Submitted:
17 April 2024
Posted:
18 April 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Study Design
2.2. Sampling and Samples
2.2. Environmental Samples
2.3. DNA Extraction
2.4. Primer Design and Characterization
2.5. Sequencing and Bioinformatics
2.6. Statistical and Phylogenetic Analysis
3. Results
3.1. In Silico Testing of Designed and Commonly Used Primers
2.2. In Vitro Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
References
- Bolhuis, H.; Stal, L.J. Analysis of Bacterial and Archaeal Diversity in Coastal Microbial Mats Using Massive Parallel 16S RRNA Gene Tag Sequencing. The ISME Journal 2011, 5, 1701–1712. [Google Scholar] [CrossRef] [PubMed]
- Klindworth, A.; Pruesse, E.; Schweer, T.; Peplies, J.; Quast, C.; Horn, M.; Glöckner, F.O. Evaluation of General 16S Ribosomal RNA Gene PCR Primers for Classical and Next-Generation Sequencing-Based Diversity Studies. Nucleic Acids Research 2013, 41, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Winand, R.; Bogaerts, B.; Hoffman, S.; Lefevre, L.; Delvoye, M.; Van Braekel, J.; Fu, Q.; Roosens, N.H.; Cj, S.; Keersmaecker, D.; et al. Targeting the 16S RRNA Gene for Bacterial Identification in Complex Mixed Samples: Comparative Evaluation of Second (Illumina) and Third (Oxford Nanopore Technologies) Generation Sequencing Technologies. International Journal of Molecular Sciences Article 2019. [Google Scholar] [CrossRef] [PubMed]
- Bahram, M.; Anslan, S.; Hildebrand, F.; Bork, P.; Tedersoo, L. Brief Report Newly Designed 16S RRNA Metabarcoding Primers Amplify Diverse and Novel Archaeal Taxa from the Environment. 2018. [CrossRef]
- Casero, M.C.; Velázquez, D.; Medina-Cobo, M.; Quesada, A.; Cirés, S. Unmasking the Identity of Toxigenic Cyanobacteria Driving a Multi-Toxin Bloom by High-Throughput Sequencing of Cyanotoxins Genes and 16S RRNA Metabarcoding. Science of The Total Environment 2019, 665, 367–378. [Google Scholar] [CrossRef] [PubMed]
- Abdala Asbun, A.; Besseling, M.A.; Balzano, S.; van Bleijswijk, J.D.L.; Witte, H.J.; Villanueva, L.; Engelmann, J.C. Cascabel: A Scalable and Versatile Amplicon Sequence Data Analysis Pipeline Delivering Reproducible and Documented Results. Frontiers in Genetics 2020, 11, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Pérez Gallego, R.; Bale, N.J.; Sinninghe Damste, J.S.; Villanueva, L. Developing a Genetic Approach to Target Cyanobacterial Producers of Heterocyte Glycolipids in the Environment. Frontiers in Microbiology 2023, 14, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Kirk Harris, J.; Gregory Caporaso, J.; Walker, J.J.; Spear, J.R.; Gold, N.J.; Robertson, C.E.; Hugenholtz, P.; Goodrich, J.; McDonald, D.; Knights, D.; et al. Phylogenetic Stratigraphy in the Guerrero Negro Hypersaline Microbial Mat. The ISME Journal 2013, 7, 50–60. [Google Scholar] [CrossRef] [PubMed]
- Amaral-Zettler, L.A.; McCliment, E.A.; Ducklow, H.W.; Huse, S.M. A Method for Studying Protistan Diversity Using Massively Parallel Sequencing of V9 Hypervariable Regions of Small-Subunit Ribosomal RNA Genes. PLoS ONE 2009, 4, 1–9. [Google Scholar] [CrossRef]
- Jasser, I.; Kostrzewska-Szlakowska, I.; Kwiatowski, J.; Navruzshoev, D.; Suska-Malawska, M.; Khomutovska, N. Morphological and Molecular Diversity of Benthic Cyanobacteria Communities Versus Environmental Conditions in Shallow, High Mountain Water Bodies in Eastern Pamir Mountains (Tajikistan). Polish Journal of Ecology 2020, 67, 286–304. [Google Scholar] [CrossRef]
- Khomutovska, N.; De Los Ríos, A.; Jasser, I. Microorganisms Diversity and Colonization Strategies of Endolithic Cyanobacteria in the Cold Mountain Desert of Pamir. 2020. [CrossRef]
- Sandzewicz, M.; Khomutovska, N.; Łach, Ł.; Kwiatowski, J.; Niyatbekov, T.; Suska-Malawska, M.; Jasser, I. Salinity Matters the Most: How Environmental Factors Shape the Diversity and Structure of Cyanobacterial Mat Communities in High Altitude Arid Ecosystems. Frontiers in Microbiology 2023, 14, 1–17. [Google Scholar] [CrossRef]
- Jasser, I.; Panou, M.; Khomutovska, N.; Sandzewicz, M.; Panteris, E.; Niyatbekov, T.; Łach, Ł.; Kwiatowski, J.; Kokociński, M.; Gkelis, S. Cyanobacteria in Hot Pursuit: Characterization of Cyanobacteria Strains, Including Novel Taxa, Isolated from Geothermal Habitats from Different Ecoregions of the World. Molecular Phylogenetics and Evolution 2022, 170, 107454. [Google Scholar] [CrossRef]
- Kleinteich, J.; Hildebrand, F.; Wood, S.A.; CirÌs, S.; Agha, R.; Quesada, A.; Pearce, D.A.; Convey, P.; Küpper, F.C.; Dietrich, D.R. Diversity of Toxin and Non-Toxin Containing Cyanobacterial Mats of Meltwater Ponds on the Antarctic Peninsula: A Pyrosequencing Approach. Antarctic Science 2014, 26, 521–532. [Google Scholar] [CrossRef]
- Rasuk, M.C.; Fernández, A.B.; Kurth, D.; Contreras, M.; Novoa, F.; Poiré, D.; Farías, M.E. Bacterial Diversity in Microbial Mats and Sediments from the Atacama Desert. Microbial Ecology 2016, 71, 44–56. [Google Scholar] [CrossRef]
- Khomutovska, N.; Jerzak, M.; Kostrzewska-Szlakowska, I.; Kwiatowski, J.; Suska-Malawska, M.; Syczewski, M.; Jasser, I. Life in Extreme Habitats: Diversity of Endolithic Microorganisms from Cold Desert Ecosystems of Eastern Pamir. Polish Journal of Ecology 2017, 65, 303–319. [Google Scholar] [CrossRef]
- Khomutovska, N.; De Los Ríos, A.; Syczewski, M.D.; Jasser, I. Connectivity of Edaphic and Endolithic Microbial Niches in Cold Mountain Desert of Eastern Pamir (Tajikistan). 2021. [CrossRef]
- Gkelis, S.; Panou, M.; Konstantinou, D.; Apostolidis, P.; Kasampali, A.; Papadimitriou, S.; Kati, D.; Di Lorenzo, G.M.; Ioakeim, S.; Zervou, S.K.; et al. Diversity, Cyanotoxin Production, and Bioactivities of Cyanobacteria Isolated from Freshwaters of Greece. Toxins 2019, 11. [Google Scholar] [CrossRef]
- Ar, K.; Gkelis, S.; Vardaka, E.; Moustaka-gouni, M. Limnologica Morphological and Molecular Analysis of Bloom-Forming Cyanobacteria in Two Eutrophic , Shallow Mediterranean Lakes. 2011, 41, 167–173. [CrossRef]
- Codd, G.; Bell, S.; Kaya, K.; Ward, C.; Beattie, K.; Metcalf, J. Cyanobacterial Toxins, Exposure Routes and Human Health. European Journal of Phycology 1999, 34, 405–415. [Google Scholar] [CrossRef]
- Teikari, J.; Baunach, M.; Dittmann, E. Cyanobacterial Genome Sequencing, Annotation, and Bioinformatics. Methods in molecular biology (Clifton, N.J.) 2022, 2489, 269–287. [Google Scholar] [CrossRef]
- Quiblier, C.; Wood, S.; Echenique Subiabre, I.; Heath, M.; Villeneuve, A.; Humbert, J.-F. A Review of Current Knowledge on Toxic Benthic Freshwater Cyanobacteria--Ecology, Toxin Production and Risk Management. Water research 2013, 47, 5464–5479. [Google Scholar] [CrossRef] [PubMed]
- Brasell, K.A.; Heath, M.W.; Ryan, K.G.; Wood, S.A. Successional Change in Microbial Communities of Benthic Phormidium-Dominated Biofilms. Microbial Ecology 2015, 69, 254–266. [Google Scholar] [CrossRef]
- Kleinteich, J.; Wood, S.A.; Puddick, J.; Schleheck, D.; Küpper, F.C.; Dietrich, D. Potent Toxins in Arctic Environments – Presence of Saxitoxins and an Unusual Microcystin Variant in Arctic Freshwater Ecosystems. Chemico-Biological Interactions 2013, 206, 423–431. [Google Scholar] [CrossRef]
- Tikhonova, I.; Kuzmin, A.; Deeva, D.; Sorokovikova, E.; Potapov, S.; Lomakina, A.; Belykh, O. Cyanobacteria Nostoc Punctiforme from Abyssal Benthos of Lake Baikal: Unique Ecology and Metabolic Potential. Indian Journal of Microbiology 2017, 57, 422–426. [Google Scholar] [CrossRef] [PubMed]
- Gaget, V.; Keulen, A.; Lau, M.; Monis, P.; Brookes, J.D. DNA Extraction from Benthic Cyanobacteria: Comparative Assessment and Optimization. 2016. [CrossRef]
- Lee, E.; Khurana, M.S.; Whiteley, A.S.; Monis, P.T.; Bath, A.; Gordon, C.; Ryan, U.M.; Paparini, A. Novel Primer Sets for next Generation Sequencing-Based Analyses of Water Quality. PLoS ONE 2017, 12, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Khomutovska, N.; Sandzewicz, M.; Łach, Ł.; Suska-Malawska, M.; Chmielewska, M.; Mazur-Marzec, H.; Cegłowska, M.; Niyatbekov, T.; Wood, S.A.; Puddick, J.; et al. Limited Microcystin, Anatoxin and Cylindrospermopsin Production by Cyanobacteria from Microbial Mats in Cold Deserts. Toxins 2020, 12. [Google Scholar] [CrossRef] [PubMed]
- Guillard, R.R.L. and Lorenzen, C.J. Yellow-Green Algae with Chlorophyllidec. Yellow-Green Algae with Chlorophyllidec. Journal of Phycology, 8, 10-14. 1972.
- Rippka, R.; Deruelles, J.; Waterbury, J.B. Generic Assignments, Strain Histories and Properties of Pure Cultures of Cyanobacteria. Journal of General Microbiology 1979, 111, 1–61. [Google Scholar] [CrossRef]
- Bradley, R.K.; Roberts, A.; Smoot, M.; Juvekar, S.; Do, J. Fast Statistical Alignment. PLoS Comput Biol 2009, 5, 1000392. [Google Scholar] [CrossRef] [PubMed]
- Larsson, A. AliView: A Fast and Lightweight Alignment Viewer and Editor for Large Datasets. BIOINFORMATICS APPLICATIONS 2014, 30, 3276–3278. [Google Scholar] [CrossRef] [PubMed]
- Roush, D.; Giraldo-Silva, A.; Garcia-Pichel, F. Cydrasil 3, a Curated 16S RRNA Gene Reference Package and Web App for Cyanobacterial Phylogenetic Placement. [CrossRef]
- Guiry, M.D. & Guiry, G.M. No Title Available online: https://www.algaebase.org.
- Fadeev, E.; Cardozo-mino, M.G.; Rapp, J.Z.; Bienhold, C.; Salter, I.; Salman-carvalho, V.; Molari, M.; Tegetmeyer, H.E.; Buttigieg, P.L.; Boetius, A. Comparison of Two 16S RRNA Studies of Arctic Microbial Communities. 2021, 12, 1–11. [CrossRef]
- Sabat, A.J.; Van Zanten, E.; Akkerboom, V.; Wisselink, G.; Van Slochteren, K.; De Boer, R.F.; Hendrix, R.; Friedrich, A.W.; Rossen, J.W.A.; Kooistra-Smid, A.M.D. Targeted Next-Generation Sequencing of the 16S-23S RRNA Region for Culture-Independent Bacterial Identification-Increased Discrimination of Closely Related Species. [CrossRef]
- Komarek, J. Cyanobacterial Taxonomy: Current Problems and Prospects for the Integration of Traditional and Molecular Approaches. Algae 2006, 21, 349–375. [Google Scholar] [CrossRef]
- Li, X.; Huo, S.; Xi, B. Updating the Resolution for 16S RRNA OTUs Clustering Reveals the Cryptic Cyanobacterial Genus and Species. Ecological Indicators 2020, 117. [Google Scholar] [CrossRef]
- Li, X.C.; Huo, S.; Zhang, J.; Ma, C.; Xiao, Z.; Zhang, H.; Xi, B.; Xia, X. Metabarcoding Reveals a More Complex Cyanobacterial Community than Morphological Identification. Ecological Indicators 2019, 107, 105653. [Google Scholar] [CrossRef]
- Zou, S.; Smith, L. Comprehensive Primer Sets and Cost Ecient Multiplex PCR-Based EDNA Sequencing for Community Dynamics of Cyanobacteria, Eukaryotic Phytoplankton and Zooplankton in Lake. Research Square 2020, 1–29. [Google Scholar]







| Primer name | Direction | Target region | Position | Sequence (5′ to 3′) | Reference |
|---|---|---|---|---|---|
| S-D-Bact-0341-b-S-17 | F | V3-V4 | 341 | CCTACGGGNGGCWGCAG | [2] |
| S-D-Bact-0785-a-A-21 | R | 785 | GACTACHVGGGTATCTAATCC | ||
| C_773F | F | V4-V6 | 773 | AAWGGGATTAGATACCCCWGT | present study |
| C_1086R | R | 1086 | RGGKTGCGCTCGTTGCGGGA | ||
| 1328F | F | V6 | 870 | GCTAACGCGTTAAGTATCCCGCCTG | [27] |
| 1664R | R | 1160 | GTCTCTCTAGAGTGCCCAACTTAATG |
| Sample ID | Location | EC, uS | Macroscopic characteristic of mats | Morphology-based identification of mat-forming microorganisms (optical microscope) |
|---|---|---|---|---|
| Cyx8 | Sassykkul (Bulunkul subregion) |
347 | Multilayer soft mat, high content of EPS | Leptolyngbya sp., Chlorogloea sp., Nostoc punctiforme, green algae (Haematococccus pluvialis) |
| Cyx9 | Alichur (Bulunkul subregion) |
2720 | Unlayered beneath soil - Mat dominated by filamentous cyanobacteria covered by a mineral soil layer | Calothrix spp., Nostoc commune, Chlorogloea sp., Phormidium sp., Leptolyngbya sp., green algae (Haematococcus pluvialis) |
| Cyx15a | hot spring near Gunt river (Bulunkul subregion) | 1791 | Unlayered type - mat dominated by filamentous cyanobacteria, lower content of EPS compared to Cyx8 | Hilbrichtia pamiria gen. sp. nov., Oscillatoria sp., |
| Sample ID |
Shannon_B | Faith_PD_B | Observed_features/ASVs | Pielou_evenness_B | Shannon_C | Pielou_evenness_C | Nr of Cyanobacterial families | Observed ASVs_C |
| Cyx15a_V3-V4 | 6.51 | 21.91 | 184 | 0.86 | 1.41 | 0.68 | 5 | 8 |
| Cyx15a_V4-V6 | 1.68 | 3.96 | 9 | 0.53 | 1.16 | 0.56 | 5 | 8 |
| Cyx15a_V6 | 1.18 | 4.85 | 22 | 0.26 | 0.67 | 0.32 | 3 | 8 |
| Cyx8_V3-V4 | 5.15 | 15.03 | 133 | 0.73 | 2.18 | 0.83 | 3 | 14 |
| Cyx8_V4-V6 | 1.22 | 4.00 | 8 | 0.41 | 0.84 | 0.38 | 3 | 9 |
| Cyx8_V6 | 0.41 | 3.98 | 14 | 0.11 | 0.26 | 0.11 | 3 | 11 |
| Cyx9_V3-V4 | 7.83 | 37.86 | 453 | 0.89 | 2.41 | 0.77 | 5 | 23 |
| Cyx9_V4-V6 | 2.54 | 5.57 | 53 | 0.44 | 1.67 | 0.43 | 10 | 48 |
| Cyx9_V6 | 2.39 | 7.13 | 84 | 0.37 | 1.51 | 0.39 | 8 | 46 |
| Mix_V3-V4 | 5.64 | 14.45 | 132 | 0.80 | 2.75 | 0.74 | 10 | 41 |
| Mix_V4-V6 | 2.85 | 4.27 | 23 | 0.63 | 2.01 | 0.64 | 9 | 23 |
| Mix_V6 | 2.56 | 4.74 | 29 | 0.53 | 1.74 | 0.56 | 7 | 23 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).