid species causing the disease of A. oxyphylla need to be reidentified and characterized based on fungi diversity, molecular systematics and pathogenicity.

The development of molecular phylogenetic analysis overcomes the limitation of overlapping conidial measurements in traditional taxonomy of pestalotioid species [14,15,27,28]. In 2014, two novel genera, Neopestalotiopsis and Pseudopestalotiopsis, were segregated from Pestalotiopsis based on conidial characters and multi-locus phylogenetic analyses. The combined sequences of ITS, tub2 and tef-1α genes were used to construct phylogenetic trees, which become an important basis for distinguishing different species within the genus of Pestalotiopsis, Neopestalotiopsis and Pseudopestalotiopsis. Morphologically, Neopestalotiopsis can be easily differentiated from Pestalotiopsis and Pseudopestalotiopsis by their versicolorous median cells of conidia, and Pseudopestalotiopsis is different from Pestalotiopsis with three darker concolorous median cells [15]. Through these methods, many novel pestalotioid species isolated from different plants have been introduced in recent years [17,20,29,30,31,32,33,34].

Therefore, the object of this study is to clarify the types, characteristics and pathogenicity of pestalotioid species related to the disease of A. oxyphylla in Hainan, China.

2. Materials and Methods

2.1. Sample Collection, Fungi Isolation and Morphological Examination

Fresh leaves and stems of A. oxyphylla with typical ring spot were collected from the main planted area at ten towns in six cities of Hainan province, including Baoting, Ledong, Qiongzhong, Sanya, Wanning, and Wuzhishan in 2022. Small pieces (5×5 mm) of leaves or stems were cut from the junction of disease and health areas, disinfected with 3% sodium hypochlorite for 3 min, then 75% ethanol for 30s, subsequently washed with sterilized water for three times. The treated tissue pieces were dried on sterilized blotting paper and then placed on PDA plates (containing 100 μg/mL streptomycin, 50 μg/mL kanamycin and 100 μg/mL ampicillin). The plates were cultured at room temperature and examined daily for 7 days, then the marginal mycelia were transferred to fresh PDA and purified by single-spore culturing.

The pestalotioid strains usually sporulated at room temperature on PDA after 10-20 days. Conidiomata were observed using dissecting microscope (CNOPTEC, SZ680, China) and the characteristics of spores and conidiophores using optical microscope (CNOPTEC, DV320, China). All the morphological characteristics of the spores were photographed and measured at least 30 individuals using OPTPro. The images were progressed by Adobe Photoshop CS6. The pure cultures of isolated fungal strains were stored in the seed health center of China Agricultural University.

2.2. DNA Extraction, Gene Sequencing, and Phylogenetic Analyses

DNA was extracted from fresh fungal mycelia using the Biomed genomic DNA extraction kit (Biomed, Beijing). The partial sequences of three genes (ITS, tef-1α and tub2) were amplified. The PCR was performed according to Table 1 and the PCR products were purified and sequenced at Beijing Tsingke Biotech.

The nucleotide sequences were checked by Chromas2.4.1, then blasted in the NCBI to assess the closest phylogenetic matches. All related sequences by blasted or referenced previous studies were downloaded from GenBank (Table 2). MAFFT v.7(https://mafft.cbrc.jp/alignment/software/) was used to align each locus sequences and MEGA v.11 was used to manually improve the sequences. The three final aligned gene sequences were concatenated by SequenceMatrix [40].

The phylogenetic analyses of the combined sequences were carried out with maximum-likelihood (ML) and Bayesian inference (BI) methods. ML analysis was performed on the CIPRES web portal (https://www.phylo.org) using RAxML-HPC BlackBox 8.2.10 with GTRGAMMA substitution model and 1,000 bootstrap replicates [91]. BI analysis was implemented using MrBayes v.3.2.7 [92], and MrModeltest 2.2 [92] was used to seek the best-fit nucleotide substitution models for each gene. Two Markov chain Monte Carlo (MCMC) were run for 1,000,000 generations, and trees were sampled every 1000th generation. The first 25% of trees, standing for the burn-in phase of the analyses, were discarded, and the remaining trees were estimated the posterior probabilities. ML tree and BI tree were viewed using Figtree v.1.4.4. and modified by WPS Office.

The new species can be further confirmed through PHI (Pairwise Homoplasy Index) analysis, which can also be used to analyze the species boundaries and related taxa [93]. The PHI test was completed in SplitsTree v.4 [94,95]，and the value over 0.05 reveals no significant recombination in the dataset. The relationship among closely related species were shown by splits graphs through the LogDet transformation and split decomposition.

2.3. Pathogenicity Test

The pathogenicity of fungi was tested by wound inoculation method. Fresh and healthy leaves of A. oxyphylla with 30-40 cm long were collected from the field. The surface of the leaves was disinfected by spraying of 75% ethanol and then washed three times with sterile water. Each fungal isolate was inoculated on 6 sites of a leaf with 3 leave replicates. A piece of mycelial (6 mm diameter), which was taken from the margin of a fresh colony cultured to 2/3 of the PDA plate’s diameter, was placed on the wound of leaf injured by sterilized needle. A piece of PDA without mycelium was used as control. The inoculated leaves were placed in a box and cultured in the incubator at 26℃, 600 LUX with 16 h/8 h LED light/dark cycle. After 5 days, disease symptoms were recorded and the lesion area was measured using ImageJ and the data were analyzed by SPSS Statistics 24. The re-isolated fungi from disease lesion were identified based on Koch's postulate.

3. Results

3.1. Phylogenetic Analyses

A total of 36 pestalotioid isolates were obtained from the leaves (32 isolates) and stems (4 isolates) samples of A. oxyphylla in six cities of Hainan province. Based on ITS sequence and the color of intermediate cells of conidia, 36 strains were classified into three genera, of which 32 strains belong to Neopestalotiopsis, two strains belong to Pestalotiopsis and two strains belong to Pseudopestalotiopsis.

The phylogenetic tree of Neopestalotiopsis contained 145 taxa, with 2 outgroup taxa (P. colombiensis and P. diversiseta). A total of 1,404 characters including gaps (503 for ITS, 469 for tef-1a, and 432 for tub2) were included in the phylogenetic analysis. For the Bayesian inference, the HKY+G model with gamma-distributed rate was selected for ITS, HKY+G model with gamma-distributed rate was selected for tef1-a and the HKY+I+G model with invgamma-distributed rate was selected for tub2. Similar tree topologies were acquired by ML and BI methods, and the best scoring ML tree is shown in Figure 1. The phylogenetic tree analyzed 32 Neopestalotiopsis taxa isolated from A. oxyphylla, revealed 6 novel species.

The phylogenetic tree of Pestalotiopsis comprised 78 taxa, with the outgroup taxon (N. cubana CBS 600.96). A total of 1,475 characters including gaps (505 for ITS, 495 for tef-1a, and 475 for tub2) were included in the phylogenetic analysis. For the Bayesian inference, the GTR + I + G model with invgamma-distributed rate was selected for ITS, GTR + G model with gamma-distributed rate was selected for tef1-a and the GTR + I + G model with invgamma-distributed rate was selected for tub2. Similar tree topologies were obtained by ML and BI methods, and the best scoring ML tree is shown in Figure 2. The phylogenetic tree analyzed two Pestalotiopsis strains isolated from A. oxyphylla, clustered with the type species of P. hydei.

The alignment of Pseudopestalotiopsis contained 35 taxa, with P. trachicarpicola OP068 as outgroup taxon. A total of 1,392 characters including gaps (521 for ITS, 442 for tef-1a, and 429 for tub2) were included in the phylogenetic analysis. For the Bayesian inference, the HKY+G model with gamma-distributed rate was selected for ITS, HKY + G model with gamma-distributed rate was selected for tef1-a and the HKY + I model with propinv-distributed rate was selected for tub2. Similar tree topologies were obtained by ML and BI methods, and the best scoring ML tree is shown in Figure 3. The phylogenetic tree analyzed two Pseudopestalotiopsis taxa isolated from A. oxyphylla, clustered with the type species of Ps. avicenniae and Ps. myanmarina respectively.

3.2. PHI Analyses

The result of PHI test indicates no obvious recombination (Фw =0.1064) among N. baotingensis SX41-0706, N. oblatespora YJ11-0708 and their closely species N. saprophytica MFLUCC 12-0282, N. paeoniea CBS 318.74, N. hydeana MFLUCC 20-0132, N. egyptiaca CBS 140162, N. guajavicola FMBCC 11.4, N. mesopotamica CBS 299.74 (Figure 4a). And there is no significant recombination (Фw =0.0786) between N. olivaceous LF25-0709 and its closely species N. amomi HKAS 124563, N. zingiber GUCC 21001, N. magna MFLUCC 12-0652 (Figure 4b). N. yongxunensis YX101-0708, N. wuzhishanensis YX116-0708 and their closely taxa have no significant recombination according to the PHI test result (Фw =0.1103) (Figure 4c).

3.3. Taxonomy

Based on multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristics analyses, 17 species were identified. Three Neopestalotiopsis strains failed to acquire spores and were not been identified to specific species. Six new species were described as below. The conidial dimension of identified isolations in this study and their closely strains are shown in Table 3.

Neopestalotiopsis baotingensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 5)

Etymology: named referring to the first collection city of Baoting in Hainan Province.

Holotype: SX41-0706.

Description:

Conidiomata on PDA solitary or aggregated, globose, dark. Conidiophores often degenerated to conidiogenous cells. Conidiogenous cells spherical, hyaline. Conidia, fusiform, straight to slightly curved, 18-26×5-7.2 μm (

\bar{x}

=23.2×6.3 μm), 4 septate; basal cell conical to obtuse, hyaline, thin and smooth-walled, 3.2-6.2 μm long (

\bar{x}

=4.5 μm); three median cells, 12-17.3 μm (

\bar{x}

=14.8 μm), verruculose, versicolor, pale brown to dark brown, septa and periclinal walls darker than the rest of the cell, second cell from base pale brown to brown, paler than the two other cells, 3.2-5.5 μm long (

\bar{x}

=4.4 μm), third cell brown to dark brown, darker than the two other cells, 4-6 μm long (

\bar{x}

=4.9 μm), fourth cell brown to darker brown, 4-6 μm long (

\bar{x}

=5 μm); apical cell 2.5-5 μm long (

\bar{x}

=3.8 μm), cylindric to subcylindric; with 2-4 tubular appendages on the apical cell, often 2-3, arising from the apex of the apical cell, unbranched, 3-30.5 μm long (

\bar{x}

=19.7 μm); single basal appendage, unbranched, tubular, centric, 2.5-10 μm long (

\bar{x}

=6.3 μm). Sexual morph not observed.

Culture characteristics: The colony reached 70 mm diameter on PDA after 4 days growth at room temperature. The colony was off white, dense aerial hyphae on the surface with crenate edge, and its reverse was lemon-yellow.

Material examined: China, Hainan Province, Baoting city, Shiling Town, Shuixian village, from leaf spots of A. oxyphylla, 6 July 2022, X.F. Cui and Z.G. Hao (SX41-0706, holotype); ex-type, Hainan Province, Wuzhishan city, Shuiman Town, Yongxun village, from spots on base stem of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (YJ34-0708);

Notes: Two strains of Neopestalotiopsis baotingensis were isolated from two cities of Hainan, SX41-0706 and YJ34-0708, clustered with well-supported (ML=81%, BI=1). N. baotingensis is closed related to N. saprophytica (MFLUCC 12-0282) in the phylogenetic analysis. The conidiophores of N. baotingensis often degenerated to conidiogenous cells, while that of N. saprophytica unbranched or irregularly branched; N. baotingensis is shorter than N. saprophytica (N. baotingensis 18-26 μm,

\bar{x}

=23.2 μm vs. N. saprophytica 22–30 μm,

\bar{x}

=24.9 μm); and N. baotingensis has shorter apical appendages (N. baotingensis 3-30.5 μm,

\bar{x}

=19.7 μm vs. N. saprophytica 23-35 μm,

\bar{x}

=27.3 μm). Additionally, there are 18 bp difference of ITS~tef-1α~tub2 between N. baotingensis and N. saprophytica (4/452 in ITS; 16/784 in tef-1α; and 1/448 in tub2). The PHI test about N. baotingensis reveals that there is no obvious recombination between N. baotingensis and its closely taxa. Therefore, N. baotingensis is classified as a new species in this study.

Neopestalotiopsis oblatespora X.F. Cui and Z.G. Hao, sp. nov. (Figure 6)

Etymology: named referring to spore morphology.

Holotype: YJ11-0708.

Description:

Conidiomata not observed on PDA. Conidiophores often monopodial branched, colorless. Conidia, oblate, straight, scarcely curved, 18-23.2×5.5-6.7 μm (

\bar{x}

=20.2×6.2 μm), 4 septate; basal cell conical to subcylindrical, pale brown or hyaline, thin and smooth-walled, 2.5-4.5 μm long (

\bar{x}

=3.2 μm); three median cells, 12-15 μm (

\bar{x}

=13.6 μm), nearly concolor or versicolor, brown to dark brown, septa and periclinal walls darker than the rest of the cell, second cell from base brown to dark brown, 3.7-6 μm long (

\bar{x}

=4.7 μm), third cell dark brown, 3-5 μm long (

\bar{x}

=4.2 μm); fourth dark brown, 3.5-5.3 μm long (

\bar{x}

=4.4 μm); apical cell 2.5-4 μm long (

\bar{x}

=3.2 μm), conical, hyaline, thin and smooth-walled; 2-4 tubular appendages on the apical cell (often 3), arising from the apex of the apical cell, unbranched, 10-26.5 μm long (

\bar{x}

=18 μm); single basal appendage, unbranched, tubular, centric or lateral, 2-9 μm long (

\bar{x}

=5.6 μm). Sexual morph not observed.

Culture characteristics: The colonies reached 70 mm diameter after 4 days on PDA at room temperature, serrated edge, off white, sparse aerial hyphae on the surface appearing radiant, turning grey after sporulation.

Material examined: China, Hainan Province, Wuzhishan city, Shuiman Town, Yongxun village, from the spots on base stem of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (YJ11-0708);

Notes:

Based on multigene analyses, Neopestalotiopsis oblatespora is closely related to Neopestalotiopsis guajavicola (FMBCC 11.4), only 2 bp difference between them (1/476 in ITS, 1/378 in tef-1α). However, N. oblatespora is distinct from N. guajavicola with sporulation structure (branched conidiophores of N. oblatespora vs. conidiomata of N. guajavicola); smaller spore (N. oblatespora: 18-23×5.5-6.7 μm,

\bar{x}

=20.2×6.2 μm vs. N. guajavicola 21.7-24.9×6-7 μm,

\bar{x}

=23.3×6.5 μm); shorter apical appendages (N. oblatespora: 10-26.5 μm,

\bar{x}

=18 μm vs. N. guajavicola : 19.1-24.5 μm,

\bar{x}

=21.8 μm); additionally, having 2-4 apical appendages, while N. guajavicola carrying 2-3 appendages. Moreover, N. oblatespora has no significant recombination with its closely taxa according to the PHI test. Therefore, N. oblatespora is classified as a new species at present study.

Neopestalotiopsis olivaceous X.F. Cui and Z.G. Hao, sp. nov. (Figure 7)

Etymology: named referring to the color of colony.

Holotype: LF25-0709.

Description:

Conidiomata not observed on PDA. Conidia sometimes aggregate into globose, dark green. Conidiophore branches, with spore scars. Conidia, fusiform, straight to obviously irregular curved, 21.5-33.8×5.5-7.7 μm (

\bar{x}

=26.5×6.3 μm), 4 septate; basal cell conical, hyaline or pale olive, smooth, thin-walled, 2.7-6.2 μm long (

\bar{x}

=4.5 μm); three median cells 14 to 21.7 μm long (

\bar{x}

=17 μm), pale olivaceous to olivaceous, concolorous, wall rugose, septa darker than the rest of the cell; second cell from base, pale olivaceous to olivaceous, 3.3 to 8.5 μm long (

\bar{x}

=5.9 μm); third cell, pale olivaceous to olivaceous, 4 to 6.5 μm long (

\bar{x}

=5.1 μm); fourth cell, pale olivaceous to olivaceous, 4 to 6.5 μm long (

\bar{x}

=5.4 μm); apical cell 3.5 to 5.5 μm long (

\bar{x}

=4.5 μm), hyaline, conic to acute; with 2 to 5 (often 3-4) tubular appendages on the apical cell, inserted at different loci in a crest at the apex of the apical cell, unbranched, 9.5 to 22.5 μm (

\bar{x}

=14 μm) long; single basal appendage, occasionally no, unbranched, tubular, centric or lateral, 1.2 to 4.8 μm (

\bar{x}

=2.4 μm) long. Sexual morph not observed.

Culture characteristics: The colonies reached 70 mm diameter on PDA after 7 days growth at room temperature. Colonies appeared circular, white above, medium dense, aerial hyphae on the surface flat; and its reverse was olivaceous, gradually deepened over time.

Material examined: China, Hainan Province, Qiongzhong city, Changzheng Town, Luofan village, from leaf spots of A. oxyphylla, 9 July 2022, X.F. Cui and Z.G. Hao (LF25-0709, holotype); ex-type, Hainan Province, Baoting city, Shiling Town, Shuixian village, from leaf spots of A. oxyphylla, 6 July 2022, X.F. Cui and Z.G. Hao (SX33-0706); Hainan Province, Wuzhishan city, Shuiman Town, Yongxun village, from leaf spots of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (YX45-0708).

Notes: Three strains of Neopestalotiopsis olivaceous were isolated from three cities of Hainan, LF25-0709, SX33-0706 and YX45-0708, clustered with well-supported (ML=99%, BI=1). N. olivaceous clusters a sister group with N. amoni (HKAS 124563) and N. zingiberis (GUCC 21001). Molecularly, N. olivaceous can be differed from N. amoni (HKAS 124563) and N. zingiberis (GUCC 21001) according to ITS~ tef-1α~tub2 (1/471 of ITS, 6/347 of TEF with N. amoni; 3/447 of ITS, 14/722 of TUB and 13/358 of TEF with N. zingiberis). Morphologically, N. olivaceous is distinguished with longer conidia (21.5-33.8 μm of N. olivaceous vs. 18-30 μm of N. amoni and 21-31 μm of N. zingiberis), different numbers of apical appendages (2-5 tubular appendages of N. olivaceous vs. 2-3 of N. amoni and 1-3 of N. zingiberis) and longer apical appendages (N. olivaceous 9.5-22.5 μm vs. N. amoni 7-17 μm and N. zingiberis 12-15 μm). The result of PHI test showed no significant recombination among N. olivaceous and its closely taxa. Thus, N. olivaceous is classified as a new species at present study.

Neopestalotiopsisoxyphylla X.F. Cui and Z.G. Hao, sp. nov. (Figure 8)

Etymology: named referring to the host species, Alpinia oxyphylla.

Holotype: LF55-0709.

Description:

Conidiomata solitary or aggregated, globose, dark, often immersed in PDA. Conidiophores distinct, often degenerated to conidiogenous cells. Conidiogenous cells spherical, hyaline. Conidia, fusiform, straight to slightly curved, 18.8-23.5×5.3-7.0 μm (

\bar{x}

=21×6.2 μm), 4 septate; basal cell conical to subcylindrical, hyaline, thin and smooth-walled, 2.3-5 μm long (

\bar{x}

=3.9 μm); three median cells, 11.3-15 μm (

\bar{x}

=13 μm), versicolor, brown to dark brown, septa and periclinal walls darker than the rest of the cell, wall with verrucae; second cell from base pale brown, paler than the other two cells, 3.3-5.2 μm long (

\bar{x}

=4.1 μm), third cell dark brown, darker than the other two, 3.5-5.0 μm long (

\bar{x}

=4.1 μm), fourth pale brown to brown, 3.7-5.4 μm long (

\bar{x}

=4.4 μm); apical cell 2.8-5 μm long (

\bar{x}

=3.8 μm), conic to acute, hyaline, thin and smooth-walled; with 2-4 tubular appendages on the apical cell (often 2-3), arising from the apex of the apical cell, occasionally branched, flexuous, 10-25.3 μm long (

\bar{x}

=18.6 μm); single basal appendage, unbranched, tubular, centric, 2.5-8 μm long (

\bar{x}

=5 μm). Sexual morph not observed.

Culture characteristics: The colonies reached 70 mm diameter after 9 days on PDA at room temperature, edge circular, off white, dense, central aerial hyphae on the surface raised, with filiform margin; fruit bodies black; reverse similar in color.

Material examined: China, Hainan Province, Qiongzhong city, Changzheng Town, Luofan village, from leaf spots of A. oxyphylla, 9 July 2022, X.F. Cui and Z.G. Hao (LF55-0709, holotype); ex-type, Hainan Province, Wuzhishan city, Maoyang Town, Maohui village, from base stem spots of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (MJ31-0708); ex-type, Hainan Province, Baoting city, Nanmao Shengli Farm, from leaf spots of A. oxyphylla, 6 July 2022, X.F. Cui and Z.G. Hao (NM44-0706).

Notes:

Based on multigene analyses, Neopestalotiopsis oxyphylla is closely related to N. brachiata (MFLUCC 17-1555), N. elaeidis (MFLUCC 15-0735), N. petila (MFLUCC 17-1738), N. aotearoa (CBS 367.54) and N. piceana (CBS 394.48), only 0-2 bp difference among them. However, N. oxyphylla is distinct from N. elaeidis with larger spore (N. oxyphylla: 18.8-23.5×5.3-7.0 μm,

\bar{x}

=21×6.2 μm vs. N. elaeidis 10-20×3-7 μm,

\bar{x}

=16×5.5 μm) and thinner spore (N. oxyphylla: 5.3-7.0 μm vs. N. aotearoa: 6.5–8.5 μm and N. piceana 7.5–9 μm); N. oxyphylla has different numbers of apical appendages (N. oxyphylla: 2-4; N. brachiata: 1-3; N. aotearoa, N. elaeidis and N. petila: 2-3; N. piceana: 3), and shorter apical appendages(N. oxyphylla: 10-25.3 μm vs. N. brachiata: 9.5-33; N. petila: 22-29 μm, N. piceana: 21-31 μm), but longer than N. aotearoa (5-12 μm). In addition, N. oxyphylla has shorter basal appendage (N. oxyphylla: 2.5-8 μm vs. N. piceana: 6-23 μm). Therefore, N. oxyphylla is classified as a new species at present study.

Neopestalotiopsis wuzhishanensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 9)

Etymology: named referring to the first collection city of Wuzhishan in Hainan province.

Holotype: YX116-0708.

Description:

Conidiomata on PDA solitary, globose, dark. Conidiophores often degenerated to conidiogenous cells. Conidiogenous cells unclear. Conidia, fusiform, straight, scarcely curved, 19.5-26.5×4.5-6.3 μm (

\bar{x}

=22.4×5.2 μm), 4 septate; basal cell conical to subcylindrical, hyaline, thin and smooth-walled, 2.8-5.5 μm long (

\bar{x}

=4.2 μm); three median cells, 12.8-16 μm (

\bar{x}

=14.4 μm), nearly concolor, pale brown, hyaline, septa and periclinal walls darker than the rest of the cell; second cell from base pale brown , 4-6.2 μm long (

\bar{x}

=5.1 μm), third cell pale brown, 3.5-5.2 μm long (

\bar{x}

=4.4 μm), fourth pale brown, 3.8-6.3 μm long (

\bar{x}

=4.7 μm); apical cell 2.7-5.5 μm long (

\bar{x}

=3.6 μm), conic to acute, hyaline, thin and smooth-walled; with 1-3 tubular appendages on the apical cell (often 1-2), arising from the apex of the apical cell, unbranched, strairht to flexuous, 9-20.8 μm long (

\bar{x}

=15.4 μm); single or no basal appendage, unbranched, tubular, centric, 0.8-3.8 μm long (

\bar{x}

=1.9 μm). Sexual morph not observed.

Culture characteristics: The colonies reached 70 mm diameter after 12 days on PDA at room temperature, edge circular, white, medium dense, aerial hyphae on the surface flat, with filiform margin; fruit bodies black. And its reverse was lemon-yellow.

Material examined: China, Hainan Province, Wuzhishan city, Shuiman Town, Yongxun village, from leaf spot of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (YX116-0708).

Notes:

Neopestalotiopsis wuzhishanensis clusters a sister group to Neopestalotiopsis cubana (CBS 600.96). While, N. wuzhishanensis is different from N. cubana depending on ITS, tef-1α and tub2 sequences (3/481 in ITS, 4/446 in tef-1α, 3/720 in tub2). Additionally, there are remarkably discrepancies in morphological characteristics, N. wuzhishanensis is thinner (N. wuzhishanensis: 4.5-6.3 μm,

\bar{x}

=5.2 μm vs. N. cubana 8-9.5 μm,

\bar{x}

=8.8 μm), shorter in apical appendages (N. wuzhishanensis: 9-20.8 μm,

\bar{x}

=15.4 μm vs. N. cubana: 21-27 μm,

\bar{x}

=24 μm) and base appendage (N. wuzhishanensis: 0.8-3.8 μm,

\bar{x}

=1.9 μm vs. N. cubana: 4-7 μm); additionally, three media cells of N. wuzhishanensis are paler than N. cubana; furthermore, N. cubana having 1-3 apical appendages, while N. cubana carrying 2-4 appendages. The result of PHI test showed that N. wuzhishanensis has no significant recombination with their closely taxa. Therefore, N. wuzhishanensis is classified as a new species at present study.

Neopestalotiopsis yongxunensis X.F. Cui and Z.G. Hao, sp. nov. (Figure 10)

Etymology: named referring to the first collection village of Yongxun in Hainan province.

Holotype: YX101-0708.

Description:

Conidiomata on PDA solitary or aggregated, globose, dark, embedded or semi-immersed. Conidiophores often degenerated to conidiogenous cells. Conidiogenous cells unclear. Conidia, fusiform, straight to curved, 18.2-25.5×5.8-7.5 μm (

\bar{x}

=21.6×6.6 μm), 4 septate; basal cell conical, hyaline, thin and smooth-walled, 3.0-5.2 μm long (

\bar{x}

=4.1 μm); three median cells, 12-15.2 μm (

\bar{x}

=13.7 μm), versicolor, pale brown to brown, septa and periclinal walls darker than the rest of the cell; second cell from base pale brown, paler than the other two cells, 3.5-5.3 μm long (

\bar{x}

=4.3 μm), third cell brown, darker than the other two, 3.8-5.3 μm long (

\bar{x}

=4.6 μm), fourth cell brown, 4.0-5.2 μm long (

\bar{x}

=4.6 μm); apical cell 2.5-5.0 μm long (

\bar{x}

=3.7 μm), conic to subcylindrical, hyaline, thin and smooth-walled; with 2-4 tubular appendages on the apical cell, arising from the apex of the apical cell, filiform, unbranched, strairht to flexuous, 10.5-24.7 μm long (

\bar{x}

=18.2 μm); single basal appendage, unbranched, tubular, centric, 1.7-7 μm long (

\bar{x}

=4.2 μm). Sexual morph not observed.

Culture characteristics: The colonies reached 70 mm diameter after 4 days on PDA at room temperature, edge circular, white, dense aerial mycelium on the surface; reverse similar in color. Fruit bodies black, mostly under the hyphae, visible on the back.

Material examined: China, Hainan Province, Wuzhishan city, Shuiman Town, Yongxun village, from leaf spot of A. oxyphylla, 8 July 2022, X.F. Cui and Z.G. Hao (YX101-0708);

Notes:

Neopestalotiopsis yongxunensis is related to N. dendrobii (MFLUCC 14-0106) and N. paeonia-suffruticosa (HKAS 123212) in the phylogenetic analysis. While, N. yongxunensis can be differed from N. dendrobii and N. paeonia-suffruticosa depending on ITS, tef1-α and tub2 sequences, 7 bp difference (2/284 in tef1-α, 5/441 in tub2) with N. dendrobii and 10 bp difference (9/440 in tef1-α, 1/740 in tub2) with N. paeonia-suffruticosa. In addition, there are remarkably discrepancies in morphological characteristics, N. yongxunensis is thinner in conidia (N. yongxunensis: 5.8-7.5 μm,

\bar{x}

=6.6 μm vs. N. paeonia-suffruticosa: 9-11 μm,

\bar{x}

=9.5 μm), has different numbers of apical appendages (N. yongxunensis 2-4 vs. N. paeonia-suffruticosa 3-4) and shorter apical appendages (N. yongxunensis: 10.5-24.7 μm vs. N. paeonia-suffruticosa 22.5-34 μm). While N. yongxunensis differs from N. dendrobii in having longer apical appendages (N. yongxunensis: 10.5-24.7 μm vs. N. dendrobii 5-6.5 μm) with different numbers (N. yongxunensis 2-4 vs. N. dendrobii 2-3). Furthermore, the PHI test indicates that there is no significant recombination between N. yongxunensis and its closely species. Therefore, N. yongxunensis is classified as a new species at present study.

3.4. Pathogenicity Assay

Sixteen of the 20 tested Pestalotioid isolates were able to cause typical brown lesions after inoculation, while the other 4 isolates did not, including Neopestalotiopsis sp.4 MH133-0708, N. coffeae-arabicae NM42-0706, N. oblatespora YJ11-0708 and Neopestalotiopsis sp.3 SX11-0706. The lesion areas measured 5 days after inoculation were 54.02, 13.86, 15.57, 4.65, 11.08, 117.40, 100.63, 82.31, 8.55, 80.25, 32.03, 7.02, 104.86, 84.48, 102.04 and 16.17 mm² for isolates of P. hydei BA11-0708, Ps. myanmarina JR34-0709, Ps. avicenniae LF48-0709, N. coffeae-arabicae BL32-0708, N. coffeae-arabicae LF51-0709, N. cubana MH51-0708, N. cubana YX112-0708, N. wuzhishanensis YX116-0708, N. yongxunensis YX101-0708, N. baotingensis SX41-0706, N. vaccinii JR31-0709, N. rosicola NM47-0708, N. oxyphylla LF55-0709, N. brachiata SX31-0706, Neopestalotiopsis sp.5 XC11-0709 and N. olivaceous LF25-0709, respectively (Figure 11). The morphology of purified fungi re-isolated from the lesion of inoculation was identical with those of the isolateds used for inoculation, which were also confirmed by PCR and gene sequences. The results of pathogenicity and phylogenetic analysis showed that the strains close to N. cubana and N. brachiata had stronger pathogenicity (Figure 1 and Figure 11B).

4. Discussion

In this study, 36 pestalotioid strains were isolated. According to multi-locus phylogeny (ITS, tef-1α and tub2) and morphological characteristics analyses, one Pestalotiopsis sp, two Pseudopestalotiopsis spp., and 14 Neopestalotiopsis spp. were identified. Six new species (N. baotingensis, N. oblatespora, N. olivaceous, N. oxyphylla, N. wuzhishanensis and N. yongxunensis) were described. Among 36 strains, the isolation frequency of N. coffeae-arabicae and N. cubana was both 16.67%, higher than the others；additionally, N. coffeae-arabicae, N. olivaceous and N. oxyphylla were isolated from 5, 3 and 3 cities separately, with more widely distribution in Hainan than others. This is the first systematic report of Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis fungi related with A. oxyphylla in its main planted area.

The development of molecular biology has greatly facilitated the identification of microorganisms, and the phylogeny analyses of combined ITS, tef-1α and tub2 can better distinguish Neopestalotiopsis, Pestalotiopsis and Pseudopestalotiopsis. For example, N. olivaceous and N. wuzhishanensis in this study do not conform to the morphological characteristics of versicolorous median cells depicted in Neopestalotiopsis. This phenomenon was also mentioned by Sun et al [16], so the phylogeny analyses can overcome the discrimination of the three genera only by intermediate color cells. While the three gene sequences of N. oxyphylla, N. aotearoa and N. brachiata are closely similar only with 0-2 bp difference of the combined sequence, also between N. oblatespora and N. guajavicola with 2 bp difference, while they have obvious discrepancy in morphological characteristics. Similar phenomenon was observed between N. alpapicalis MFLUCC 17-2544^T and N. rhizophorae MFLUCC 17-1551^T [41]. Therefore, more gene fragments need to be introduced in order to further differentiate closly related species of pestalotioid fungi.

RLB disease is an important disease in the cultivation process of A. oxyphylla according to previous reports. Its pathogen was reported as Pestalotia palmarum in 1986[11], now classified as Pestalotiopsis palmarum. While the ring brown spot (RBS) disease with similar symptom to RLB disease was caused by Pestalosphaeria alpinia, the sexual morph of Pestalotioid, reported in 1994[25]. Perhaps due to the differences in classification method and limitation on sample size, P. palmarum and P. alpinia were not isolated in this study，which explained the potential diversity of pestalotioid fungi in this host needed to be further explored. In addition, the symptoms of RLB and RBS disease are similar both caused by pestalotioid fungi with different morph, so it is recommended to merge the two diseases into one for future research and disease management.

Through the pathogenicity tests of 20 pestalotioid strains, most species can cause obvious symptoms on the leaves indicating the diversity pathogen of RLB disease, and the Neopestalotiopsis species (the lesion area over 75 mm² of 7 species) were more tended to infect A. oxyphylla and caused more serious disease than Pestalotiopsis (the lesion area about 50 mm²) and Pseudopestalotiopsis (less than 50 mm² both of the two). The reports that the disease caused by Neopestalotiopsis fungi were more in recent years [16]. In addition, all pathogenicity tests were carried out with a single cultivar of A. oxyphylla and constant environmental conditions. As we all know, differences in varieties and changes in environmental conditions can both affect the occurrence of diseases. Therefore, more attempts need to be performed on different varieties under different environmental conditions.

What is worth noting is that most of pestalotioid species have a broad range of hosts, and one species of pestalotioid species can infect several economic plants, while a plant can be harmed by several pestalotioid fungi. For example, N. cubana can infect rubber trees [96], Camellia oleifera [17] and Ixora chinensis [97], and a new leaf fall disease of rubber trees was caused by N. aotearoa, N. cubana and N. formicarum [96]. A. oxyphylla is a semi-shade plant mainly planted under rubber forests. In this study, 6 strains of N. cubana, one strain of Neopestalotiopsis sp.3 SX11-0706 clustered with N. formicarum and 5 strains (N. oxyphylla, N. brachiata and Neopestalotiopsis sp.5 XC11-0709) closely related to N. aotearoa were isolated. It refers that some pestalotioid species may infect both rubber tree and A. oxyphylla. The promotion of cultivation medicinal plant under the forest should also pay attention to the occurrence of cross-infection diseases, in order to prevent them in advance.

A comprehensive understanding of the species and genetic diversity of pathogens is the foundation for sustainable disease management. Since there is no research about the resistance varieties of A. oxyphylla to RLB disease. The strains with different characteristics and pathogenicity isolated in this study may provide a material basis for subsequent screening of resistant varieties, including highly active biological and chemical agents friendly to the environment.

Author Contributions

Formal analysis, Xiufen Cui; Methodology, Zhigang Hao and Yingbin Li; Resources, Xiufen Cui, Zhigang Hao and Jinan Zhang; Software, Shuang Song; Supervision, Jianqiang Li, Yixiang Liu and Laixin Luo; Visualization, Menghuai Chen; Writing – original draft, Xiufen Cui. All authors read and approved the manuscript.

Data Availability Statement

All data supporting the findings discussed in this article can be obtained from the corresponding author upon reasonable request.

Acknowledgements

This work was supported by the Major Science and Technology Project in Yunnan Province (202102AE090042-02) and the leading fund project of Sanya Research Institute of China Agricultural University (SYND-2022-11).

Conflict of Interest

The authors declare no conflict of interest.

References

Qiu, L.Y. Investigation of germplasm resources of Alpinia oxyphylla Miq. in Hainan Island. Master's thesis，Hainan University, Hainan, China, 2015.
Pharmacopoeia of the People's Republic of China. Alpiniae oxyphyllae fructus; The Medicine Science and Technology Press of China, China, 2020, 1, 303.
Zhang, Q.; Zheng, Y.L.; Hu, X.J.; Hu, X.L.; Lv, W.W.; Lv, D.; Chen, J.J.; Wu, M.L.; Song, Q.C.; Shentu, J.Z. Ethnopharmacological uses, phytochemistry, biological activities, and therapeutic applications of Alpinia oxyphylla Miguel: A review. Journal of Ethnopharmacology 2018, 224, 149-168. [CrossRef]
Zhang, J.Q.; Wang, S.; Li, Y.H.; Xu, P.; Chen, F.; Tan, Y.F.; Duan, J.A. Anti-diarrheal constituents of Alpinia oxyphylla. Fitoterapia 2013, 89, 149-156. [CrossRef]
Zhou, J.Z.; Zhang, K.; Zhang, L.Y.; Xian, Q.Q.; Sun, P.Z.; Du, Z.Y. Geographical distribution and prediction of potential region of Alpinia oxyphylla Miq. Anhui Agric. Sci．2018, 46, 1-3+8. [CrossRef]
Wang, Y.F. Exploration of metabolites and related genes of volatile oil from wild Alpinia oxyphylla Miq. in Hainan Province. Central University for Nationalities, Beijing, China, 2022.
Chen, L.Z.; Liufu, Y.Q.; Lin, S.C.; Xian, S.Q. Analysis of the basic biological characteristics and high yield cultivation techniques of Alpinia oxyphylla Miq. South China Agriculture 2018, 12, 27+29. [CrossRef]
Zhang, C.; Wu, Y.G.; Yang, H.G.; Yao, G.L.; Zhang, J.F.; Yu, J.; Yang, D.M.; Chen, P. The current planting situation and industrial development countermeasures of Alpinia oxyphylla Miq. in Hainan Province. Modern Horticulture 2021, 44, 63-67. [CrossRef]
He, H.M. Analysis of biological characteristics and environment for high production of Alpinia Oxyphylla. Chinese Journal of Mordern Applied Pharmacy 1992, 205-207.
Yan, X.X.; Ren, B.L.; Wang, M.Y.; Wang, Q.L.; Yang, Q.; Tang, H.; Wang, Z.N. Present situation and development strategy of Alpinia oxyphylla. China Journal of Chinese Materia Medica 2019, 44, 1960-1964. [CrossRef]
Hong, X.Q.; Chen, J.J. Three important new diseases of Alpinia oxyphylla Miq. Chinese Journal of Tropical Agriculture 1986, 50-53.
Xu, X.R.; Zhou, J.; Wu, X.P.; Lei, X.T. The main diseases and pests of Alpinia oxyphylla and their prevention and control. China Tropical Agriculture 2012, 48, 56-58.
Fu, M.Y.; Zeng, X.P.; Rui, K.; Wang, H.F.; Chen, M.C. The occurrence and control of the leaf blight disease of Alpinia oxyphylla in Hainan Island. Modern Agricultural Science and Technology 2015, 655, 170-171.
Maharachchikumbura, S.S.N.; Guo, L.D.; Cai, L.; Chukeatirote, E.; Wu, W.P.; Sun, X.; Crous, P.W.; Bhat, D.J.; McKenzie, E.H.C.; Bahkali, A.H.; et al. A multi-locus backbone tree for Pestalotiopsis, with a polyphasic characterization of 14 new species. Fungal Diversity 2012, 56, 95-129. [CrossRef]
Maharachchikumbura, S.S.N.; Hyde, K.D.; Groenewald, J.Z.; Xu, J.; Crous, P.W. Pestalotiopsis revisited. Studies in Mycology 2014, 121-186. [CrossRef]
Sun, Y.R.; Jayawardena, R.S.; Sun, J.E.; Wang, Y. Pestalotioid species associated with medicinal plants in southwest China and Thailand. Microbiology Spectrum 2023, 11, e0398722. [CrossRef]
Li, L.L.; Yang, Q.; Li, H. Morphology, phylogeny, and pathogenicity of pestalotioid species on Camellia oleifera in China. Journal of Fungi 2021, 7, 1080. [CrossRef]
Diogo, E.; Goncalves, C.I.; Silva, A.C.; Valente, C.; Braganca, H.; Phillips, A.J.L. Five new species of Neopestalotiopsis associated with diseased Eucalyptus spp. in Portugal. Mycological Progress 2021, 20, 1441-1456. [CrossRef]
Lin, H.F.; Chen, T.H.; Liu, S.D. Bioactivity of antifungal substance iturin a produced by Bacillus subtilis strain BS-99-H against Pestalotiopsis eugeniae, a causal pathogen of wax apple fruit rot. Plant Pathology Bulletin 2010, 19, 225-233.
Prasannath, K.; Shivas, R.G.; Galea, V.J.; Akinsanmi, O.A. Neopestalotiopsis species associated with flower diseases of Macadamia integrifolia in Australia. Journal of Fungi 2021, 7, 771. [CrossRef]
Tsai, I.; Chung, C.L.; Lin, S.R.; Hung, T.H.; Shen, T.L.; Hu, C.Y.; Hozzein, W.N.; Ariyawansa, H.A. Cryptic diversity, molecular systematics, and pathogenicity of genus Pestalotiopsis and allied genera causing gray blight disease of tea in Taiwan, With a description of a new Pseudopestalotiopsis species. Plant Disease 2021, 105, 425-443. [CrossRef]
Maharachchikumbura, S.S.N.; Larignon, P.; Hyde, K.D.; Al-Sadi, A.M.; Liu, Z.Y. Characterization of Neopestalotiopsis, Pestalotiopsis and Truncatella species associated with grapevine trunk diseases in France. Phytopathologia Mediterranea 2016, 55, 380-390. [CrossRef]
Ayoubi, N.; Soleimani, M.J. Strawberry fruit rot caused by Neopestalotiopsis iranensis sp nov., and N. mesopotamica. Current Microbiology 2016, 72, 329-336. [CrossRef]
Chamorro, M.; Aguado, A.; De los Santos, B. First report of root and crown rot caused by Pestalotiopsis clavispora (Neopestalotiopsis clavispora) on strawberry in Spain. Plant Disease 2016, 100, 1495-1495. [CrossRef]
Maharachchikumbura, S.S.N.; Guo, L.D.; Chukeatirote, E.; Bahkali, A.H.; Hyde, K.D. Pestalotiopsis-morphology, phylogeny, biochemistry and diversity. Fungal Diversity 2011, 50, 167-187. [CrossRef]
Qi, P.K. Fungal diseases of cultivated medicinal plants in Guangdong Province; Guangdong Science and Technology Press: Guangdong, China, 1994.
Jeewon, R.; Liew, E.C.Y.; Hyde, K.D. Phylogenetic relationships of Pestalotiopsis and allied genera inferred from ribosomal DNA sequences and morphological characters. Molecular Phylogenetics and Evolution 2002, 25, 378-392. [CrossRef]
Jeewon, R.; Liew, E.C.Y.; Simpson, J.A.; Hodgkiss, I.J.; Hyde, K.D. Phylogenetic significance of morphological characters in the taxonomy of Pestalotiopsis species. Molecular Phylogenetics and Evolution 2003, 27, 372-383. [CrossRef]
Gualberto, G.F.; Catarino, A.D.; Sousa, T.F.; Cruz, J.C.; Hanada, R.E.; Caniato, F.F.; Silva, G.F. Pseudopestalotiopsis gilvanii sp. nov. and Neopestalotiopsis formicarum leaves spot pathogens from guarana plant: a new threat to global tropical hosts. Phytotaxa 2021, 489, 121-139. [CrossRef]
He, Y.K.; Yang, Q.; Sun, Y.R.; Zeng, X.Y.; Jayawardena, R.S.; Hyde, K.D.; Wang, Y. Additions to Neopestalotiopsis (Amphisphaeriales, Sporocadaceae) fungi: two new species and one new host record from China. Biodiversity Data Journal 2022, 10, e90709. [CrossRef]
Li, W.L.; Dissanayake, A.J.; Zhang, T.; Maharachchikumbura, S.S.N.; Liu, J.K. Identification and pathogenicity of pestalotioid fungi associated with woody oil plants in Sichuan Province, China. Journal of Fungi 2022, 8. [CrossRef]
Prematunga, C.J.Y., L.Q.; Gomdola, D.; Balasuriya, A.; Yang, Y.H.; Jayawardena, R.S.; Luo, M. An addition to pestalotioid fungi in China: Neopestalotiopsis fragariae sp. nov. causing leaf spots on Fragaria × ananassa. Asian Journal of Mycology 2022, 5, 220-238, https://asianjournalofmycology.org/pdf/AJOM_5_2_10-1.
Yang, Q.; He, Y.K.; Yuan, J.; Wang, Y. Two new Pseudopestalotiopsis species isolated from Celtis sinensis and Indocalamus tessellatus plants in southern China. Phytotaxa 2022, 543, 274-282. [CrossRef]
Yang, Q.; Zeng, X.Y.; Yuan, J.; Zhang, Q.; He, Y.K.; Wang, Y. Two new species of Neopestalotiopsis from southern China. Biodiversity Data Journal 2021, 9. [CrossRef]
White, T.J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pcr Protocols, Academic Press, Inc, 1990, 315-322.
Carbone, I.; Kohn, L.M. A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 1999, 91, 553-556. [CrossRef]
O'Donnell, K.; Kistler, H.C.; Cigelnik, E.; Ploetz, R.C. Multiple evolutionary origins of the fungus causing Panama disease of banana: Concordant evidence from nuclear and mitochondrial gene genealogies. Proceedings of the National Academy of Sciences of the United States of America 1998, 95, 2044-2049. [CrossRef]
Glass, N.L.; Donaldson, G.C. Development of primer sets designed for use with the PCR to amplify conserved genes from filamentous ascomycetes. Applied and Environmental Microbiology 1995, 61, 1323-1330. [CrossRef]
Odonnell, K.; Cigelnik, E. Two divergent intragenomic rDNA ITS2 types within a monophyletic lineage of the fungus Fusarium are nonorthologous. Molecular Phylogenetics and Evolution 1997, 7, 103-116. [CrossRef]
Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171-180. [CrossRef]
Norphanphoun, C.; Jayawardena, R.S.; Chen, Y.; Wen, T.C.; Meepol, W.; Hyde, K.D. Morphological and phylogenetic characterization of novel pestalotioid species associated with mangroves in Thailand. Mycosphere 2019, 10, 531-578. [CrossRef]
Kumar, V.; Cheewangkoon, R.; Gentekaki, E.; Maharachchikumbura, S.S.N.; Brahmanage, R.S.; Hyde, K.D. Neopestalotiopsis alpapicalis sp. nov. a new endophyte from tropical mangrove trees in Krabi Province (Thailand). Phytotaxa 2019, 393, 251-262. [CrossRef]
Bezerra, J.D.P.; Machado, A.R.; Firmino, A.L.; Rosado, A.W.C.; de Souza, C.A.F.; de Souza-Motta, C.M.; Freire, K.; Paiva, L.M.; Magalhaes, O.M.C.; Pereira, O.L.; et al. Mycological diversity description I. Acta Botanica Brasilica 2018, 32, 656-666. [CrossRef]
Jiang, N.; Fan, X.; Tian, C. Identification and characterization of leaf-inhabiting fungi from Castanea Plantations in China. Journal of Fungi (Basel, Switzerland) 2021, 7. [CrossRef]
Liu, X.F.; Tibpromma, S.; Zhang, F.; Xu, J.C.; Chethana, K.W.T.; Karunarathna, S.C.; Mortimer, P.E. Neopestalotiopsis cavernicola sp. nov. from Gem Cave in Yunnan Province, China. Phytotaxa 2021, 512, 1-27. [CrossRef]
Tibpromma, S.; Hyde, K.D.; McKenzie, E.H.C.; Bhat, D.J.; Phillips, A.J.L.; Wanasinghe, D.N.; Samarakoon, M.C.; Jayawardena, R.S.; Dissanayake, A.J.; Tennakoon, D.S.; et al. Fungal diversity notes 840–928: micro-fungi associated with Pandanaceae. Fungal Diversity 2018, 93, 1-160. [CrossRef]
Song, Y.; Geng, K.; Zhang, B.; Hyde, K.D.; Zhao, W.S.; Wei, J.G.; Kang, J.C.; Wang, Y. Two new species of Pestalotiopsis from Southern China. Phytotaxa 2013, 126, 22-30. [CrossRef]
Peng, C.; Crous, P.W.; Jiang, N.; Fan, X.; Liang, Y.; Tian, C. Diversity of Sporocadaceae (pestalotioid fungi) from rosa in China. Persoonia 2022, 49, 201-260. [CrossRef]
Ma, X.Y.; Maharachchikumbura, S.S.N.; Chen, B.W.; Hyde, K.D.; McKenzie, E.H.C.; Chomnunti, P.; Kang, J.C. Endophytic pestalotioid taxa in Dendrobium orchids. Phytotaxa 2019, 419, 268-286. [CrossRef]
Crous, P.W.; Wingfield, M.J.; Le Roux, J.J.; Richardson, D.M.; Strasberg, D.; Shivas, R.G.; Alvarado, P.; Edwards, J.; Moreno, G.; Sharma, R.; et al. Fungal Planet description sheets: 371-399. Persoonia 2015, 35, 264-327. [CrossRef]
Konta, S.; Tibpromma, S.; Karunarathna, S.C.; Samarakoon, M.C.; Steven, L.S.; Mapook, A.; Boonmee, S.; Senwanna, C.; Balasuriya, A.; Eungwanichayapant, P.D.; et al. Morphology and multigene phylogeny reveal ten novel taxa in Ascomycota from terrestrial palm substrates (Arecaceae) in Thailand. Mycosphere 2023, 14, 107-152. [CrossRef]
Ul Haq, I.; Ijaz, S.; Khan, N.A. Genealogical concordance of phylogenetic species recognition-based delimitation of Neopestalotiopsis species associated with leaf spots and fruit canker disease affected guava plants. Pakistan Journal of Agricultural Sciences 2021, 58, 1301-1313. [CrossRef]
Zhang, Z.; Liu, R.; Liu, S.; Mu, T.; Zhang, X.; Xia, J. Morphological and phylogenetic analyses reveal two new species of Sporocadaceae from Hainan, China. MycoKeys 2022, 88, 171-192. [CrossRef]
Freitas, E.F.S.; Da Silva, M.; Barros, M.V.P.; Kasuya, M.C.M. Neopestalotiopsis hadrolaeliae sp. nov., a new endophytic species from the roots of the endangered orchid Hadrolaelia jongheana in Brazil. Phytotaxa 2019, 416, 211-220. [CrossRef]
Huanaluek, N.; Jayawardena, R.S.; Maharachchikum-Bura, S.S.N.; Harishchandra, D.L. Additions to pestalotioid fungi in Thailand: Neopestalotiopsis hydeana sp. nov. and Pestalotiopsis hydei sp. nov. Phytotaxa 2021, 479, 23-43. [CrossRef]
Akinsanmi, O.A.; Nisa, S.; Jeff-Ego, O.S.; Shivas, R.G.; Drenth, A. Dry flower disease of macadamia in Australia caused by Neopestalotiopsis macadamiae sp. nov. and Pestalotiopsis macadamiae sp. nov. Plant Disease 2017, 101, 45-53. [CrossRef]
Maharachchikumbura, S.S.; Guo, L.D.; Chukeatirote, E.; Hyde, K.D. Improving the backbone tree for the genus Pestalotiopsis; addition of P. steyaertii and P. magna sp. nov. Mycological Progress 2014, 13, 617-624. [CrossRef]
Crous, P.W.; Wingfield, M.J.; Chooi, Y.H.; Gilchrist, C.L.M.; Lacey, E.; Pitt, J.I.; Roets, F.; Swart, W.J.; Cano-Lira, J.F.; Valenzuela-Lopez, N.; et al. Fungal Planet description sheets: 1042-1111. Persoonia 2020, 44, 301-459. [CrossRef]
Liu, F.; Bonthond, G.; Groenewald, J.Z.; Cai, L.; Crous, P.W. Sporocadaceae, a family of coelomycetous fungi with appendage-bearing conidia. Studies in Mycology 2019, 92, 287-415. [CrossRef]
Silverio, M.L.; Calvacanti, M.A.d.Q.; Silva, G.A.d.; Oliveira, R.J.V.d.; Bezerra, J.L. A new epifoliar species of Neopestalotiopsis from Brazil. Agrotropica 2016, 28, 151-158.
Crous, P.W.; Summerell, B.A.; Swart, L.; Denman, S.; Taylor, J.E.; Bezuidenhout, C.M.; Palm, M.E.; Marincowitz, S.; Groenewald, J.Z. Fungal pathogens of Proteaceae. Persoonia 2011, 27, 20-45. [CrossRef]
Chaiwan, N.; Jeewon, R.; Pem, D.; Jayawardena, R.S.; Nazurally, N.; Mapook, A.; Promputtha, I.; Hyde, K.D. Fungal species from Rhododendron sp.: Discosia rhododendricola sp. nov, Neopestalotiopsis rhododendricola sp. nov. and Diaporthe nobilis as a new host record. Journal of Fungi (Basel, Switzerland) 2022, 8. [CrossRef]
Ariyawansa, H.A.; Hyde, K.D. Additions to Pestalotiopsis in Taiwan. Mycosphere 2018, 9, 999-1013. [CrossRef]
Santos, J.; Hilario, S.; Pinto, G.; Alves, A. Diversity and pathogenicity of pestalotioid fungi associated with blueberry plants in Portugal, with description of three novel species of Neopestalotiopsis. European Journal of Plant Pathology 2022, 162, 539-555. [CrossRef]
Fiorenza, A.; Gusella, G.; Aiello, D.; Polizzi, G.; Voglmayr, H. Neopestalotiopsis siciliana sp. nov. and N. rosae causing stem lesion and dieback on avocado plants in Italy. Journal of Fungi 2022, 8. [CrossRef]
Jayawardena, R.S.; Liu, M.; Maharachchikumbura, S.S.N.; Zhang, W.; Xing, Q.; Hyde, K.D.; Nilthong, S.; Li, X.; Yan, J. Neopestalotiopsis vitis sp. nov. causing grapevine leaf spot in China. Phytotaxa 2016, 258, 63-74. [CrossRef]
Liu, X.F.; Tibpromma, S.; Hughes, A.C.; Chethana, K.W.T.; Wijayawardene, N.N.; Dai, D.Q.; Du, T.Y.; Elgorban, A.M.; Stephenson, S.L.; Suwannarach, N.; et al. Culturable mycota on bats in central and southern Yunnan Province, China. Mycosphere 2023, 14, 497-662. [CrossRef]
Liu, F.; Hou, L.w.; Raza, M.; Cai, L. Pestalotiopsis and allied genera from Camellia, with description of 11 new species from China. Scientific Reports 2017, 7. [CrossRef]
Gu, R.; Bao, D.F.; Shen, H.W.; Su, X.J.; Li, Y.X.; Luo, Z.L. Endophytic Pestalotiopsis species associated with Rhododendron in Cangshan Mountain, Yunnan Province, China. Frontiers in Microbiology 2022, 13. [CrossRef]
Crous, P.W.; Boers, J.; Holdom, D.; Osieck, E.R.; Steinrucken, T.V.; Tan, Y.P.; Vitelli, J.S.; Shivas, R.G.; Barrett, M.; Boxshall, A.G.; et al. Fungal Planet description sheets: 1383–1435. Persoonia 2022, 48, 261-371. [CrossRef]
Ariyawansa, H.A.; Hyde, K.D.; Jayasiri, S.C.; Buyck, B.; Chethana, K.W.T.; Dai, D.Q.; Dai, Y.C.; Daranagama, D.A.; Jayawardena, R.S.; Lucking, R.; et al. Fungal diversity notes 111-252-taxonomic and phylogenetic contributions to fungal taxa. Fungal Diversity 2015, 75, 27-274. [CrossRef]
Chaiwan, N.; Wanasinghe, D.N.; Mapook, A.; Jayawardena, R.S.; Norphanphoun, C.; Hyde, K.D. Novel species of Pestalotiopsis fungi on Dracaena from Thailand. Mycology 2020, 11, 306-315. [CrossRef]
Liu, J.K.; Hyde, K.D.; Jones, E.B.G.; Ariyawansa, H.A.; Bhat, D.J.; Boonmee, S.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Phookamsak, R.; Phukhamsakda, C.; et al. Fungal diversity notes 1-110: taxonomic and phylogenetic contributions to fungal species. Fungal Diversity 2015, 72, 1-197. [CrossRef]
Silva, N.; Maharachchikumbura, S.; Thambugala, K.; Bhat, D.J.; Hyde, K.D. Morpho-molecular taxonomic studies reveal a high number of endophytic fungi from Magnolia candolli and M. garrettii in China and Thailand. Mycosphere 2021, 12, 163–237.
Yan, M.Z.; Maharachchikumbura, S.; Tian, Q.; Hyde, K.D. Pestalotiopsis species on ornamental plants in Yunnan Province, China. Sydowia -Horn 2013, 65, 113–128.
Maharachchikumbura, S.S.N.; Chukeatirote, E.; Guo, L.D.; Crous, P.W.; Mckenzie, E.H.C.; Hyde, K.D. Pestalotiopsis species associated with Camellia sinensis (tea). Mycotaxon 2013, 123, 47-61(15). [CrossRef]
Monteiro, P.; Gonçalves, M.F.M.; Pinto, G.; Silva, B.; Martín-García, J.; Diez, J.J.; Alves, A. Three novel species of fungi associated with pine species showing needle blight-like disease symptoms. European Journal of Plant Pathology 2022, 162, 183-202. [CrossRef]
Hyde, K.D.; Jeewon, R.; Chen, Y.-J.; Bhunjun, C.S.; Calabon, M.S.; Jiang, H.-B.; Lin, C.-G.; Norphanphoun, C.; Sysouphanthong, P.; Pem, D.; et al. The numbers of fungi: is the descriptive curve flattening? Fungal Diversity 2020, 103, 219-271. [CrossRef]
Das, K.; Lee, S.Y.; Jung, H.Y. Pestalotiopsis kaki sp. nov., a Novel species isolated from persimmon tree (Diospyros kaki) Bark in Korea. Mycobiology 2020, 49, 54-60. [CrossRef]
Chen, Y.Y.; Maharachchikumbura, S.S.N.; Liu, J.K.; Hyde, K.D.; Nanayakkara, R.R.; Zhu, G.S.; Liu, Z.Y. Fungi from Asian Karst formations I. Pestalotiopsis photinicola sp nov., causing leaf spots of Photinia serrulata. Mycosphere 2017, 8, 103-110. [CrossRef]
Harishchandra, D.L.; Aluthmuhandiram, J.V.S.; Yan, J.; Hyde, K.D. Molecular and morpho-cultural characterisation of Neopestalotiopsis and Pestalotiopsis species associated with ornamental and forest plants in China. Lett Appl Microbiol 2020, 73(3), 352-362.
Zhang, Y.; Maharachchikumbura, S.S.N.; McKenzie, E.H.C.; Hyde, K.D. A novel species of Pestalotiopsis causing leaf spots of Trachycarpus fortunei. Cryptogamie Mycologie 2012, 33, 311-318. [CrossRef]
Wei, J.G.; Phan, C.K.; Wang, L.; Xu, T.; Luo, J.T.; Sun, X.; Guo, L.D. Pestalotiopsis yunnanensis sp. nov., an endophyte from Podocarpus macrophyllus (Podocarpaceae) based on morphology and ITS sequence data. Mycological Progress 2013, 12, 563-568. [CrossRef]
Maharachchikumbura, S.S.N.; Guo, L.D.; Liu, Z.Y.; Hyde, K.D. Pseudopestalotiopsis ignota and Ps. camelliae spp. nov associated with grey blight disease of tea in China. Mycological Progress 2016, 15. [CrossRef]
Catarino, A.d.M.; Hanada, R.E.; de Queiroz, C.A.; Sousa, T.F.; Lima, Í.N.; Gasparotto, L.; da Silva, G.F. First report of Pseudopestalotiopsis dawaina causing spots in Caryota mitis in Brazil. Plant Disease 2020, 104, 989. [CrossRef]
Nozawa, S.; Ando, K.; Phay, N.; Watanabe, K. Pseudopestalotiopsis dawaina sp. nov. and Ps. kawthaungina sp. nov.: two new species from Myanmar. Mycological Progress 2018, 17, 865-870. [CrossRef]
Tsai, I.; Maharachchikumbura, S.S.N.; Hyde, K.D.; Ariyawansa, H.A. Molecular phylogeny, morphology and pathogenicity of Pseudopestalotiopsis species on Ixora in Taiwan. Mycological Progress 2018, 17, 941-952. [CrossRef]
Lateef, A.A.; Sepiah, M.; Bolhassan, M.h. Description of Pseudopestalotiopsis kubahensis sp. nov., a new species of microfungi from Kubah National Park, Sarawak, Malaysia. Current Research in Environmental & Applied Mycology 2015. 5, 376–381.
Nozawa, S.; Yamaguchi, K.; Yen, L.T.H.; Hop, D.V.; Phay, N.; Ando, K.; Watanabe, K. Identification of two new species and a sexual morph from the genus Pseudopestalotiopsis. Mycoscience 2017, 58, 328-337. [CrossRef]
Song, Y.; Tangthirasunun, N.; Maharachchikumbura, S.S.N.; Jiang, Y.L.; Xu, J.J.; Hyde, K.D.; Wang, Y. Novel Pestalotiopsis species from Thailand point to the rich undiscovered diversity of this chemically creative genus. Cryptogamie Mycologie 2014, 35, 139-149. [CrossRef]
Miller, M.A.; Pfeiffer, W.T.; Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In Proceedings of the Gateway Computing Environments Workshop (GCE), New Orleans, LA, USA, 2010, 1-8. [CrossRef]
Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 2003, 19, 1572-1574. [CrossRef]
Quaedvlieg, W.; Binder, M.; Groenewald, J.Z.; Summerell, B.A.; Carnegie, A.J.; Burgess, T.I.; Crous, P.W. Introducing the consolidated species concept to resolve species in the Teratosphaeriaceae. Persoonia 2014, 33, 1-40. [CrossRef]
Bruen, T.C.; Philippe, H.; Bryant, D. A simple and robust statistical test for detecting the presence of recombination. Genetics 2006, 172, 2665-2681. [CrossRef]
Huson, D.H.; Bryant, D. Application of phylogenetic networks in evolutionary studies. Molecular Biology and Evolution 2006, 23, 254-267. [CrossRef]
Pornsuriya, C.; Chairin, T.; Thaochan, N.; Sunpapao, A. Identification and characterization of Neopestalotiopsis fungi associated with a novel leaf fall disease of rubber trees (Hevea brasiliensis) in Thailand. Journal of Phytopathology 2020, 168, 416-427. [CrossRef]
Khoo, Y.W.; Tan, H.T.; Khaw, Y.S.; Li, S.F.; Chong, K.P. First report of Neopestalotiopsis cubana causing leaf blight on Ixora chinensis in Malaysia. Plant Disease 2022, 106, 2749-2749. [CrossRef]

Figure 1. RAxML tree of Neopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The roots of this tree are Pestalotiopsis diversiseta MFLUCC 12-0287 and P. colombiensis CBS 118553. The strains isolated in this study are marked in red. Ex-type strains are marked with ^T. ML bootstrap values ≥50% and BI probabilities (in red) ≥0.90 are displayed at the nodes.

Figure 2. RAxML tree of Pestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is N. cubana CBS 600.9. The strains isolated in this study are marked in red. Ex-type strains are marked with ^T. ML bootstrap values ≥50% and BI probabilities (in red) ≥0.90 are displayed at the nodes.

Figure 3. RAxML tree of Pseudopestalotiopsis isolates based on ITS, tef-1α and tub2 sequences. The root of this tree is P. trachycaroicola OP068. The strains isolated in this study are marked in red. Ex-type strains are marked with ^T. ML bootstrap values ≥50% and BI probabilities (in red) ≥0.90 are displayed at the nodes.

Figure 4. Split graphs showing the result of PHI test of new Neopestalotiopsis species with their most closely related species. The new species in each graph is shown in red font.

Figure 5. Neopestalotiopsis baotingensis (SX41-0706, holotype). (a-b) Colony on PDA (above and reverse), (c-d) Conidiomata on PDA, (e-f) Conidiogenous cells, (g-l) Conidia. Scale bars = 10 μm.

Figure 6. Neopestalotiopsis oblatespora (YJ11-0708, holotype). (a-b) Colony on PDA (above and reverse), (c) Conidia pile on PDA, (d-e) Conidiophores, (f-k) Conidia. Scale bars = 10 μm.

Figure 7. Neopestalotiopsis olivaceous (LF25-0709, holotype). (a-b) Colony on PDA (above and reverse), (c) Conidia pile on PDA, (d) Conidiophores, (e-l) Conidia. Scale bars = 10 μm.

Figure 8. Neopestalotiopsis oxyphylla (LF55-0709, holotype). (a-b) Colony on PDA (above and reverse), (c) Conidiomata on PDA, (d-e) Conidiogenous cells, (f-k) Conidia. Scale bars = 10 μm.

Figure 9. Neopestalotiopsis wuzhishanensis (YX116-0708, holotype). (a-b) Colony on PDA (above and reverse), (c) Conidiomata on PDA, (d-e) Conidiogenous cells, (f-k) Conidia. Scale bars = 10 μm.

Figure 10. Neopestalotiopsis yongxunensis (YX101-0708, holotype). (a-b) Colony on PDA (above and reverse), (c) Conidiomata on PDA, (d-e) Conidiogenous cells, (f-k) Conidia. Scale bars = 10 μm.

Figure 11. Pathogenicity test results of 20 pestalotioid species on Alpinia oxyphylla leaves. (A) symptoms on leaves after 5 days. Icons in figures in sequence are CK, P. hydei BA11-0708, Ps. myanmarina JR34-0709, Ps. avicenniae LF48-0709, N. coffeae-arabicae BL32-0708, N. coffeae-arabicae LF51-0709, Neopestalotiopsis sp.4 MH133-0708, N. coffeae-arabicae NM42-0706, N. cubana MH51-0708, N. cubana YX112-0708, N. wuzhishanensis YX116-0708, N. yongxunensis YX101-0708, N. baotingensis SX41-0706, N. oblatespora YJ11-0708, N. vaccinii JR31-0709, N. rosicola NM47-0708, N. oxyphylla LF55-0709, N. brachiata, SX31-0706, Neopestalotiopsis sp.5 XC11-0709, N. olivaceous LF25-0709, Neopestalotiopsis sp.3 SX11-0706. (B) Pathogenicity of the isolates was evaluated by measuring area of the necrotic lesions after 5 days. Error bars indicate the standard deviation of the mean. Significant differences (p < 0.05) are indicated with different letters according to Duncan’s multiple range test. The abscissa designation corresponds sequentially to (A), excluding “CK”.

Table 1. PCR primers and procedures used in this study.

Locus	Primes Name	Sequence (5’to 3’)	PCR procedures	Reference
ITS	ITS5	GGAAGTAAAAGTCGTAACAAGG	95°C 5 min; 94°C 25 s; 52°C 25 s; 72°C 10 s; repeat 2 to 4 for 35 cycles; 72°C 5 min; 4°C on hold	[35]
ITS	ITS4	TCCTCCGCTTATTGATATGC		[35]
tef-1α	EF1-728F	CATCGAGAAGTTCGAGAAGG	95°C 5 min; 94°C 25 s; 52°C 25 s; 72 °C 10 s (15s); repeat 2 to 4 for 35 cycles; 72°C 5 min; 4°C on hold	[36,37]
	EF1-526F	GTCGTYGTYATYGGHCAYGT
	EF2	GGARGTACCAGTSATCATGTT
tub2	T1	AACATGCGTGAGATTGTAAGT	95°C 5 min; 94°C 25 s; 55°C 25 s; 72°C 15 s; repeat 2 to 4 for 35 cycles; 72°C 5 min; 4°C on hold	[38,39]
tub2	Bt2b	ACCCTCAGTGTAGTGACCCTTGGC		[38,39]

Table 2. The strains information and their genes’ accession numbers of pestalotioid species used in this study.

Taxonomic status	Strain No.	Host/Substrate	Origin	Gen Bank Accessions Numbers			References
Taxonomic status	Strain No.	Host/Substrate	Origin	ITS	tub 2	tef-lα	References
Neopestalotiopsis acrostichi	MFLUCC 17-1754^T	Acrostichum aureum	Thailand	MK764272	MK764338	MK764316	[41]
N. acrostichi	MFLUCC 17-1755	Acrostichum aureum	Thailand	MK764273	MK764339	MK764317	[41]
N. alpapicalis	MFLUCC 17-2544^T	Rhizophora mucronata	Thailand	MK357772	MK463545	MK463547	[42]
N. alpapicalis	MFLUCC 17-2545	Rhizophora mucronata	Thailand	MK357773	MK463546	MK463548	[42]
N. amomi	HKAS 124563^T	Amomum villosum	China	OP498012	OP752133	OP653489	[16]
N. amomi	HKAS 124564	Amomum villosum	China	OP498013	OP765913	OP753382	[16]
N. aotearoa	CBS 367.54^T	Canvas	New Zealand	KM199369	KM199454	KM199526	[14]
N. asiatica	MFLUCC 12-0286^T	Prunus dulcis	China	JX398983	JX399018	JX399049	[15]
N. australis	CBS 114159^T	Telopea sp.	Australia	KM199348	KM199432	KM199537	[15]
N. brachiata	MFLUCC 17-1555	Rhizophora apiculata	Thailand	MK764274	MK764340	MK764318	[41]
N. brasiliensis	COAD 2166^T	Psidium guajava	Brazil	MG686469	MG692400	MG692402	[43]
N. brasiliensis	CFCC 54341	Castanea mollissima	China	MW166229	MW218522	MW199748	[44]
N. camelliae-oleiferae	CSUFTCC81^T	Camellia oleifera	China	OK493585	OK562360	OK507955	[17]
N. camelliae-oleiferae	CSUFTCC82	Camellia oleifera	China	OK493586	OK562361	OK507956	[17]
N. cavernicola	KUMCC 20-0269^T	Cave	China	MW545802	MW557596	MW550735	[45]
N. chiangmaiensis	MFLUCC 18–0113	Pandanus sp.	Thailand	NA	MH412725	MH388404	[46]
N. chrysea	MFLUCC 12-0261^T	Dead leaves	China	JX398985	JX399020	JX399051	[14]
N. chrysea	MFLUCC 12-0262	Dead leaves	China	JX398986	JX399021	JX399052	[14]
N. clavispora	MFLUCC 12-0281^T	Magnolia sp.	China	JX398979	JX399014	JX399045	[14]
N. clavispora	MFLUCC 12-0280	Magnolia sp.	China	JX398978	JX399013	JX399044	[14]
N. cocoes	MFLUCC 15-0152^T	Cocos nucifera	Thailand	KX789687	NA	KX789689	[41]
N. coffeae-arabicae	HGUP4015	Coffea arabica	China	KF412647	KF412641	KF412644	[47]
N. coffeae-arabicae	HGUP4019^T	Coffea arabica	China	KF412649	KF412643	KF412646	[47]
N. concentrica	CFCC 55162^T	Rosa chinensis	China	OK560707	OM117698	OM622433	[48]
N. cubana	CBS 600.96^T	Leaf litter	Cuba	KM199347	KM199438	KM199521	[15]
N. dendrobii	MFLUCC 14-0106^T	Dendrobium cariniferum	Thailand	MK993571	MK975835	MK975829	[49]
N. dendrobii	MFLUCC 14-0099	Dendrobium cariniferum	Thailand	MK993570	MK975834	MK975828	[49]
N. drenthii	BRIP 72263a	Macadamia integrifolia	Australia	MZ303786	MZ312679	MZ344171	[20]
N. drenthii	BRIP 72264a^T	Macadamia integrifolia	Australia	MZ303787	MZ312680	MZ344172	[20]
N. egyptiaca	CBS 140162^T	Mangifera indica	Egypt	KP943747	KP943746	KP943748	[50]
N. elaeagni	HGUP10002^T	Elaeagnus pungens	China	MW930716	MZ683391	MZ203452	[30]
N. elaeidis	MFLUCC 15-0735	Elaeis guineensis	Thailand	ON650689	NA	ON734012	[51]
N. ellipsospora	MFLUCC 12-0283^T	Dead plant	China	JX398980	JX399016	JX399047	[14]
N. eucalyptorum	CBS 147684^T	Eucalyptus globulus	Portugal	MW794108	MW802841	MW805397	[18]
N. eucalypticola	CBS 264.37^T	Eucalyptus globulus	NA	KM199376	KM199431	KM199551	[15]
N. fragariae	ZHKUCC 22-0115	Fragaria x ananassa	China	ON651146	ON685199	ON685197	[32]
N. foedans	CGMCC 3.9123^T	Mangrove plant	China	JX398987	JX399022	JX399053	[14]
N. foedans	CGMCC 3.9178	Neodypsis decaryi	China	JX398989	JX399024	JX399055	[14]
N. formicarum	CBS 362.72^T	Dead ant	Cuba	KM199358	KM199455	KM199517	[15]
N. formicarum	CBS 115.83	Plant debris	Cuba	KM199344	KM199444	KM199519	[15]
N. guajavae	FMBCC 11.1^T	Psidium guajava	Pakistan	MF783085	MH460871	MH460868	[52]
N. guajavicola	FMBCC 11.4^T	Psidium guajava	Pakistan	MH209245	MH460873	MH460870	[52]
N. haikouensis	SAUCC212271^T	Ilexchinensis sp.	China	OK087294	OK104870	OK104877	[53]
N. hadrolaeliae	COAD 2637^T	Hadrolaelia jongheana	Brazil	MK454709	MK465120	MK465122	[54]
N. hispanica	CBS 147686^T	Eucalyptus globulus	Portugal	MW794107	MW802840	MW805399	[18]
N. honoluluana	CBS 114495^T	Telopea sp.	USA	KM199364	KM199457	KM199548	[15]
N. hydeana	MFLUCC 20-0132^T	Artocarpus heterophyllus	Thailand	MW266069	MW251119	MW251129	[55]
N. hyperici	HKAS 124561	Hypericum monogynum	China	OP498010	OP765908	OP713768	[16]
N. iberica	CBS 147688^T	Eucalyptus globulus	Portugal	MW794111	MW802844	MW805402	[18]
N. javaensis	CBS 257.31^T	Cocos nucifera	Indonesia	KM199357	KM199437	KM199543	[15]
N. lusitanica	CBS 147690^T	Eucalyptus globulus	Portugal	MW794110	MW802843	MW805406	[18]
N. longiappendiculata	CBS 147692^T	Eucalyptus globulus	Portugal	MW794112	MW802845	MW805404	[18]
N. macadamiae	BRIP 63737c^T	Macadamia integrifolia	Australia	KX186604	KX186654	KX186627	[56]
N. macadamiae	BRIP 63742a	Macadamia integrifolia	Australia	KX186599	KX186657	KX186629	[56]
N. maddoxii	BRIP 72266a^T	Macadamia integrifolia	Australia	MZ303782	MZ312675	MZ344167	[56]
N. magna	MFLUCC 12-0652^T	Pteridium sp.	France	KF582795	KF582793	KF582791	[57]
N. mesopotamica	CBS 336.86^T	Pinus brutia	Iraq	KM199362	KM199441	KM199555	[15]
N. mesopotamica	CBS 299.74	Eucalyptus sp.	Turkey	KM199361	KM199435	KM199541	[15]
N. mianyangensis	HKAS 123211	Paeonia suffruticosa	China	OP546681	OP672161	OP723490	[31]
N. musae	MFLUCC 15-0776^T	Musa sp.	Thailand	KX789683	KX789686	KX789685	[41]
N. natalensis	CBS 138.41^T	Acacia mollissima	South Africa	KM199377	KM199466	KM199552	[15]
N. nebuloides	BRIP 66617^T	Sporobolus elongatus	Australia	MK966338	MK977632	MK977633	[58]
N. olumideae	BRIP 72273a^T	Macadamia integrifolia	Australia	MZ303790	MZ312683	MZ344175	[20]
N. paeoniea	CBS 318.74	Anacardium occidentale	Nigeria	MH554031	MH554707	NA	[59]
N. paeonia-suffruticosa	HKAS 123212^T	Paeonia suffruticosa	China	OP082292	OP235980	OP204794	[31]
N. pernambucana	URM 7148-01^T	Vismia guianensis	Brazil	KJ792466	NA	KU306739	[60]
N. perukae	FMBCC11.3^T	Guava	Pakistan	MH209077	MH460876	MH523647	[52]
N. petila	MFLUCC 17-1737	Rhizophora mucronata	Thailand	MK764275	MK764341	MK764319	[41]
N. petila	MFLUCC 17-1738^T	Rhizophora mucronata	Thailand	MK764276	MK764342	MK764320	[41]
N. phangngaensis	MFLUCC 18-0119^T	Pandanus sp.	Thailand	MH388354	MH412721	MH388390	[46]
N. piceana	CBS 254.32	Cocos nucifera	Indonesia	KM199372	KM199452	KM199529	[15]
N. piceana	CBS 394.48^T	Picea sp.	UK	KM199368	KM199453	KM199527	[15]
N. photiniae	MFLUCC 22-0129^T	Photinia serratifolia	China	OP498008	OP752131	OP753368	[16]
N. protearum	CBS 114178^T	Leucospermum cuneiforme	Zimbabwe	JN712498	KM199463	LT853201	[61]
N. psidii	FMBCC 11.2^T	Psidium guajava	Pakistan	MF783082	MH477870	MH460874	[52]
N. rhapidis	GUCC 21501^T	Rhododendron simsii	China	MW931620	MW980441	MW980442	[34]
N. rhizophorae	MFLUCC 17-1551^T	Rhizophora mucronata	Thailand	MK764277	MK764343	MK764321	[41]
N. rhizophorae	MFLUCC 17 1550	Rhizophora mucronata	Thailand	MK764278	MK764344	MK764322	[41]
N. rhododendri	GUCC 21504^T	Rhododendron simsii	China	MW979577	MW980443	MW980444	[34]
N. rhododendricola	KUN-HKAS-123204^T	Rhododendron sp.	China	OK283069	OK274147	OK274148	[62]
N. rosae	CBS 101057^T	Rosa sp.	New Zealand	KM199359	KM199429	KM199523	[15]
N. rosicola	CFCC 51992^T	Rosa chinensis	China	KY885239	KY885245	KY885243	[63]
N. rosicola	CFCC 51993	Rosa chinensis	China	KY885240	KY885246	KY885244	[63]
N. samarangensis	CBS 115451	Unidentified Tree	China	KM199365	KM199447	KM199556	[15]
N. saprophytica	MFLUCC 12-0282^T	Magnolia sp.	China	JX398982	JX399017	JX399048	[15]
N. scalabiensis	CAA 1029^T	Vaccinium corymbosum	Portugal	MW969748	MW934611	MW959100	[64]
N. sichuanensis	CFCC 54338^T	Castanea mollissima	China	MW166231	MW218524	MW199750	[44]
N. siciliana	AC46	Persea americana	Italy	ON117813	ON209162	ON107273	[65]
N. sonneratae	MFLUCC 17-1744	Sonneronata alba	Thailand	MK764279	MK764345	MK764323	[41]
N. sonneratae	MFLUCC 17-1745^T	Sonneronata alba	Thailand	MK764280	MK764346	MK764324	[41]
N. steyaertii	IMI 192475^T	Eucalyptus viminalis	Australia	KF582796	KF582794	KF582792	[15]
N. surinamensis	CBS 450.74^T	Soil under Elaeis guineensis	Suriname	KM199351	KM199465	KM199518	[15]
N. subepidermalis	CFCC 55160	Rosa chinensis	China	OK560699	OM117690	OM622425	[48]
N. suphanburiensis	MFLUCC 22-0126^T	Unknown	Thailand	OP497994	OP752135	OP753372	[16]
N. terricola	HKAS 123213	Paeonia suffruticosa	China	OP082294	OP235982	OP204796	[31]
N. thailandica	MFLUCC 17-1730^T	Rhizophora mucronata	Thailand	MK764281	MK764347	MK764325	[41]
N. thailandica	MFLUCC 17-1731	Rhizophora mucronata	Thailand	MK764282	MK764348	MK764326	[41]
N. umbrinospora	MFLUCC 12-0285^T	Unidentified plant	China	JX398984	JX399019	JX399050	[14]
N. vaccinii	CAA 1059^T	Vaccinium corymbosum	Portugal	MW969747	MW934610	MW959099	[64]
N. vacciniicola	CAA 1055^T	Vaccinium corymbosum	Portugal	MW969751	MW934614	MW959103	[64]
N. vheenae	BRIP 72293a^T	Macadamia integrifolia	Australia	MZ303792	MZ312685	MZ344177	[20]
N. vitis	MFLUCC 15-1265^T	Vitis vinifera cv. “Summer black”	China	KU140694	KU140685	KU140676	[66]
N. vitis	MFLUCC 15-1270	Vitis vinifera cv. “Kyoho”	China	KU140699	KU140690	KU140681	[66]
N. xishuangbannaensis	KUMCC 21-0424^T	Kerivoula hardwickii (Bat)	China	ON426865	OR025934	OR025973	[67]
N. xishuangbannaensis	KUMCC 21-0425	Kerivoula hardwickii (Bat)	China	ON426866	OR025935	OR025974	[67]
N. zakeelii	BRIP 72282a^T	Macadamia integrifolia	Australia	MZ303789	MZ312682	MZ344174	[20]
N. zimbabwana	CBS 111495^T	Leucospermum cunciforme	Zimbabwe	NA	KM199456	KM199545	[15]
N. zingiber	GUCC 21001^T	Zingiber officinale	China	MW930715	MZ683390	MZ683389	[34]
Neopestalotiopsis sp.2	CFCC 54340	Castanea mollissima	China	MW166235	MW218528	MW199754	[44]
Neopestalotiopsis sp.2	ZX22B	Castanea mollissima	China	MW166236	MW218529	MW199755	[44]
Neopestalotiopsis sp. nov.	GUCC 210003	Unknown	China	MW930717	MZ683392	MZ540914	[34]
Neopestalotiopsis sp.1	CFCC 54337	Castanea mollissima	China	MW166233	MW218526	MW199752	[44]
Neopestalotiopsis sp.1	ZX121	Castanea mollissima	China	MW166234	MW218527	MW199753	[44]
Pestalotiopsis adusta	ICMP 6088^T	Refrigerator door	Fiji	JX399006	JX399037	JX399070	[14]
P. adusta	MFLUCC 10-0146	Syzygium sp.	Thailand	JX399007	JX399038	JX399071	[14]
P. aggestorum	LC6301^T	Camellia sinensis	China	KX895015	KX895348	KX895234	[68]
P. appendiculata	CGMCC 3.23550^T	Rhododendron sp.	China	OP082431	OP185516	OP185509	[69]
P. australasiae	CBS 114126^T	Knightia sp.	New Zealand	KM199297	KM199409	KM199499	[15]
P. australasiae	CBS 11141	Protea sp.	New Sout Wales	KM199298	KM199410	KM199501	[15]
P. australis	CBS 114193^T	Grevillea sp.	New South Wales	KM199332	KM199383	KM199475	[15]
P. biciliata	CBS 124463^T	Platanus×hispanica	Slovakia	KM199308	KM199399	KM199505	[15]
P. brachiata	LC2988^T	Camellia sp.	China	KX894933	KX895265	KX895150	[14]
P. brassicae	CBS 170.26^T	Brassica napus	New Zealand	KM199379	NA	KM199558	[15]
P. camelliae	MFLUCC 12-0277^T	Camellia japonica	China	JX399010	JX399041	JX399074	[14]
P. camelliae-oleiferae	CSUFTCC08^T	Camellia oleifera	China	OK493593	OK562368	OK507963	[17]
P. chamaeropis	CBS 186.71^T	Chamaerops humilis	Italy	KM199326	KM199391	KM199473	[14]
P. chiangmaiensis	MFLUCC 22-0127^T	Phyllostachys edulis	Thailand	OP497990	OP752137	OP753374	[16]
P. chiaroscuro	BRIP 72970	Sporobolus natalensis	Australia	OK422510	OK423752	OK423753	[70]
P. clavata	MFLUCC 12-0268^T	Buxus sp.	China	JX398990	JX399025	JX399056	[14]
P. colombiensis	CBS 118553^T	Eucalyptus eurograndis	Colombia	KM199307	KM199421	KM199488	[15]
P. daliensis	CGMCC 3.23548^T	Rhododendron sp.	China	OP082429	OP185518	OP185511	[69]
P. diploclisiae	CBS 115587^T	Diploclisia glaucescens	China	KM199320	KM199419	KM199486	[15]
P. diversiseta	MFLUCC 12-0287^T	Rhododendron sp.	China	NR 120187	JX399040	JX399073	[14]
P. dracaenae	HGUP4037^T	Dracaena fragrans	China	NA	MT598645	MT598644	[71]
P. dracaenicola	MFLUCC 18-0913^T	Dracaena sp.	Thailand	MN962731	MN962733	MN962732	[72]
P. dracontomelon	MFUCC 10-0149^T	Dracontomelon dao	Thailand	KP781877	NA	KP781880	[73]
P. endophytica	MFLUCC 18-0932	Endophytic on healthy leaves of Magnolia candoll	Thailand	NR 172439	NA	MW417119	[74]
P. ericacearum	IFRDCC 2439^T	Rhododendron delavayi	China	KC537807	KC537821	KC537814	[75]
P. etonensis	BRI P 66615	Sporobolus jacquemontii	Australia	MK966339	MK977634	MK977635	[58]
P. formosana	NTUCC 17-009^T	dead grass	China	MH809381	MH809385	MH809389	[63]
P. furcata	MFLUCC 12-0054^T	Camellia sinensis	Thailand	JQ683724	JQ683708	JQ683740	[76]
P. fusoidea	CGMCC 3.23545^T	Endophytic in fresh Rhododendron delavayi leaves.	China	OP082427	OP185519	OP185512	[69]
P. grevilleae	CBS 114127^T	Grevillea sp.	Australia	KM199300	KM199407	KM199504	[15]
P. hawaiiensis	CBS 114491^T	Leucospermum sp.	Hawaii	KM199339	KM199428	KM199514	[15]
P. hispanica	CBS 115391^T	Protea ‘Susara’	Spain	MH553981	MH554640	MH554399	[59]
P. hydei	MFLUCC 20-0135^T	Litsea Petiolata	Thailand	MW266063	MW251112	MW251113	[55]
P. hydei	GUCC 21-0816	dead twigs	China	OP753660	OP765909	OP753383	[16]
P. hollandica	CBS 265.33^T	Sciadopitys verticillata	Netherlands	KM199328	KM199388	KM199481	[15]
P. humus	CBS 336.97^T	Soil	Papua New Guinea	KM199317	KM199420	KM199484	[15]
P. hunanensis	CSUFTCC15^T	Camellia oleifera	China	OK493599	OK562374	OK507969	[17]
P. iberica	CAA1006^T	Pinus radiata	Spain	MW732249	MW759036	MW759039	[77]
P. inflexa	MFLUCC 12-0270^T	Unidentified tree	China	JX399008	JX399039	JX399072	[14]
P. intermedia	MFLUCC 12-0259^T	Unidentified tree	China	JX398993	JX399028	JX399059	[14]
P. jiangxiensis	LC4399^T	Eurya sp.	China	KX895009	KX895341	KX895227	[68]
P. jinchanghensis	LC6636^T	Camellia sinensis	China	KX895028	KX895361	KX895247	[68]
P. kandelicola	NCYU 19-0355^T	Kandelia candel	China	MT560722	MT563099	MT563101	[78]
P. kaki	KNU-PT-1804^T	Diospyros kaki	Korea	LC552953	LC552954	LC553555	[79]
P. kenyana	CBS 442.67^T	Coffea sp.	Kenya	KM199302	KM199395	KM199502	[15]
P. kenyana	CBS 911.96	raw material from agar-agar	NA	KM199303	KM199396	KM199503	[15]
P. knightiae	CBS 114138^T	Knightia sp.	New Zealand	KM199310	KM199408	KM199497	[15]
P. knightiae	CBS 111963	Knightia sp.	New Zealand	KM199311	KM199406	KM199495	[15]
P. linearis	MFLUCC 12-0271	Trachelospermum sp.	China	JX398992	JX399027	JX399058	[14]
P. loeiana	MFLUCC 22-0123	dead leaves	Thailand	OP497988	OP713769	OP737881	[16]
P. lushanensis	LC4344^T	Camellia sp.	China	KX895005	KX895337	KX895223	[68]
P. macadamiae	BRIP 63738B^T	Macadamia integrifolia	Australia	KX186588	KX186680	KX186621	[56]
P. malayana	CBS 102220^T	Macaranga triloba	Malaysia	KM199306	KM199411	KM199482	[15]
P. monochaeta	CBS 144.97^T	Quercus robur	Netherlands	KM199327	KM199386	KM199479	[15]
P. jesteri	MFLUCC 12-0279^T	Fagraea bodenii	China	JX399012	JX399043	JX399076	[14]
P. nanjingensis	CSUFTCC16^T	Camellia oleifera	China	OK493602	OK562377	OK507972	[17]
P. nanningensis	CSUFTCC10^T	Camellia oleifera	China	OK493596	OK562371	OK507966	[17]
P. neolitseae	NTUCC 17-011^T	Neolitsea villosa	Taiwan	MH809383	MH809387	MH809391	[63]
P. oryzae	CBS 353.69^T	Oryza sativa	Denmark	KM199299	KM199398	KM199496	[15]
P. papuana	CBS 331.96^T	Coastal soil	Papua New Guinea	KM199321	KM199413	KM199491	[15]
P. photinicola	GZCC 16-0028^T	Photinia serrulata	China	KY092404	KY047663	KY047662	[80]
P. rhizophorae	MFLUCC 17-0416^T	Rhizophora apiculata	Thailand	MK764283	MK764349	MK764327	[41]
P. rhodomyrtus	HGUP4230^T	Rhodomyrtus tomentosa	China	KF412648	KF412642	KF412645	[47]
P. rosarioides	CGMCC 3.23549^T	Rhododendron decorum	China	OP082430	OP185520	OP185513	[69]
P. rosea	MFLUCC 12-0258^T	Pinus sp.	China	JX399005	JX399036	JX399069	[14]
P. scoparia	CBS176.25^T	Chamaecyparis sp.	NA	KM199330	KM199393	KM199478	[15]
P. shandogensis	JZB340038^T	unknow	China	MN625275	MN626729	MN626740	[81]
P. smilacicola	MFLUCC 22-0125^T	Smilax sp.	Thailand	OP497991	OP762673	OP753376	[16]
P. suae	CGMCC 3.23546^T	Rhododendron delavayi	China	OP082428	OP185521	OP185514	[69]
P. telopeae	CBS 114161^T	Telopea sp.	Australia	KM199296	KM199403	KM199500	[15]
P. telopeae	CBS 114137	Protea sp.	Australia	KM199301	KM199469	KM199559	[15]
P. thailandica	MFLUCC 17-1616^T	Rhizophora apiculata	Thailand	MK764285	MK764351	MK764329	[41]
P. trachycarpicola	OP068^T	Trachycarpus fortunei	China	JQ845947	JQ845945	JQ845946	[82]
P. unicolor	MFLUCC 12-0276^T	Rhododendron sp.	China	JX398999	JX399030	NA	[14]
P. verruculosa	MFLUCC 12-0274^T	Rhododendron sp.	China	JX398996	NA	JX399061	[14]
P. yanglingensis	LC4553^T	Camellia sinensis	China	KX895012	KX895345	KX895231	[83]
Pseudopestalotiopsis ampullacea	LC6618^T	Camellia sinensis	China	KX895025	KX895358	KX895244	[68]
Ps. annellata	NTUCC 17-030^T	Camellia sinensis	China, Taiwan	MT322087	MT321889	MT321988	[21]
Ps. avicenniae	MFLUCC 17-0434^T	Avicennia marina	Thailand	MK764287	MK764353	MK764331	[41]
Ps. camelliae	CGMCC 3.9192	Camellia sinensis	China	NA	KU562851	KU562850	[84]
Ps. camelliae-sinensis	NTUCC 18-031	Camellia sinensis	China, Taiwan	MT322047	MT321849	MT321948	[21]
Ps. camelliae-sinensis	LC3490^T	Camellia sinensis	China	KX894985	KX895316	KX895202	[68]
Ps. chinensis	NTUCC 18-066	Camellia sinensis	China, Taiwan	MT322083	MT321885	MT321984	[21]
Ps. chinensis	LC3011^T	Camellia sinensis	China	KX894937	KX895269	KX895154	[68]
Ps. chinensis	NTUCC 18-038	Camellia sinensis	China, Taiwan	MT322055	MT321857	MT321956	[21]
Ps. cocos	CBS 272.29^T	Cocos nucifera	Java	MH855069	KM199467	KM199553	[15]
Ps. celtidis	GUCC 21599^T	Celtis sinensis	China	OL423535	OL439010	OL439012	[33]
Ps. curvatispora	MFLUCC 17-1723	Rhizophora mucronata	Thailand	MK764290	MK764356	MK764334	[41]
Ps. curvatispora	MFLUCC 17-1722^T	Rhizophora mucronata	Thailand	MK764289	MK764355	MK764333	[41]
Ps. dawaina	INPA 2912	Caryota mitis	Brazil	MN096659	MN151310	MN151308	[85]
Ps. dawaina	MM14-F0015^T	unknown	Dawei, Myanmar	LC324750	LC324751	LC324752	[86]
Ps. gilvanii	INPA 2913^T	Paullinia cupana	Brazil	MN385951	MN385954	MN385957	[29]
Ps. hydeae	NTUCC 17-003.1	Diospyros sp.	China, Taiwan	MG816313	MG816323	MG816333	[87]
Ps. ignota	NN 42909^T	Camellia sinensis	China	KU500020	NA	KU500016	[84]
Ps. indica	CBS 459.78^T	Hibiscus rosa-sinensis	India	KM199381	KM199470	KM199560	[15]
Ps. indocalami	GUCC 21600^T	Indocalamus tessellatus	China	OL423536	OL439011	OL439013	[33]
Ps. ixorae	NTUCC 17-001.1^T	Lxora sp.	NA	MG816316	MG816326	MG816336	[87]
Ps. kawthaungina	MM14F0083^T	unknown	Kawthaung, Myanmar	LC324753	LC324754	LC324755	[86]
Ps. kubahensis	UMAS-KUB-P20^T	Macaranga sp.	Sarawak, Malaysia	MG818971	NA	NA	[88]
Ps. myanmarina	NBRC 112264^T	Averrhoa carambola	Dawei, Myanmar	LC114025	LC114045	LC114065	[89]
Ps. rhizophorae	MFLUCC 17-1560^T	Rhizophora apiculata	Thailand	MK764291	MK764357	MK764335	[41]
Ps. simitheae	KUMCC 17-0255	Magnolia candolli	China	MW244023	MW602387	MW273930	[74]
Ps. simitheae	MFLUCC12-0121^T	Pandanus odoratissimus	Thailand	KJ503812	KJ503815	KJ503818	[90]
Ps. solicola	CBS 386.97^T	soil in tropical forest	Papua New Guinea	MH554039	MH554715	MH554474	[59]
Ps. Taiwanensis	NTUCC 17-002.1^T	Ixora sp.	China, Taiwan	MG816319	MG816329	MG816339	[87]
Ps. Thailandica	MFLUCC 17-1724^T	Rhizophora mucronata	Thailand	MK764292	MK764358	MK764336	[41]
Ps. Thailandica	MFLUCC 17-1725	Rhizophora mucronata	Thailand	MK764293	MK764359	MK764337	[41]
Ps. Theae	MFLUCC 12-0055^T	Camellia sinensis	Thailand	JQ683727	JQ683711	JQ683743	[14]
Ps. vietnamensis	NBRC 112252	Fragaria sp.	Hue, Vietnam	LC114034	LC114054	LC114074	[89]

Holotype strains are marked with ^T.

Table 3. The conidial dimension of Pestalotioid species related to this study.

Species	Isolate Number	Conidial Size (μm)	Apical Appendages (μm)		Basal Appendage
Species	Isolate Number	Conidial Size (μm)	Number	Length	Basal Appendage
N. baotingensis	SX41-0706	18-26×5-7.2	2-4	3-30.5	2.5-10
N. Saprophytica	MFLUCC 12-0282	22–30×5–6	2-4	23–35	4-7
N. brachiata	SX31-0706	18.5-25.3×5.5-7.5	1-3	3.7-38.7	2.5-8
N. brachiata	MFLUCC 17-1555	18.5–25×5.5–6	1-3	9.5–33	4–9
N. coffeae-arabicae	BL32-0708	19.2-25.3×5.3-7	2-4	10.9-22.6	1.4-5.4
N. coffeae-arabicae	LF51-0709	17.8-24.2×5-7	2-4	6.6-21.6	2.5-6.8
N. coffeae-arabicae	NM42-0706	17.5-23.8×5.8-7.8	2-4	12.7-31	2.7-9.2
N. coffeae-arabicae	HGUP4019	16-20×5-7	2-4	11-16	3-5
N. cubana	MH51-0708	19.7-30×5-6.8	2-4	15.5-32.2	4-7.5
N. cubana	YX112-0708	21-29×5.6-7.3	2-4	18.7-36.5	3.3-10.3
N. cubana	CBS 600.96	20-25×8-9.5	2-4	21-27	4-7
N. oblatespora	YJ11-0708	18-23.2×5.5-7	2-4	10-26.5	2-9
N. guajavicola	FMBCC 11.4	23.3×6.5	2-3	21.8	4.4
N. olivaceous	LF25-0709	21.5-33.8×5.5-7.7	2-5	9.5-22.5	(0)1.2-4.8
N. amomi	HKAS 124563	18-30×4-7	2-3	7-17	2-5
N. zingiberis	GUCC 21001	21‒31×6‒9.5	1-3	12-15	0-6
N. oxyphylla	LF55-0709	18.8-23.5×5.3-7.0	2-4	10-25.3	2.5-8
N. aotearoa	CBS 367.54	21–28×6.5–8.5	2-3	5-12	1.5-4
N. elaeidis	MFLUCC 15-0735	10-20×3-7	2-3	10-20	(0)2-6
N. petila	MFLUCC 17-1738	21–26.5×6–7	2-3	22-29	3-8
N. piceana	CBS 394.48	19.5–25×7.5–9	3	21-31	6-23
N. samarangensis	MFLUCC 12-0233	18–21×6.5–7.5	3	12–18	3.5–5.2
N. rosicola	NM47-0708	16.9-24.6×5.5-7.2	2-4	10-25	1.7-7
N. rosicola	CFCC 51992	20.2-25.5×5.5-8	2-4	17-22.8	2-9.5
N. vaccinii	JR31-0709	14.5-20.6×5.5-7.4	2-3	10-22.5	1.3-5.1
N. vaccinii	CAA1059	20.9×6.4	2-3	8.9–25.3	1.7–6.6
N. hispanica	CBS 147686	24.4–25.3×7.2–7.8	3-4	19.5–22.6	5.1–15.5
N. wuzhishanensis	YX116-0708	19.5-26.5×4.5-6.3	1-3	9-20.8	(0)0.8-3.8
N. mianyangensis	UESTCC 22.0006	19–23×5.5–7	3	5.5–11	3–4
N. yongxunensis	YX101-0708	18.2-25.5×5.8-7.5	2-4	10.5-24.7	1.7-7
N. dendrobii	MFLUCC 14-0106	20.5–23×6.5–7.5	2–3	5–6.5	NA
N. paeonia-suffruticosa	CGMCC3.23554	20–23×9–11	3–4	22.5–34	3.5–7.5
P. hydei	BA11-0708	20.3-27.8×4.5-6.6	1-3	3.4-17.2	1-9.5
P. hydei	MFLUCC 20-0135	18-35×3-6	1-3	3-12	2-8
Ps. avicenniae	LF48-0709	20.8-30.7×5.8-7.9	1-3	17.2-33.3	2-7.8
Ps. avicenniae	MFLUCC 17-0434	22.5-26.5×5.5-6	1-3	15.5–28.5	3-4
Ps. myanmarina	JR34-0709	25.4-34.8×5.8-7.4	2-3	18.1-36.9	2.7-7
Ps. myanmarina	NBRC 11226	31-38.5×6.5-9	2-3	22.5-38.5	NA

Isolations in this study are in bold, references see Table 2.

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.