Submitted:
13 March 2024
Posted:
13 March 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Collection of Samples and Detection of Astigmatid Mites in Honeybees
2.2. Total Nucleic Acid Extraction
2.3. Amplification of Astigmatid Mite-Specific Genes Using Polymerase Chain Reaction
2.4. Phylogenetic Analysis and Statistical Analysis
3. Results
3.1. Molecular Identification of Carpoglyphus lactis Mites in Honeybee Colonies
3.2. Similarities of COI Gene Sequence of Astigmatid Mites in Honeybee Colonies
3.3. Prevalence of Carpoglyphus lactis Mite in Korean Honeybee Colonies
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Truong, A-T.; Yoo, M-S.; Seo S.K.; Hwang, T.J.; Yoon, S-S.; Cho, Y.S. Prevalence of honey bee pathogens and parasites in South Korea: A five-year surveillance study from 2017 to 2021. Heliyon 2023, 9, e13494. [CrossRef]
- Klein, A-M.; Vaissière, B.E.; Cane JH, Steffan-Dewenter I, Cunningham SA, Kremen C, et al. Importance of pollinators in changing landscapes for world crops. Proc. R. Soc. B 2007, 274, 303–313. [CrossRef]
- Mutinelli, F.; Pinto, A.; Barzon, L.; Toson, M. Some Considerations about Winter Colony Losses in Italy According to the Coloss Questionnaire. Insects 2022, 13, 1059. [CrossRef]
- Johannesen, J.; Wöhl, S.; Berg, S.; Otten, C. (2022). Annual fluctuations in winter colony losses of Apis mellifera L. are predicted by honey flow dynamics of the preceding year. Insects 2022, 13, 829.
- Gray, A.; Adjlane, N.; Arab, A.; Ballis, A.; Brusbardis, V.; Bugeja Douglas, A.; Cadahia, L.; Charriere, J.D.; Chlebo, R.; Coffey, M.F.; et al. Honey bee colony loss rate in 37 countries using the COLOSS survey for winter 2019-2020: the combined effects of operation size, migration and queen replacement. J. Api. Res. 2023, 62, 204-210.
- Chantawannakul, P.; de Guzman, L.I.; Li, J.; Williams, G.R. Parasites, pathogens, and pests of honeybees in Asia. Apidologie 2016, 47, 301–324. [CrossRef]
- Chantawannakul, P.; Ramsey, S.; Khongphinitbunjong, K.; Phokasem, P. Tropilaelaps mite: an emerging threat to European honey bee. Curr. Opin. Insect. Sci. 2018, 26, 69–75. [CrossRef]
- Denmark, H.A.; Cromroy, H.L.; Sanford, M.T. Honey bee tracheal mite, Acarapis woodi (Rennie) (Arachnida: Acari: Tarsonemidae). University of Florida, IFAS Extension. 2000. [CrossRef]
- Sammataro, D.; Gerson, U.; Needham, G. Parasitic mites of honey bees: life history, implications, and impact. Annu. Rev. Ento. 2000, 45, 519–548. [CrossRef]
- Emmanouel, N.G.; Pelekassis, C.D.; Santas, L.A. Harmful mesostigmatic mites ectoparasitic to honey bees. Entomol. Hell. 1983, 1, 17–23. [CrossRef]
- Truong, A-T.; Yoo, M-S.; Yun, B-R.; Kang, J.E.; Noh, J.; Hwang, T.J.; Seo, S.K.; Yoon, S-S.; Cho, Y.S. Prevalence and pathogen detection of Varroa and Tropilaelaps mites in Apis mellifera (Hymenoptera, Apidae) apiaries in South Korea. J. Apicul. Res. 2023, 62, 804–812.
- Nguyen, T-T.; Yoo, M-S.; Truong, A-T.; Lee, J.H.; Youn, S.Y.; Lee, S-J.; Kim, D-H.; Yoon, S-S.; Cho, Y.S. First identification of Tyrophagus curvipenis (Acari: Acaridae) and pathogen detection in Apis mellifera colonies in the Republic of Korea. Sci. Rep. 2023, 13, 9469. [CrossRef]
- Jung, C.; Lee, M.L. Beekeeping in Korea: Past, present, and future challenges. In: Chantawannakul P, Williams G, Neumann P, editors. Asian Beekeeping in the 21st Century. Singapore: Springer; 2018. p. 175–197.
- Ahn, A.J.; Ahn, K.S.; Noh, J.H.; Kim, Y.H.; Yoo, M.S.; Kang, S.W.; Yo, D.H.; Shin, S.S. Molecular prevalence of Acarapis mite infestations in honey bees in Korea. Korean J. Parasitol. 2015, 53, 315–320. [CrossRef]
- Bowman, C. Variation in the trophic morphology of Astigmatid mites common in UK beehives. Acarologia 2023, 63, Suppl:4–16. [CrossRef]
- Hubert, J.; Nesvorna, M.; Kopecký, J.; Ságová-Marečková, M.; Poltronieri, P. Carpoglyphus lactis (Acari: Astigmata) from various dried fruits differed in associated micro-organisms. J. Appl. Microbiol. 2015, 118, 470–484. [CrossRef]
- Jiang, Z. A new species of Carpoglyphidae from China (Acarina: Acaroidea). J. Jiang. Univ. 1991, 15, 82–86.
- Chmielewski, W. Morphological and bio-ecological characteristics of Carpoglyphus lactis found in natural honey, warehouses and beehives. Pszczelnicze Zeszyty Naukowe. 1970, 14, 109–127.
- Clark, J.M. A new species of Carpoglyphus (Astigmatina: Carpoglyphidae) from the bark of black beech (Nothofagus) honeydew in New Zealand. Int. J. Acarol. 2010, 36, 453–459. [CrossRef]
- Haragsim, O.; Samšiňák, K.; Vobrázková, E. The mites inhabiting the beehives in ČSR. Z. Angew. Entomol. 1978, 87, 52–67.
- Vijayakumar, K.; Muthuraman, M.; Jayaraj, R. Infestation of Carpoglyphus lactis (Linnaeus)(Acari: Carpoglyphidae) on Trigona iridipennis (Apidae: Meliponinae) from India. Sch. J. Agric. Sci. 2013, 3, 25–28.
- Baker, E.; Delfinado, M. Notes on the driedfruit mite Carpoglyphus lactis (Acarina: Carpoglyphidae) infesting honeybee combs. J. Apicul. Res. 1978, 17, 52–54. [CrossRef]
- Zhang, Z-Q. New Zealand records of Carpoglyphus lactis (Acari: Carpoglyphidae). Syst. Appl. Acarol. 2012, 17, 239–240. [CrossRef]
- Zhang, K.; Zhang, Z-Q. The dried fruit mite Carpoglyphus lactis (Acari: Carpoglyphidae) is a suitable alternative prey for Amblyseius herbicolus (Acari: Phytoseiidae). Syst. Appl. Acarol. 2021, 26, 2167–2176. [CrossRef]
- Hughes, A.M. The mites of stored food and houses her majesty's stationery office. 2nd ed.; London, UK, 1976.
- Chmielewski, W. Bionomics of Carpoglyphus lactis (Acari: Carpoglyphidae) on honey. In Ecology and Evolution of the Acari, 3rd ed.; Bruin, J., van der Geest, L.P.S., Sabelis, M.W., Eds.; Spinger: Dordrecht, Netherlands, 1999; pp. 423–424.
- Zander, E. Handbook of beekeeping in individual representations. Diseases and pests of adult bees. Stuttgart: Verlag Eugen Ulmer, 1947.
- Yang, B.; Cai, J.; Cheng, X. Identification of astigmatid mites using ITS2 and COI regions. Parasitol. Res. 2011, 108, 497–503. [CrossRef]
- Hall, T. BioEdit version 7.0.0. 2004. Distributed by the Author, website. Available online: www.mbio.ncsu.edu/BioEdit/bioedit.html.
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [CrossRef]
- Chmielewski, W. Stored products mites (Acaroidea) in Polish bee hives. In Modern acarology, proceedings of the 8 International Congress of Acarology, held in Ceske Budejovice, Czechoslovakia, 6-11 August 1990; Dusbabek, F., Bukva, V., Eds; SPB Academic Publishing bv: The Hague, Netherlands. 1991; 615–619.
- Dabert, M.; Witalinski, W.; Kazmierski, A.; Olszanowski, Z.; Dabert, J. Molecular phylogeny of acariform mites (Acari, Arachnida): Strong conflict between phylogenetic signal and long-branch attraction artifacts. Mol. Phylogenet. Evol. 2010, 56, 222–241. [CrossRef]






| Name of primers | Sequences (5’ -> 3’) | Amplicon size (bp) | Note | References |
|---|---|---|---|---|
| COI–For | GTTTTGGGATATCTCTCATAC | 377 | Used for Astigmatid mite detection | [28] |
| COI–Rev | GAGCAACAACATAARAAGTATC | |||
| CL-For | CTTGAATTTGTAGAATGGA | 1242 | Used for C. lactis mite detection | This study |
| CL-Rev | CTAATCGAGGTGTCCGAGGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).