Submitted:
10 September 2024
Posted:
11 September 2024
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Polymer Preparation and Peptide Conjugation
2.3. NPs Preparation
2.4. Nanoparticle Characterization
2.5. Preparation of Cur-Loaded NPs
2.6. DL% and EE% Methodology
2.7. In Vitro Release Study
2.8. Cell Culture
2.9. Cell Cytotoxicity Assay Methodology
2.10. Gene Expression Analysis
2.11. Invasion Assay
2.12. Statistical Analysis
3. Result
3.1. Characterization of NPs and NPs-A6
3.2. DL% and EE% Findings
3.3. Drug Release Profile
3.4. MTT Assay
3.5. Gene Expression Analysis
3.6. Invasion Assay
4. Discussion
5. Conclusions
Author Contributions
Data Availability Statement
Acknowledgments
Conflict of interest
References
- Anand, U., et al., Cancer chemotherapy and beyond: Current status, drug candidates, associated risks and progress in targeted therapeutics. Genes & Diseases, 2023. 10(4): p. 1367-1401.
- Zaer, M., et al., Doxorubicin-loaded Niosomes functionalized with gelatine and alginate as pH-responsive drug delivery system: A 3D printing approach. International Journal of Biological Macromolecules, 2023. 253: p. 126808.
- Nurgali, K., R.T. Jagoe, and R. Abalo, Editorial: Adverse Effects of Cancer Chemotherapy: Anything New to Improve Tolerance and Reduce Sequelae? Front Pharmacol, 2018. 9: p. 245.
- Feliu, J., et al., Can we avoid the toxicity of chemotherapy in elderly cancer patients? Crit Rev Oncol Hematol, 2018. 131: p. 16-23.
- Rostami, N., et al., Synthesis and Characterization of Folic Acid-Functionalized DPLA-co-PEG Nanomicelles for the Targeted Delivery of Letrozole. ACS Applied Bio Materials, 2023. 6(5): p. 1806-1815. [CrossRef]
- Rostami, N., et al., Exploring Advanced CRISPR Delivery Technologies for Therapeutic Genome Editing. Small Science. n/a(n/a): p. 2400192. [CrossRef]
- Sun, L., et al., Smart nanoparticles for cancer therapy. Signal Transduction and Targeted Therapy, 2023. 8(1): p. 418.
- Edis, Z., et al., Nanocarriers-Mediated Drug Delivery Systems for Anticancer Agents: An Overview and Perspectives. Int J Nanomedicine, 2021. 16: p. 1313-1330.
- Ciuca, M.D. and R.C. Racovita, Curcumin: Overview of Extraction Methods, Health Benefits, and Encapsulation and Delivery Using Microemulsions and Nanoemulsions. Int J Mol Sci, 2023. 24(10). [CrossRef]
- Rostami, N. and R. Davarnejad, Characterization of folic acid-functionalized PLA-PEG nanomicelle to deliver Letrozole: A nanoinformatics study. IET Nanobiotechnol, 2022. 16(4): p. 103-114. [CrossRef]
- Behl, A., et al., Biodegradable PEG-PCL Nanoparticles for Co-delivery of MUC1 Inhibitor and Doxorubicin for the Confinement of Triple-Negative Breast Cancer. J Polym Environ, 2023. 31(3): p. 999-1018. [CrossRef]
- Luo, D., et al., MPEG-PCL Nanomicelles Platform for Synergistic Metformin and Chrysin Delivery to Breast Cancer in Mice. Anticancer Agents Med Chem, 2022. 22(2): p. 280-293. [CrossRef]
- Firouzai-Amandi, A., et al., Development, Characterization, and In Vitro Evaluation of Cytotoxic Activity of Rutin Loaded PCL-PEG Nanoparticles Against Skov3 Ovarian Cancer Cell. Asian Pac J Cancer Prev, 2022. 23(6): p. 1951-1957. [CrossRef]
- Ni, R., et al., Dual-modified PCL-PEG nanoparticles for improved targeting and therapeutic efficacy of docetaxel against colorectal cancer. Pharm Dev Technol, 2021. 26(8): p. 910-921.
- Rezaie, P., et al., Evaluation of combined effect of hyperthermia and ionizing radiation on cytotoxic damages induced by IUdR-loaded PCL-PEG-coated magnetic nanoparticles in spheroid culture of U87MG glioblastoma cell line. Int J Radiat Biol, 2018. 94(11): p. 1027-1037.
- Tomeh, M.A., R. Hadianamrei, and X. Zhao, A Review of Curcumin and Its Derivatives as Anticancer Agents. Int J Mol Sci, 2019. 20(5). [CrossRef]
- Hsu, K.Y., C.T. Ho, and M.H. Pan, The therapeutic potential of curcumin and its related substances in turmeric: From raw material selection to application strategies. J Food Drug Anal, 2023. 31(2): p. 194-211. [CrossRef]
- de Waure, C., et al., Exploring the Contribution of Curcumin to Cancer Therapy: A Systematic Review of Randomized Controlled Trials. Pharmaceutics, 2023. 15(4).
- Wang, W., et al., Curcumin in cancer therapy: Exploring molecular mechanisms and overcoming clinical challenges. Cancer Letters, 2023. 570: p. 216332. [CrossRef]
- Mohebian, Z., M. Babazadeh, and N. Zarghami, In Vitro Efficacy of Curcumin-Loaded Amine-Functionalized Mesoporous Silica Nanoparticles against MCF-7 Breast Cancer Cells. Adv Pharm Bull, 2023. 13(2): p. 317-327. [CrossRef]
- Santhamoorthy, M., et al., k-Carrageenan based magnetic@polyelectrolyte complex composite hydrogel for pH and temperature-responsive curcumin delivery. Int J Biol Macromol, 2023. 244: p. 125467. [CrossRef]
- Wang, X., et al., Curcumin induces apoptosis in human hepatocellular carcinoma cells by decreasing the expression of STAT3/VEGF/HIF-1alpha signaling. Open Life Sci, 2023. 18(1): p. 20220618. [CrossRef]
- Do, X.-H., et al., Differential Cytotoxicity of Curcumin-Loaded Micelles on Human Tumor and Stromal Cells. International Journal of Molecular Sciences, 2022. 23(20): p. 12362. [CrossRef]
- Jambhrunkar, S., et al., Mesoporous silica nanoparticles enhance the cytotoxicity of curcumin. RSC Advances, 2014. 4(2): p. 709-712. [CrossRef]
- Moballegh Nasery, M., et al., Curcumin Delivery Mediated by Bio-Based Nanoparticles: A Review. Molecules, 2020. 25(3). [CrossRef]
- Asemaneh, H.R., et al., Functionalized Graphene Oxide/Polyacrylonitrile Nanofibrous Composite: Pb2+ and Cd2+ Cations Adsorption. International Journal of Engineering, 2020. 33(6): p. 1048-1053. [CrossRef]
- Hussain, A., et al., Application of curcumin nanoformulations to target folic acid receptor in cancer: Recent trends and advances. Environ Res, 2023: p. 116476. [CrossRef]
- Li, X., et al., The Peptide Functionalized Inorganic Nanoparticles for Cancer-Related Bioanalytical and Biomedical Applications. Molecules, 2021. 26(11). [CrossRef]
- Sharma, R., et al., Functionalized Peptide-Based Nanoparticles for Targeted Cancer Nanotherapeutics: A State-of-the-Art Review. ACS Omega, 2022. 7(41): p. 36092-36107. [CrossRef]
- Gu, W., et al., A6 peptide-tagged, ultra-small and reduction-sensitive polymersomal vincristine sulfate as a smart and specific treatment for CD44+ acute myeloid leukemia. J Control Release, 2021. 329: p. 706-716. [CrossRef]
- Gomari, M.M., et al., Rational peptide design for targeting cancer cell invasion. Proteins: Structure, Function, and Bioinformatics, 2024. 92(1): p. 76-95. [CrossRef]
- Gu, W., et al., CD44-Specific A6 Short Peptide Boosts Targetability and Anticancer Efficacy of Polymersomal Epirubicin to Orthotopic Human Multiple Myeloma. Adv Mater, 2019. 31(46): p. e1904742. [CrossRef]
- Koh, H.J., et al., Intraocular properties of urokinase-derived antiangiogenic A6 peptide in rabbits. J Ocul Pharmacol Ther, 2004. 20(5): p. 439-49.
- Piotrowicz, R.S., et al., A6 peptide activates CD44 adhesive activity, induces FAK and MEK phosphorylation, and inhibits the migration and metastasis of CD44-expressing cells. Mol Cancer Ther, 2011. 10(11): p. 2072-82. [CrossRef]
- Zhang, C., et al., A6 Peptide-Tagged Core-Disulfide-Cross-Linked Micelles for Targeted Delivery of Proteasome Inhibitor Carfilzomib to Multiple Myeloma In Vivo. Biomacromolecules, 2020. 21(6): p. 2049-2059. [CrossRef]
- Manjili, H.K., et al., Poly(caprolactone)–poly(ethylene glycol)–poly(caprolactone) (PCL–PEG–PCL) nanoparticles: a valuable and efficient system for in vitro and in vivo delivery of curcumin. RSC Advances, 2016. 6(17): p. 14403-14415.
- Wu, K., L. Yu, and J. Ding, Synthesis of PCL–PEG–PCL Triblock Copolymer via Organocatalytic Ring-Opening Polymerization and Its Application as an Injectable Hydrogel—An Interdisciplinary Learning Trial. Journal of Chemical Education, 2020. 97(11): p. 4158-4165. [CrossRef]
- Kulhari, H., et al., Peptide conjugated polymeric nanoparticles as a carrier for targeted delivery of docetaxel. Colloids and Surfaces B: Biointerfaces, 2014. 117: p. 166-173. [CrossRef]
- Chandrasiri, I., et al., Reproducible and controlled peptide functionalization of polymeric nanoparticles. Frontiers in Biomaterials Science, 2022. 1. [CrossRef]
- Rostami, N., et al., Design, Synthesis, and Comparison of PLA-PEG-PLA and PEG-PLA-PEG Copolymers for Curcumin Delivery to Cancer Cells. Polymers, 2023. 15(14): p. 3133. [CrossRef]
- Patra, J.K., et al., Nano based drug delivery systems: recent developments and future prospects. Journal of Nanobiotechnology, 2018. 16(1): p. 71. [CrossRef]
- Nosrati, H., et al., Synthesis, characterization, and kinetic release study of methotrexate loaded mPEG–PCL polymersomes for inhibition of MCF-7 breast cancer cell line. Pharmaceutical Development and Technology, 2019. 24(1): p. 89-98.
- Phan, Q.T., et al., Characteristics and cytotoxicity of folate-modified curcumin-loaded PLA-PEG micellar nano systems with various PLA:PEG ratios. Int J Pharm, 2016. 507(1-2): p. 32-40. [CrossRef]
- Samrot, A.V., et al., Synthesis of curcumin loaded polymeric nanoparticles from crab shell derived chitosan for drug delivery. Informatics in Medicine Unlocked, 2018. 10: p. 159-182. [CrossRef]
- Zatorska-Płachta, M., et al., Encapsulation of Curcumin in Polystyrene-Based Nanoparticles—Drug Loading Capacity and Cytotoxicity. ACS Omega, 2021. 6(18): p. 12168-12178. [CrossRef]
- Liu, Y., et al., Development of High-Drug-Loading Nanoparticles. Chempluschem, 2020. 85(9): p. 2143-2157.
- Chen, K., et al., Preparation and Characterization of Size-Controlled Nanoparticles for High-Loading λ-Cyhalothrin Delivery through Flash Nanoprecipitation. Journal of Agricultural and Food Chemistry, 2018. 66(31): p. 8246-8252. [CrossRef]
- Chang, G., et al., CD44 targets Na(+)/H(+) exchanger 1 to mediate MDA-MB-231 cells' metastasis via the regulation of ERK1/2. Br J Cancer, 2014. 110(4): p. 916-27.
- Khosropanah, M.H., et al., Analysis of the Antiproliferative Effects of Curcumin and Nanocurcumin in MDA-MB231 as a Breast Cancer Cell Line. Iran J Pharm Res, 2016. 15(1): p. 231-9.
- Rio, D.C., et al., Purification of RNA using TRIzol (TRI reagent). Cold Spring Harb Protoc, 2010. 2010(6): p. pdb.prot5439. [CrossRef]
- Khanna, P., K.L. Johnson, and J.L. Maron, Optimal reference genes for RT-qPCR normalization in the newborn. Biotech Histochem, 2017. 92(7): p. 459-466.
- Bustin, S.A., et al., Quantitative real-time RT-PCR--a perspective. J Mol Endocrinol, 2005. 34(3): p. 597-601.
- Pfaffl, M.W., A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001. 29(9): p. e45. [CrossRef]
- Pijuan, J., et al., In vitro Cell Migration, Invasion, and Adhesion Assays: From Cell Imaging to Data Analysis. Front Cell Dev Biol, 2019. 7: p. 107. [CrossRef]
- Ranstam, J., Hypothesis-generating and confirmatory studies, Bonferroni correction, and pre-specification of trial endpoints. Acta orthopaedica, 2019. 90(4): p. 297-297. [CrossRef]
- Manjili, H.K., et al., In vitro and in vivo delivery of artemisinin loaded PCL-PEG-PCL micelles and its pharmacokinetic study. Artif Cells Nanomed Biotechnol, 2018. 46(5): p. 926-936.
- Khanmohammadi, M.R., et al., Methoxy poly(ethylene glycol)-block-polycaprolactone copolymer: formulation and optimization by experimental design; determination of diblock molar mass by multivariate regression analysis of 1H NMR spectra. Analytical Methods, 2013. 5(11): p. 2840-2847. [CrossRef]
- Araveti, P.B. and A. Srivastava, Curcumin induced oxidative stress causes autophagy and apoptosis in bovine leucocytes transformed by Theileria annulata. Cell Death Discovery, 2019. 5(1): p. 100. [CrossRef]
- Wang, J.B., et al., Curcumin induces apoptosis through the mitochondria-mediated apoptotic pathway in HT-29 cells. J Zhejiang Univ Sci B, 2009. 10(2): p. 93-102. [CrossRef]
- Rozenberg, M., et al., Spectroscopic FTIR and NMR study of the interactions of sugars with proteins. Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy, 2019. 222: p. 116861. [CrossRef]
- Yao, Y., et al., Nanoparticle-Based Drug Delivery in Cancer Therapy and Its Role in Overcoming Drug Resistance. Front Mol Biosci, 2020. 7: p. 193. [CrossRef]
- Freire, J.M., et al., Using zeta-potential measurements to quantify peptide partition to lipid membranes. Eur Biophys J, 2011. 40(4): p. 481-7. [CrossRef]
- Moyano, D.F., et al., Nanoparticle Hydrophobicity Dictates Immune Response. Journal of the American Chemical Society, 2012. 134(9): p. 3965-3967. [CrossRef]
- Maestro, A., et al., Contact angle of micro- and nanoparticles at fluid interfaces. Current Opinion in Colloid & Interface Science, 2014. 19(4): p. 355-367. [CrossRef]
- Siepmann, J. and N.A. Peppas, Higuchi equation: derivation, applications, use and misuse. Int J Pharm, 2011. 418(1): p. 6-12. [CrossRef]
- Weng, J., H.H.Y. Tong, and S.F. Chow, In Vitro Release Study of the Polymeric Drug Nanoparticles: Development and Validation of a Novel Method. Pharmaceutics, 2020. 12(8). [CrossRef]
- Bhawana, et al., Curcumin Nanoparticles: Preparation, Characterization, and Antimicrobial Study. Journal of Agricultural and Food Chemistry, 2011. 59(5): p. 2056-2061.
- Huang, Y., et al., Curcumin encapsulated zein/caseinate-alginate nanoparticles: Release and antioxidant activity under in vitro simulated gastrointestinal digestion. Current Research in Food Science, 2023. 6: p. 100463. [CrossRef]
- Luss, A.L., et al., Toxicity Evaluation and Controlled-Release of Curcumin-Loaded Amphiphilic Poly-N-vinylpyrrolidone Nanoparticles: In Vitro and In Vivo Models. Pharmaceutics, 2024. 16(1): p. 8. [CrossRef]
- Agus, D.B., et al., A physical sciences network characterization of non-tumorigenic and metastatic cells. Scientific Reports, 2013. 3(1): p. 1449. [CrossRef]
- Sheridan, C., et al., CD44+/CD24- breast cancer cells exhibit enhanced invasive properties: an early step necessary for metastasis. Breast Cancer Res, 2006. 8(5): p. R59.
- Liu, D. and Z. Chen, The effect of curcumin on breast cancer cells. J Breast Cancer, 2013. 16(2): p. 133-7. [CrossRef]
- Shishodia, S., Molecular mechanisms of curcumin action: gene expression. Biofactors, 2013. 39(1): p. 37-55. [CrossRef]
- Elmore, S., Apoptosis: a review of programmed cell death. Toxicol Pathol, 2007. 35(4): p. 495-516. [CrossRef]
- Chen, C., et al., The biology and role of CD44 in cancer progression: therapeutic implications. J Hematol Oncol, 2018. 11(1): p. 64. [CrossRef]









| Gene name | Primer sequence | Strand | Product size |
|---|---|---|---|
| GAPDH |
TGGAAGGACTCATGACCACA | Plus | 119 |
| AGAGGCAGGGATGATGTTCT | Minus | ||
| Bcl-2 |
TGGGATCGTTGCCTTATGCA | Plus | 101 |
| GTCTACTTCCTCTGTGATGTTGT | Minus | ||
| hTERT |
GTCTACTTCCTCTGTGATGTTGT | Plus | 128 |
| CCGGCATCTGAACAAAAGCC | Minus | ||
| BAX |
AAACTGGTGCTCAAGGCCC | Plus | 81 |
| AGAGGCAGGGATGATGTTCT | Minus | ||
| MMP-2 |
TGGATACCCCTTTGACGGTAAG | Plus | 137 |
| CATACTTCACACGGACCACTTG | Minus | ||
| MMP-9 |
GATGCCTGCAACGTGAACAT | Plus | 88 |
| AGAATCGCCAGTACTTCCCATC | Minus | ||
| CD44 |
GCTTCAATGCTTCAGCTCCA | Plus | 71 |
| TCCATCAAAGGCATTGGGCA | Minus |
| Parameter | NPs | Cur-NPs | Cur-NPs-A6 |
|---|---|---|---|
| Average size (nm) | 54.3 | 67.6 | 76.4 |
| PDI | 0.32 | 0.34 | 0.39 |
| Zeta Potential (mV) | -32.7 | -12.6 | -13.8 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).