Escherichia coli is an indicator microorganism in One Health antibiotic resistance surveillance programmes. The purpose of the study was to describe and compare E. coli isolates obtained from pigs and human contacts from a commercial farm in South Africa using conventional methods and whole genome sequencing (WGS). Porcine E. coli isolates were proportionally more resistant phenotypically and harboured a richer diversity of antibiotic resistance genes, as compared to human E. coli isolates. Different pathovars, namely ExPEC (12.43%, 21/169), ETEC (4.14%; 7/169), EPEC (2.96%, 5/169), EAEC (2.96%, 5/169) and STEC (1.18%, 2/169) were detected at low frequencies. Sequence type complex (STc) 10 were the most prevalent (85.51%, 59/169) among human and porcine isolates. Six STcs (STc10, STc86, STc168, STc206, STc278 and STc469) were shared at the human-livestock interface according to multilocus sequence typing (MLST). Core genome MLST and hierarchical clustering (HC) showed that human and porcine isolates were overall genetically diverse, but some clustering at HC2 to HC200 were observed. In conclusion, even though the isolates shared a spatio-temporal relationship, there were still differences in the virulence potential, antibiotic resistance profiles, and cgMLST and HC according to the source of isolation.

Heavy metals are dangerous contaminants constituting a threat to human health because they persist in soils and are easily transferred into the food chain, causing damages to human health. Among heavy metals, nickel appears to be one of the most dangerous responsible for different disorders. Public health protection requires nickel detection in environment and food chains; a simple, rapid and sensitive method to detect nickel contamination is represented by biosensors. In this paper we report the setup of a whole-cell based system, in which protoplasts, obtained from Nicotiana tabacum leaves, were used as transducers to detect the presence of heavy metal ions and, in particular, nickel ions. Protoplasts were genetically modified with a plasmid containing the GFP reporter gene under the promoter region of a sunflower small HSP gene control. By this device the presence of heavy metal ions was detected. Thus, the possibility to use this whole-cell system as a novel tool to detect the presence of nickel ions in food matrices was assessed.

Autism has been described as a gastrointestinal and neurological condition that is represented by impairments in language and social situations. Recently reported increases in the occurrence of Autism Spectrum Disorder (ASD) have resulted in increased research into the environmental differences between areas with a high occurrence, as in the “Western” diet populations, and a more locally derived diet population, wherein the rate appears to be significantly less. Thirty autistic children (USA) ages 6 to 21, were sampled at three different intervals: prior to any intervention, post-xylitol intervention, and post-probiotic intervention. The sampling consisted of buccal swabs for MITOSWAB testing, and saliva for metatranscriptomics to determine the entire range of microorganisms and the metabolome. In addition, a “Blue Zone” subject component that included 30 Colombian children, ages 6-16, and who were healthy and within normal behavior standards, also had buccal swabbing and salivary sampling performed for comparison along with 30 healthy (no history medications, illnesses, or behavior issues) USA children matched for age and gender. Saliva samples were analyzed metatranscriptomically and artificial intelligence was utilized to discern important differences in the microbiome that included bacteria, archaea, fungi, and viruses, and microbial functions. Significant differences were noted, and seen in the temporal data, demonstrating shifts that may have been precipitated by the interventions, with both the probiotics and the polyols. Particular bacterial strains were significantly more prevalent in the autism subject group including a strain that reduces neurotransmitters by enzymatic degradation. This provided supporting evidence to the hypothesis that the occurrence of autism may also be influenced by low Gamma Amino Butyric Acid (GABA) levels during development. Also, of interest was the un-expected finding that verbal skills dramatically increased in 6 of the 30 ASD subjects following xylitol supplementation.

A 23-month-old neutered male dog of unknown ancestry presented with a history of progressive neurological signs that included anxiety, cognitive impairment, tremors, seizure activity, ataxia, and pronounced visual impairment. The clinical signs were accompanied by global brain atrophy. Due to progression in the severity of disease signs, the dog was euthanized at 26 months of age. Examination of tissues collected at necropsy revealed dramatic intracellular accumulations of autofluorescent inclusions in the brain, retina, and cardiac muscle. The inclusions were immunopositive for subunit c of mitochondrial ATP synthase, and their ultrastructural appearances were similar to those of lysosomal storage bodies that accumulate in some of the neuronal ceroid lipofuscinosis (NCL) diseases. The also dog exhibited widespread neuroinflammation. Based on these findings, the dog was deemed likely to have suffered from a form of NCL. A whole genome sequence analysis of the proband’s DNA revealed a homozygous C to T substitution that altered the intron 3 – exon 4 splice site of CLN6. Other mutations in CLN6 cause NCL diseases in humans and animals including dogs. CLN6 protein was undetectable with immunolabeling in the tissues of the proband. Based on the clinical history, fluorescence and electron-microscopy, immunohistochemistry, and molecular genetic findings, the disorder in this dog is classified as an NCL resulting from the absence of CLN6 protein. Screening the dog’s genome for a panel of breed-specific polymorphisms indicated that its ancestry included numerous breeds, with no single breed predominating. This suggests that the CLN6 disease variant is likely to be present in other mixed breed dogs and at least some of the ancestral breeds.

To facilitate the promotion and application of the whole process engineering consulting (WPEC) model, the transmission mechanism of influencing factors in WPEC's promotion and application is investigated. It identifies and categorizes the influencing factors within the framework of "external environment-project factors-stakeholders", systematically organizing and summarizing ten primary categories and thirty-eight secondary influencing factors of WPEC's promotion and ap-plication. Utilizing the complex network analysis method, a network of influencing factors in the promotion and application of WPEC is constructed. The network is then converted into three binary networks based on weight, which are subjected to structural analysis and motif analysis. On this basis, the transmission mechanism of influencing factors in WPEC's promotion and applica-tion and its causations are explored.

Whole cell biosensors could serve as eco-friendly and cost-effective alternatives for detecting potentially toxic bioavailable heavy metals in aquatic environments. However, they often fail to meet practical requirements due to an insufficient limit of detection (LOD) and high background noise. In this study, we designed a synthetic genetic circuit specifically tailored for detecting ionic mercury, which we applied to environmental samples collected from artisanal gold mining sites in Peru. We developed two distinct versions of the biosensor, each utilizing a different reporter protein: a fluorescent biosensor (Mer-RFP) and a colorimetric biosensor (Mer-Blue). Mer-RFP enabled real-time monitoring of the culture’s response to mercury samples using a plate reader, whereas Mer-Blue was analysed for colour accumulation at the endpoint using a specially designed, low-cost camera set up for harvested cell pellets. Both biosensors exhibited negligible baseline expression of their respective reporter proteins and responded specifically to HgBr2 in pure water. Mer-RFP demonstrated a linear detection range from 1 nM to 1 μM, whereas Mer-Blue showed a linear range from 2 nM to 125 nM. Our biosensors successfully detected a high concentration of ionic mercury in the reaction bucket where artisanal miners produce a mercury-gold amalgam. However, they did not detect ionic mercury in the water from active mining ponds, indicating a concentration lower than 3.2 nM Hg2+ -a result consistent with chemical analysis quantitation. Furthermore, we discuss the potential of Mer-Blue as a practical and affordable monitoring tool, highlighting its stability, reliance on simple visual colorimetry, and the possibility of sensitivity expansion to organic mercury.

Species of the genus Drosophila have served as favorite models in speciation studies; however, genetic factors of interspecific reproductive incompatibility are underinvestigated. Here we performed the analysis of hybrid female sterility by crossing Drosophila melanogaster females and Drosophila simulans males. Using transcriptomic data analysis, molecular, cellular, and genetic approaches, we analyzed differential gene expression, transposable element (TE) activity, piRNA biogenesis, and functional defects of oogenesis in hybrids. Premature germline stem cell loss was the most prominent defect of oogenesis in hybrid ovaries. Due to the differential expression of genes encoding piRNA pathway components, rhino and deadlock, the functional RDCmel complex in hybrid ovaries was not assembled. However, the activity of the RDCsim complex was maintained in hybrids, independent of the genomic origin of piRNA clusters. Despite the identification of a cohort of overexpressed TEs in hybrid ovaries, we found no evidence that their activity can be considered the main cause of hybrid sterility. We revealed a complicated pattern of Vasa protein expression in the hybrid germline, including partial AT-chX piRNA targeting of the vasasim allele and a significant zygotic delay in vasamel expression. We arrived at the conclusion that the hybrid sterility phenotype was caused by intricate multi-locus differences between the species.

Thorough and precise gene structure annotations are essential for maximizing the benefits of genomic data and unveiling valuable genetic insights. The cucumber genome was first released in 2009 and updated in 2019. To increase the accuracy of predicted gene models, 64 published RNA-seq data and 9 new strand-specific RNA-seq data from multiple tissues were used for manual comparison with the gene models. The updated annotation file (version 2.0) contains increased 24,145 predicted genes from previous version (24317 genes) with a higher BUSCO value of 96.9%. 6231 and 1490 transcripts were adjusted and newly added, respectively, accounting for 31.99% of the overall gene tally. These newly added and adjust genes were renamed (CsaV3.1_XGXXXXX), while genes remaining unaltered preserve their original des ignations. A random selection of 21 modified/added genes were validated using RT-PCR analyses. Additionally, tissue-specific patterns of gene expression were examined using newly obtained transcriptome data with the revised gene prediction model. This improved annotation of cucumber genome will provide essential and accurate resources for studies in cucumber.

The grain filling rate (GFR) plays a crucial role in determining grain yield. However, the regulatory and molecular mechanism of grain filling rate (GFR) in foxtail millet remains unclear. In this study, we found the GFR of 'Changnong No.47' (CN47) was significantly higher at 14 days after flowering (DAF) and 21 DAF in comparison to 'Changsheng 13' (CS13). Furthermore, CN47 also exhibited higher thousand grain weight and yield than CS13. Therefore, we conducted transcriptomics and metabolomics to analyze the biological processes and functional genes associated with GFR during two stages of grain filling in both cultivars. A total of 765 differentially expressed genes (DEGs) and 246 differentially accumulated metabolites (DAMs) were identified at the 14 DAF stage, while at the 21 DAF stage, a total of 908 DEGs and 268 DAMs were identified. The integrated analysis of co-mapped DAMs and DEGs revealed enriched pathways, including flavonoid biosynthesis, plant hormone signal transduction, tyrosine metabolism, ATP-binding cassette (ABC) transporters, beta-alanine metabolism, as well as stilbenoid, diarylheptanoid and gingerol biosynthesis. In order to elucidate their potential functions in the context of GFR, we developed a gene-metabolite regulatory network for these metabolic pathways. Notably we found some genes associated with ABC transporters and plant hormone signal transduction pathway were implicated in auxin transport and signal transduction, highlighting the crucial role of auxin during grain filling. The results provide initial insights into the regulatory and molecular mechanisms underlying GFR in foxtail millet, as well as offer valuable genetic resources for further elucidation of GFR in future studies. The findings have established a theoretical basis for improving the efficiency of yield breeding in foxtail millet.

The present study aimed to determine the genetic diversity of isolates of Mycobacterium tuberculosis (Mtb) from presumed drug resistant tuberculosis patients from several states of Brazil. The isolates had been submitted to conventional drug susceptibility testing for first- and second-line drugs. Multidrug-resistant (MDR-TB) (54.8%) was the most frequent phenotypic resistance profile, in addition to an important high frequency of pre-extensively resistant (p-XDR-TB) (9.2%). Using whole-genome sequencing (WGS), we characterized 298 Mtb isolates from Brazil. Besides analysis of genotype distribution and possible correlations between molecular and clinical data, we determined the performance of an in-house WGS pipeline with other online pipelines for Mtb lineages and drug resistance profile definition. Sub-lineage 4.3 (52%) was the most frequent genotype and the genomic approach revealed a p-XDR-TB level of 22.5%. We detected 20 novel mutations in three resistance genes, and six of these were observed in eight phenotypically resistant isolates. Cluster analysis of 170 isolates showed that 43.5% of the TB patients belonged to 24 genomic clusters, suggesting considerable ongoing transmission of DR-TB, including two interstate transmissions. The in-house WGS pipeline showed the best overall performance in drug-resistance prediction, presenting the best accuracy values to five of nine drugs tested. Significant associations were observed between suffering from fatal disease and genotypic p-XDR-TB (p = 0.03) and either phenotypic (p = 0.006) and genotypic (p = 0.0007) ethambutol resistance. The use of WGS analysis improved our understanding of the population structure of MTBC in Brazil, genetic and clinical data correlations and demonstrating its utility for surveillance efforts for spread of DR-TB, hopefully helping to avoid the emergence of even more resistant strains and to reduce TB incidence and mortality rates.

Salt stress is a major limiting factor for alfalfa yield due to its relatively low salt tolerance. High soil salinity adversely impacts alfalfa growth and development, leading to reduced yield. Melatonin (MT) is known to play a significant role in enhancing plant resistance to abiotic stresses. However, the mechanisms underlying melatonin-mediated abiotic stress responses, particularly salt stress, are not well understood. To address this gap, we conducted a study focusing on germinating alfalfa seeds under salt stress. Physiological indexes and transcriptomics analyses were carried out on the germinated seeds to investigate the effects of melatonin on alfalfa seedlings under salt stress conditions. Our results revealed that the application of melatonin led to an increase in shoot length and fresh weight of alfalfa seedlings under salt stress. Moreover, key physiological indexes such as peroxidase (POD) activity and glutathione (GSH) content were enhanced, while levels of malondialdehyde and superoxide anions decreased. Transcriptomic analysis identified a total of 2,131 differentially expressed genes in the salt-treated group, with 726 up-regulated and 1,405 down-regulated genes, while the MT-treated group showed 2896 differentially expressed genes, of which 1,097 were up-regulated and 1,799 were down-regulated. Further, KEGG enrichment analysis highlighted the enrichment of differentially expressed genes in pathways including flavonoid biosynthesis, ABC transporter, glutathione metabolism, and the MAPK signaling pathway, with these pathways more significantly enriched in the MT-treated group. These findings collectively suggest that melatonin plays a crucial role in alfalfa's response to salt stress and offer new insights into the genomic mechanisms underlying melatonin-mediated salt tolerance in alfalfa.

Accurate cloud quantification is essential in climate change research. In this work, we construct an automated computer vision framework by synergistically incorporating deep neural networks and finite sector clustering to achieve robust whole sky image-based cloud classification, adaptive segmentation, and recognition under intricate illumination dynamics. A bespoke YOLOv8 architecture attains over 95% categorical precision across four archetypal cloud varieties curated from extensive annual observations (2020) at a Tibetan highland station. Tailor-made segmentation strategies adapted to distinct cloud configurations, allied with illumination-invariant image enhancement algorithms, effectively eliminate solar interference and substantially boost quantitative performance even in illumination-adverse analysis scenarios. Compared with the traditional threshold analysis method, the cloud quantification accuracy calculated within the framework of this paper is significantly improved. Collectively, the methodological innovations provide an advanced solution to markedly escalate cloud quantification precision levels imperative for climate change research, while offering a paradigm for cloud analytics transferable to various meteorological stations.

The endometrium, the inner mucosal lining of the uterus, undergoes complex molecular and cellular changes across the menstrual cycle in preparation for embryo implantation. Transcrip-tome-wide analyses have mainly been utilized to study the endometrial receptivity, the prerequisite for successful implantation, with most of the studies, so far, comparing the endometrial transcriptomes between (i) secretory versus proliferative endometrium or (ii) mid-secretory versus early-secretory endometrium. In the current study, we provide the complete transcriptome description of the endometrium across the entire menstrual cycle and, for the first time, comprehensively characterize the proliferative phase of the endometrium. Our temporal transcriptome analysis includes five time points: mid-proliferative, late-proliferative (peri-ovulatory phase), early-secretory, mid-secretory, and late-secretory phases. Thus, we exhaustively unveil the transitions between the consecutive proliferative and secretory phases, highlighting their unique gene expression profiles and possible distinct biological functions. Transcriptome analysis reveals many differentially expressed genes (DEGs) across the menstrual cycle, most of which are phase-specific. As an example of the coordinated gene activity, the expression profile of his-tone-encoding genes within the HIST cluster on chromosome 6 showed an increase in cluster activity during the late-proliferative and a decline during the mid-secretory phase. Moreover, numerous DEGs are shared among all phases. In conclusion, in the current study, we delineate the endometrial proliferative phase-centered view of transcriptome dynamics across the menstrual cycle. Data analysis highlights significant transcriptomic and functional changes occurring during the late-proliferative phase – an essential transition point from the proliferative to the secretory phase. Future studies should explore how the biology of the late-proliferative phase endometrium impacts the achievement of mid-secretory endometrial receptivity or contributes to molecular aberrations leading to embryo implantation failure.

The purpose of this study was to identify candidate novel species performing beneficial ecological functions from soil. The hypothesis was that novel culturable species with antibiotic production potential could be readily found from soil in the Nature Canyon at Los Angeles Pierce College. 137 bacterial isolates from soil were grown on nutrient agar, ISP-6 medium, or LB agar and partial 16S was ascertained using the Sanger platform for regions V1-V4. One of the potentially novel isolates, Pseudomonas sp. 21-C3-ER, was isolated on nutrient agar from fallow soil in an agricultural nature preserve in Los Angeles. The soil conditions were 3.7% moisture, clay texture by touch, 13.37% organic matter, pH=6.63, TDS=638, 150 ppm nitrogen, 114 ppm phosphate, and 42 ppm potash. Whole genome sequencing was performed on the DNBseq platform and species identification was performed with TRUEBacID; the closest relative was Pseudomonas brassicacearum subsp. neoaurantiaca which was 92.05% similar by genomic evidence. 197 virulence factors were identified including flagellar biosynthesis, motor proteins, Beta-lactamase, Fosfomycin, copper, and sulfur drug resistance. Gram stain of strain 21-C3-ER revealed gram negative rods. Rods were visualized with scanning electron microscopy, revealing individuals approximately 1 µm in length. Secondary metabolite analysis using antiSMASH showed a variety of post-translationally modified proteins and a promysalin analog. The qualitative test for pyoverdine siderophore production using UV light was positive. Metabolic analysis using RAST indicated genes were present for pyoverdine production, antimicrobial resistance, and ammonification. The nitrate reduction test was positive. Denitrifying bacteria may prevent leaching of nitrates from soil, since ammonia has a higher affinity to soil and organic matter than nitrate. We propose Pseudomonas fernandeno as a novel species. The type stain is 21-C3-ER.

Glycosidic linkage analysis was conducted on the unfractionated polysaccharides in the alcohol-insoluble residues (AIRs) prepared from six red seaweeds (Gracilariopsis sp., Prionitis sp., Mastocarpus papillatus, Callophyllis sp., Mazzaella splendens, and Palmaria palmata) using GC-MS/FID analysis of partially methylated alditol acetates (PMAAs). The cell walls of P. palmata primarily contained mixed-linkage xylans and small amounts of sulfated galactans and cellulose. In contrast, the unfractionated polysaccharides of the other five species were rich in galactans displaying diverse 3,6-anhydro-galactose and galactose linkages with varied sulfation patterns. Different levels of cellulose were also observed. This glycosidic linkage method offers advantages for cellulose analysis over traditional monosaccharide analysis that is known for underrepresenting glucose in crystalline cellulose. Relative linkage compositions calculated from GC-MS and GC-FID measurements showed that anhydro sugar linkages generated more response in the latter detection method. This improved linkage workflow presents a useful tool for studying polysaccharide structural variations across red seaweed species. Furthermore, for the first time, relative linkage compositions from GC-MS and GC-FID measurements, along with normalized FID and total ion current (TIC) chromatograms without peak assignments, were analyzed using principal component analysis (PCA) as a proof-of-concept demonstration of the technique's potential to differentiate various red seaweed species.

Biological neural network (BNN) is the core brain for creature to accomplish its intelligent behaviors through unique network structure and mechanisms. It also inspires controlling human-designed autonomous agents including robots to generate more advanced intelligent behaviors by mimicking the neural control mechanism of creatures at a deeper and more interactive level. Here, we constructed a whole-brain neural network model of Caenorhabditis elegans (C. elegans), which characterizes the electrochemical processes at the level of cellular synapse. The neural network simulation integrates computational programming and visualization of neurons and synapse connections of C. elegans, containing the specific controllable circuits summarization with their dynamic characteristics within the whole network. To illustrate its particular intelligent control capability in terms of robotics, we introduce the first innovative methodology for applying the BNN model to a 12-legged robot’s movement control based on the established numerical simulation platforms. We accomplished and designed two methods and corresponding encoding processes, one involving orientation control and the other involving locomotion generation, to demonstrate the intelligent control performance of BNN. Both simulation and experiment results indicate that the robot exhibits stronger autonomy and more intelligent moving performance under the control of BNN. We then summarized the contributions for digitalizing the C. elegans’ whole-brain neural network in real-time and utilizing it to control robot in a closed loop to validate its advanced intelligence control ability in terms of a scientific robot.

Probiotics are microorganisms infused in products for health benefits including acceleration of nutrient digestion, however, it is also important to ensure the safety prior to incorporation. Here, we present evidence of the ability of two probiotic isolates,Lacticaseibacillus paracasei BCRC-16100 and Lacticaseibacillus paracasei ZFM54, in the (1) enhancement of carbohydrate digestion, (2) tolerance to stress, and (3) antibiotic resistance. Approaches include whole genome sequence (WGS) analysis and bioactivity assays. WGS revealed genes suggesting the ability of the two isolates to promote carbohydrate digestion, tolerance to stress and antibiotic resistance. Carbohydrate digestive ability was confirmed through a biochemical assay where the two isolates cause glucose release from starch. The two isolates also showed versatility in a range of temperature and alcohol concentration. For antibiotic resistance particularly on vancomycin, there are three mechanisms namely transporter control, transcriptional regulation, and efflux pump. Furthermore, promoter and transposable element analysis showed that some of the active antibiotic resistant (AbR) genes can be laterally transferred. Altogether, we show the potential of two probiotic isolates to be incorporated in products for improved carbohydrate digestion and the need to address the removal of active and mobile antibiotic resistance genes that may compromise safety.

The increase in hypoxia events, a result of climate change in coastal and fjord ecosystems, impacts the health and survival of mussels. These organisms deploy physiological and molecular responses as an adaptive mechanism to maintain cellular homeostasis under environmental stress. However, the specific effects of hypoxia on mussels of socioeconomic interest, such as Mytilus chilensis, are unknown. Using RNA-seq, we investigated the transcriptomic profiles of the gills, digestive gland, and adductor muscle of M. chilensis under hypoxia (10 days at 2 mg L-1) and reoxygenation (10 days at 6 mg L-1). There were 15,056 differentially expressed transcripts identified in gills, 11,864 in the digestive gland, and 9,862 in the adductor muscle. The response varied among tissues, showing chromosomal changes in Chr1, Chr9, and Chr10 during hypoxia. Hypoxia regulated signaling genes in the Toll-Like, mTOR, citrate cycle, and apoptosis pathways in gills, indicating metabolic and immunological alterations. These changes suggest that hypoxia-induced a metabolic shift in mussels, reducing reliance on aerobic respiration and increasing reliance on anaerobic metabolism. Furthermore, hypoxia appeared to suppress the immune response, potentially increasing disease susceptibility, with negative implications for the mussel culture industry and natural bed populations. This study provides pivotal insights into metabolic and immunological adaptations to hypoxia in M. chilensis, offering candidate genes for adaptive traits.

Abstract: The study used whole-genome sequencing (WGS) and bioinformatics analysis for the genomic characterization of 60 isolates of Listeria monocytogenes isolated from cattle farms, cattle abattoirs, and retail outlets in Gauteng province, South Africa. The isolates' sequence types (STs), clonal complexes (CCs), and lineages were determined using in silico multilocus sequence typing (MLST). We used BLAST-based analyses to identify virulence and antimicrobial genes, plasmids, proviruses, and the CRISPR-Cas system. The study investigated any association of the detected genes to the origin in the beef production chain of the L. monocytogenes isolates. Overall, in 60 isolates of Listeria monocytogenes, there were 7 STs, 6 CCs, 44 putative virulence factors, 2 resistance genes, 1 plasmid with AMR genes and 3 with conjugative genes, 1 CRISPR gene, and all 60 isolates were positive for proviruses. Among the 7 STs detected, ST204 (46.7%) and ST2 (21.7%) were the most prominent, with ST frequency varying significantly (p<0.001). The predominant CC detected were CC2 (21.7%) and CC204 (46.7%) in lineages I and II, respectively. Of the 44 virulence factors detected, 26 (across Listeria Pathogenicity Islands, LIPIs) were present in all the isolates. The difference in the detection frequency varied significantly (P<0.001). The two AMR genes (fosX and vga(G)) detected were present in all 60 (100%) isolates of L. monocytogenes. The only plasmid, NF033156, was present in 3 (5%) isolates. A CRISPR-Cas system was detected in 6 (10%), and all the isolates carried proviruses. Significant differences were detected in the frequencies of STs and virulence factors regarding the source and sample type of the L. monocytogenes isolates. The presence of both fosX and vga(G) genes in all the isolates from the three industries (cattle farms, abattoirs, and retail outlets) can potentially cause therapeutic implications. Our study, which characterized L. monocytogenes recovered from the three levels in the beef production chain in the country, provides the first evidence of the distribution of the pathogen with potential food safety and therapeutic implications.

RNA transcripts play a crucial role as witnesses of gene expression health. Identifying disruptive short sequences in RNA transcription and regulation is essential for potentially treating diseases. Let’s delve into the mathematical intricacies of these sequences. We’ve previously devised a mathematical approach for defining a “healthy” sequence (10.14218/GE.2023.00079). This sequence is characterized by having at most four distinct nucleotides (denoted as nt≤4). It serves as the generator of a group denoted as fp. The desired properties of this sequence are as follows: fp should be close to a free group of rank nt−1, it must be aperiodic, fp should not have isolated singularities within its SL2(C) character variety (specifically within the corresponding Groebner basis). Now, let’s explore the concept of singularities. There are cubic surfaces associated with the character variety of a four-punctured sphere denoted as S24. When we encounter these singularities, we find ourselves dealing with some algebraic solutions of a dynamical second-order differential (and transcendental) equation known as the Painlevé VI equation (10.3390/dynamics4010001). In certain cases, S24 degenerates, in the sense that two punctures collapse, resulting in a “wild” dynamics governed by the Painlevé equations of an index lower than VI. In our paper, we provide examples of these fascinating mathematical structures within the context of miRNAs. Specifically, we find a clear relationship between decorated character varieties of Painlevé equations and the character variety calculated from the seed of oncomirs. These findings should find applications in cancer research.

Plant transcriptomes are an extremely dynamic entities shaped spatially and temporally by many intracellular and environmental cues. In this review, we first summarize the complexity and diversity of plant genomes and transcriptomes as a start point for the multitude of transcriptomic responses. Numerous alterations within various tissue and organ-specific transcriptomes as well as the most relevant transcriptomic responses associated with plant acclimation to selected abiotic and biotic stress conditions, from the current studies employing high-throughput transcriptomic analysis are widely discussed. Understanding changes within plant transcriptomes, revealed by in silico functional analysis, allows for the characterization of stress-affected genes and stress acclimatory mechanisms, as well as allows to perform plant metabolic engineering. The latter allow cultivars to produce more secondary metabolites in the future, which are often desirable substances in the biomedical industry. Accordingly, in this review special attention was also paid to characterize the potential of transcriptomic analyses of medicinal species, particularly to search for new cultivars. Extensive characterization of transcriptomic responses in stress would also result in the development of new cultivars that display physiological and molecular mechanisms that allow them to cope with adverse environmental conditions more adequately.

With the rising cost of animal feed protein, finding affordable and effective substitutes is crucial. Walnut kernel cake, a polyphenols, fiber, protein and fat-rich byproduct of walnut oil extraction, has been underexplored as a potential protein replacement in pig feed. In this study, we found that feeding large Diqing Tibetan pigs walnut kernel cake promoted adipose deposition and improved pork quality during pig growth. Transcriptome analysis revealed the upregulation of genes ANGPTL8, CCNP, ETV4, and TRIB3, associated with adipose deposition. Pathway analysis highlighted enrichment in adipose-deposition-related pathways, including PPAR, Insulin, PI3K-Akt, Wnt, and MAPK signaling. Further analysis identified DEGs (differentially expressed genes) positively correlated with adipose-related traits, such as PER2 and PTGES. Single-cell transcriptome data pointed to the specific expression of CD248 and PTGES in adipocyte progenitor/stem cells (APSCs), pivotal for adipocyte differentiation and adipose deposition regulation. This study demonstrates walnut kernel cake's potential to substitute soybean cake in pig feed, providing high-quality protein and promoting adipose deposition. It offers insights into feed protein replacement, human functional food, fat metabolism, and related diseases, with marker genes and pathways supporting pig breeding and pork quality improvement.

INTRODUCTION : In this scoping review, we delve into the transformative potential of artificial intelligence (AI) in addressing challenges inherent in whole genome sequencing (WGS) analysis, with a specific focus on its implications in surgical oncology. METHODS: Scoping review of whole genomic sequencing and artificial intelligence.DISCUSSION : Unveiling the limitations of existing sequencing technologies, the review illuminates how AI-powered methods emerge as innovative solutions to surmount these obstacles. The evolution of DNA sequencing technologies, progressing from Sanger sequencing to next-generation sequencing, sets the backdrop for AI's emergence as a potent ally in processing and analyzing the voluminous genomic data generated by these technologies. Particularly, deep learning methods play a pivotal role in extracting knowledge and discerning patterns from the vast landscape of genomic information. In the context of oncology, AI-powered methods exhibit considerable potential across diverse facets of WGS analysis, including variant calling, structural variation identification, and pharmacogenomic analysis. CONCLUSIONS : This review underscores the significance of multimodal approaches in diagnoses and therapies, highlighting the imperative for ongoing research and development in AI-powered WGS techniques. Integrating AI into the analytical framework empowers scientists and clinicians to unravel the intricate interplay of genomics within the realm of multi-omics research, paving the way for more personalized and targeted treatments in surgical oncology and perhaps beyond.

The genetic bases of Alzheimer's disease (AD) and frontotemporal dementia (FTD) have been comprehensively studied, which is not the case for atypical cases not classified into these diagnoses. In the present study, we aim to contribute to the molecular understanding of the development of non-AD and non-FTD dementia by surveying rare pathogenic variants. The analysis was performed on 91 patients, the DNA samples of which were pooled and then subjected to whole exome sequencing. Among detected variants two are rare pathogenic and show significant difference in frequency between the analyzed pool and gnomAD Bulgarian control exomes. The rs373478202, G>T, B9D1 variant, most likely present in heterozygous state; is causative for the autosomal recessive ciliopathy- Joubert syndrome, which involves specific CNS malformation. The rs148918985, C>T, ASS1 variant leads to arginosuccinate enzyme deficiency and in compound heterozygosity with other rare pathogenic variant detected in the same gene causes the late-onset form of citrullinemia type I. This disorder causes high ammonia levels, which can lead to cerebral dysfunction. In conclusion, the detected rare pathogenic variants suggest that, in certain cases, the development of non-AD and non-FTD dementia can be mediated by structural alterations in neuronal cilia or by hyperammoniemia.

The application of deep learning algorithms to predict the molecular profiles of various cancers from digital images of hematoxylin and eosin (H&E)-stained slides has been reported in recent years, mainly in gastric and colon cancers. In this study, we investigated the potential use of H&E-stained endometrial cancer slide images to predict the associated mismatch repair (MMR) status. H&E-stained slide images were collected from 127 cases of the primary lesion of endometrial cancer. After digitization using a Nanozoomer virtual slide scanner (Hamamatsu Photonics), we segmented the scanned images into 5,397 tiles of 512 × 512 pixels. The MMR proteins (PMS2, MSH6) were immunohistochemically stained, classified into MMR proficient/deficient, and annotated for each case and tile. We trained several neural networks, including convolutional and attention-based networks, using tiles annotated with the MMR status. Among the tested networks, ResNet50 exhibited the highest area under the receiver operating characteristic curve (AUROC) of 0.91 for predicting the MMR status. The constructed prediction algorithm may be applicable to other molecular profiles and useful for pre-screening before implementing other, more costly genetic profiling tests.

Heteroresistance (HR) to colistin is especially concerning in settings where multi-drug resistant (MDR) K. pneumoniae are prevalent and empiric use of colistin might lead to treatment failures. This study aimed to assess the frequency of occurrence of colistin HR (CHR) among (MDR) K. pneumoniae (n=676) isolated from patients hospitalized in 13 intensive care units (ICUs) in 6 European countries in a clinical trial assessing the impact of decolonization strategies. All isolates were whole-genome-sequenced and studied for in vitro colistin susceptibility. Majority were colistin-susceptible (CS) (n=597, MIC 2 µg/ml). 288 CS isolates were randomly selected for population analysis profiling (PAP) to assess CHR prevalence. CHR was detected in 108/288 CS K. pneumoniae. No significant association was found between the occurrence of CHR and country, MIC-value, K-antigen type and O-antigen type. Overall, 92% (618/671) of the K. pneumoniae were MDR with high prevalence among CS (540/592) and CR (98.7%, 78/79) isolates. In contrast, proportion of carbapenemase-producing K. pneumoniae (CP-Kpn) was higher among CR (72.2%, 57/79) than CS isolates (29.1%, 173/594). Proportions of MDR and CP-Kpn were similar among CHR (MDR: 85%, 91/107; CP-Kpn: 29.9%, 32/107) and CS isolates (MDR: 91%, 539/592; CP-Kpn: 29.1%, 153/59). WGS analysis of PAP isolates showed diverse insertion elements in mgrB or even among technical replicates underscoring the stochasticity of the CHR phenotype. CHR isolates showed high ST diversity (Simpson’s diversity index, SDI: 0.97, in 52 of the 85 STs tested). CR (SDI: 0.85) isolates were highly associated with specific STs (ST101, ST147, ST258/ST512, P ≤ 0.003). The widespread nature of CHR among MDR K. pneumoniae in our study urge the development of rapid HR detection methods to inform on the need for combination regimens.

Due to its time effective, joint friendly and highly customizable character whole-body-electromyostimulation (WB-EMS) is regarded as a feasible solution for a large variety of training issues particularly in the area of non-athletic application. To identify gaps in research and summarize prevalent evidence we conducted an evidence map on outcomes addressed by WB-EMS trials in middle-aged to older, non-athletic adults. Based on a comprehensive systematic search in five databases and two study registers according to PRISMA, 54 projects published in 80 articles were included. More than 90% of the studies reported outcomes related to the physical fitness or function domain. Body composition parameters were addressed by two thirds of the projects. Health-related outcomes addressed by WB-EMS included cancer/neoplasm (n=7), endocrine regulation (n=8), glucose metabolism (15), nervous system diseases (n=2), cardiovascular system diseases (n=22), non-specific chronic low back pain (n=4), osteopenia (n=5) and diseases of the renal system (n=12). Outcomes related to inflammation were addressed 18 times. Of importance, no studies reported clinically relevant adverse effects related to the WB-EMS intervention. In summary, while considerable evidence on outcomes related to fitness/function and body composition is prevalent, evidence gaps of WB-EMS research were particular evident for diseases of the nervous and cerebrovascular system.

Retrospective information about the climate system and plant ecophysiology are key inputs in climate and Earth system modelling. Dendrochronology provides such information with large spatiotemporal coverage, and stable carbon isotope (¹³C/¹²C) analysis across tree-ring series is among the most advanced dendrochronological tools. For the past seventy years, this analysis was performed on whole molecules, and, to this day, ¹³C/¹²C variation is attributed to ¹³C discrimination during CO₂ diffusion into leaves and assimilation by rubisco. By contrast, ¹³C discrimination by post-rubisco processes is presumed constant. Here, recently reported results on the first dataset of intramolecular ¹³C discrimination in tree rings were synthesised by variance component analysis. The emerging picture is not consistent with the classical (DR-discrimination-centred) concepts and practices of carbon-isotope dendrochronology. Specifically, leaf and stem post-rubisco discrimination each account for more variation in the data than diffusion-rubisco discrimination, i.e., post-rubisco discrimination is not constant. Furthermore, diffusion-rubisco discrimination is used widely as proxy of leaf intrinsic water-use efficiency (iWUE), a key determinant in the responses of global biogeochemical cycles to climate change. However, since diffusion-rubisco discrimination is a small component of the total data variance, whole-molecule analysis yields confounded iWUE estimates, yet intramolecular analysis will likely offer solutions. Lastly, all currently observed ¹³C/¹²C-climate relationships are attributed to diffusion-rubisco discrimination. However, here, relationships with temperature and radiation derive from leaf-level post-rubisco discrimination while relationships with precipitation derive from stem-level post-rubisco discrimination. That said, advances in mass spectrometry may soon make intramolecular ¹³C/¹²C analysis broadly available taking carbon-isotope dendrochronology to the next level.

Inflammation is an important biological response to any tissue injury. The immune system responds to any stimulus, such as irritation, damage, or infection, by releasing pro-inflammatory cytokines. Overproduction of pro-inflammatory cytokines, including TNF-α and IL-1b, can lead to several diseases eg.,, cardiovascular diseases, joint disorders, cancer, and allergies. Emerging science suggests that whole grains may lower the markers of inflammation. Whole grains are a significant source of dietary fibres and phenolic acids that have inverse association with the risk of inflammation. The dietary fibres and phenolic acids composition of whole grains is very distinct over different grains. Whole grains (cereals and pseudo-cereals) are rich in both dietary fibres e.g., arabinoxylan, β-glucan and phenolic acids e.g., hydroxycinnamic acids, hydroxybenzoic acids, which are predominantly present in the bran layer. Although the biological mechanisms underlying widely reported association between whole grains consumption and a lower risk diseases are not fully understood. The modulatory effects of whole grains on inflammation also likely to be influenced by several mechanisms, including the effect of dietary fibres and phenolic acids, while some of these effects are direct, others involve gut microbiota, which transform important bioactive substances into more useful metabolites that moderate inflammatory signaling pathway. Thus, the aim of this review is two folded: first is to discuss the types of dietary fibres and phenolic acids commonly found in cereals and pseudo-cereals, and their health benefits observed in animal and human studies. Second, we review existing literature on the linkage between consumption of whole grains and markers of subclinical inflammation, the role of dietary fibres, phenolic acids, and gut microbiota on the anti-inflammatory activity of whole grains intake. Altogether, scientific data on the ant-inflammatory properties of whole grains are encouraging, further researches are needed to cover the gap between the emerging sciences of whole grains dietary fibres, phenolic acids and inflammation.

Coccomyxa subellipsoidea KJ (C-KJ) is a green alga with unique immunoregulatory characteristics. Here, we investigated the mechanism underlying the modification of T cell function by C-KJ components. The water-soluble extract of C-KJ was fractionated into protein (P) and sugar (S) fractions [acidic (AS), basic (BS), and neutral (NS)]. These fractions were used for the treatment of peripheral blood mononuclear cells stimulated with toxic shock syndrome toxin-1. Transcriptome analysis revealed that both P and AS enhanced the expression of the genes encoding metallothionein (MT) family proteins, inflammatory factors, and T helper (Th) 17 cytokine and suppressed that of those encoding Th2 cytokines in stimulated T cells. The kinetics of MT1 and MT2A gene expression showed a transient increase in MT1 and maintenance of MT2A mRNA after T cell stimulation in the presence of AS. The kinetics of Th17-related cytokine secretion in the early period were comparable to those of MT2A mRNA. Furthermore, our findings revealed that static, a STAT-3 inhibitor, significantly suppressed MT2A gene expression. These findings suggest that the expression of MTs is involved in the immune regulatory function of C-KJ components, which is partially regulated by Th17 responses, and may help develop innovative immunoregulatory drugs or functional foods.

During the last few years, advancement in the area of biochemistry, science of the material world, engineering and computer-aided testing has directed towards advancement of high-throughput tools for the sake of profiling information encoded in a gene. Single-cell RNA-sequencing (scRNA-seq) tools capable to examine the sequence data from each individual cells and it shows within population variety and permit exploring of cell conditions and transformation by extreme resolution, possibly give out cell sub-types or gene expression fluctuations that are shaded in mass sequencing processes, which shows population-averaged evaluations. Yet, the major disadvantage for this tool is the lack of success to pick out location related details of the RNA transcriptome, as this needs tissue detachment and cell isolation. Location based transcript determination is among the advancements in the area of medical biotechnology as this can find out the molecules like RNA dataset in their intact physical placement in tissue segment with spatial context at the scale of a single-cell, which is very advantageous as compare to single-cell sequencing techniques. These approaches give key observation in the areas of biomedical field sub-disciplines like neurology, embryology, carcinoma study, immune cell investigation and histological activities. Generally, this review mainly focused towards single-cell sequencing methods, technology development, its challenges observed, different expression data analysis mechanisms and their applications in different areas, such as in cancer research, microbes, central nervous system, sex organs and immune-biology, intensifying the essentiality of sequencing tools at single-cell level for the characterization of extremely dynamic individual cells.

Whole genome alignment (WGA) is a critical process in comparative genomics, facilitating the detection of genetic variants and aiding our understanding of evolution. This paper offers a detailed overview and categorization of WGA techniques, encompassing suffix tree-based, anchors-based, and graph-based methods. It elaborates on the algorithmic properties of these tools, focusing on performance and methodological aspects. The paper underscores the latest progress in WGA, emphasizing the increasing capacity to manage the growing intricacy and volume of genomic data. However, the field still grapples with computational and biological hurdles affecting the precision and speed of WGA. We explored these challenges and potential future solutions. This paper aims to provide a comprehensive resource for researchers, deepening our understanding of WGA tools and their applications, constraints, and prospects.

Coffee Coffea arabica L. depends on abundantly distributed rainfall and drought impacts their development, fruit production, bean quality, and ultimately, beverage quality. Plant Biotechnology by means of genetic manipulation and plant regeneration by the somatic embryogenic process is an alternative technology to overcome these prob-lems. In the present work we used the molecular approach of the trehalose/trehalase role in plant surviving in extreme drought/salt environments. We used a cassette containing the antisense C. arabica L. trehalase gene under the RD29 promoter from A. thaliana and the NOS terminator to genetically modified an em-bryogenic coffee C. arabica L. cv typica line under osmotic stress supplemented with mannitol (0.3M) and sorbitol (0.3M) containing medium. Drought resistant SE lines were recovered and regenerate plants. Resistant SE lines showed a higher rate of competence to induce secondary SE capacity. A transcrip-tome analysis was performed from high competent SE lines to understand the acquired molecular mechanisms to developed SE. From the up-regulated genes, a PPI network made by STRING v12.0 with high confidence (0.700) revealed the presence of the 10 modules. The cell cycle, chromatin remodeling, somatic embryogenesis, oxidative stress, generic transcription pathway, carbon metabolism, phenylpropanoid biosynthesis, trehalose biosynthesis, proline bio-synthesis and glycerolipid metabolism.

Recent studies have elucidated the diversity of genes encoding venom in sea anemones. However, most of those genes are yet to be explored in an evolutionary context. Insulin is a common peptide across metazoans and has been coopted into a predatory venom in many venomous lineages. In this study, we focus on the diversity of insulin-derived venoms in sea anemones and on elucidating their evolutionary history. We sourced data for 34 species of sea anemones and found sequences belonging to two venom families that have Insulin PFAM annotations (Cono-Insulin, VP302). Our findings show that both families have undergone duplication events. Members of each of the independently evolving clades have consistent predicted protein structures and distinct dN/dS values. Our work also shows that VP302 is part of a multidomain venom contig and has experienced a secondary gain into the venom system of cuticulate sea anemones.

Background: The circadian system, a vital temporal regulator influencing physiological processes, has implications for cancer development and treatment response. Our study assesses circadian timing's impact on whole-brain radiotherapy outcomes in brain metastases for personalized cancer therapy insights. Aim: Evaluate circadian influence on radiation treatment timing and its correlation with clinical outcomes. Identify patient populations benefiting from interventions synchronizing circadian rhythms, considering subgroup differences and potential disparities related to social determinants of health (SDoH). Design: IRB-approved retrospective analysis of 237 patients undergoing whole-brain radiotherapy for brain metastases (2017–2021), receiving over 80% of treatments in the morning or afternoon. Survival analyses utilized Kaplan–Meier curves. Setting/Participants: Single-institution study involving patients receiving whole-brain radiotherapy. Collected demographic, disease, and socioeconomic parameters from electronic medical records. Results: Morning treatment (n=158) showed a trend towards improved overall survival vs. afternoon (n=79), median survival 158 vs. 79 days (p=0.20, HR=0.84, CI95% 0.84–0.91). Subgroup benefits for morning treatment in females (p=0.04) and trends in controlled primary disease (p=0.11) and breast cancer metastases (p=0.08). SDoH-based disparities observed, with Black and lower-income patients exhibiting diminished circadian influence. Conclusions: Emphasizes chronobiological factors' relevance in brain metastases radiation therapy. Morning treatment correlates with improved survival, particularly in specific subgroups. Identifies potential circadian influence disparities based on SDoH, laying a foundation for personalized cancer therapy and interventions synchronizing circadian rhythms for enhanced treatment efficacy.

We investigated the potential genetic variants using whole exome sequencing (WES) and evalu-ated the disease course using T cell receptor (TCR) repertoire analysis in rheumatoid arthritis (RA). Fourteen patients with RA and five healthy controls (HCs) were enrolled. For patients with RA, only naïve patients were recruited before treatment, and data were collected at baseline and 6 and 12 months after the initiation of disease-modifying antirheumatic drug (DMARD) treatment. Laboratory data and disease parameters were also collected. Genetic variants were detected using WES, and the diversity of the TCR repertoire was assessed using Shannon-Weiner diversity. Some variants were detected by WES, but their clinical significance should be confirmed by further studies. The diversity of the TCR repertoire in patients with RA was lower than that in HCs; however, after DMARD treatment, it increased significantly. The diversity was negatively cor-related with laboratory findings and disease measures with statistical significance. Variants with a potential for RA pathogenesis were identified and the clinical significance of TCR repertoire was evaluated in Korean patients with RA. Further studies are required to confirm the findings of the present study.

The role of postmastectomy radiotherapy and regional nodal irradiation after radical mastectomy is defined in high-risk patients with locally advanced tumors, positive margins, and unfavorable biology. The benefit of postmastectomy radiotherapy in intermediate-risk patients (T3N0 tumors) remains a matter of controversy. It has been demonstrated that radiotherapy after breast-conserving surgery lowers the locoregional recurrence rate compared with surgery alone and improves the overall survival rate. In patients with 4 or more positive lymph nodes or extracapsular extension regional lymph node irradiation is indicated regardless of the surgery type (breast-conserving surgery or mastectomy). Despite the consensus that patients with more than 3 positive lymph nodes should be treated with radiotherapy, there is a controversy regarding the recommendations for patients with one to three involved lymph nodes. In patients with N0 disease with negative findings on axillary surgery, there is a trend to administer regional lymph node irradiation in patients with a high risk of recurrence. In patients treated with neoadjuvant systemic therapy and mastectomy, adjuvant radiotherapy should be administered in case of clinical stage III and/or ≥ypN1. In patients treated with neoadjuvant systemic therapy and breast-conserving surgery, postoperative radiotherapy is indicated irrespective of pathological response.

Single-cell green microalga Nannochloropsis oceanica is potentially considered to be the bioresource for biofuel and pharmaceutical production. Urea is a kind of nutrient component for photosyn-thetic N. oceanica. Meanwhile, urea could induce to accumulate some substances such as lipid and affect its growth and physiology. However, how marine microalga N. oceanica respond and adapt to urea addition remains elusive. Here, acclimation of the metabolic reprogramming to changes in the nutrient environment was studied by high-throughput mRNA sequencing in N. oceanica under Ct vs U, there were 2104 genes displayed differential expression (including 1354 upregulation and 750 downregulation, respectively) and some pathways including carbon/nitrogen metabolism, photosynthesis, and lipid metabolism would be reprogrammed in N. oceanica. The results showed that genes related to photosynthesis in N. oceanica were significantly down-regulated, especially those related to light harvesting proteins. Interestingly, urea absorption and transport may de-pend not only on specialized transport mechanisms such as urease, but also on alternative transport channels such as the ABC transporter family, CLC protein family. In addition, urea causes specific changes in carbon and lipid metabolism. Genes associated with the Calvin cycle and carbon concentration mechanisms were significantly upregulated. In lipid metabolism, genes associated with lipases, or polyunsaturated fatty acid enzymes, are highly activated. In addition, expression is enhanced in the tricarboxylic acid cycle and folate metabolism, making important contributions to energy supply and synthesis and modification of genes or macromolecules. These phenomena indicate that N. oceanica actively and dynamically regulates the redistribution of carbon and nitrogen after urea addition., which will provide references for further research on the effects of urea on N. oceanica.

The flowering of Amorphophallus bulbifer plays an important role in its reproduction. The flowers and leaves of A. bulbifer cannot grow at the same time. However, the physiological and molecular mechanisms involved in flower bud and leaf bud formation are still unclear. In this study, the flower buds and leaf buds of A. bulbifer in the early stage of growth were used as research materials, transcriptome and metabolome analyses were carried out, and the soluble sugar and starch contents of A. bulbifer corms were determined. Transcriptome analysis revealed 5 542 differentially expressed genes (DEG) between flower buds and leaf buds, 3 107 of which were upregulated and 2 435 of which were downregulated. Enrichment analysis of the KEGG pathway showed that these differential genes were enriched mainly in the plant hormone signal transduction, DNA replication and fatty acid elongation pathways. Plant hormone signal transduction, DNA replication and fatty acid elongation pathways. A total of 5 296 significant differentially abundant metabolites were screened out by nontargeted metabolomics analysis. The differentially abundant metabolites were functionally classified in the HMDB, and 118 were successfully matched, including 17 that were highly expressed in flower buds. The differentially abundant metabolites in the flower buds were mainly enriched in pathways such as amino acid metabolism, isoquinoline alkaloid biosynthesis and pyrimidine metabolism. Targeted metabolomics analysis revealed that the contents of ABA, ZT and iPA in flower buds were significantly greater than those in leaf buds, while the opposite trend was observed for IAA. The analysis of soluble sugar and starch contents showed that the starch and soluble sugar contents in flower buds were significantly greater than those in leaf buds. The results of this study showed that flower bud development in A. bulbifer was regulated by amino acids, starch, ABA, ZT, iPA, IAA and other hormones. These findings could lead to valuable genetic resources for further study of A. bulbifer flowering and provide a deeper understanding of the molecular basis of A. bulbifer flowering.

Policy initiatives by the United Nations and EU institutions have emphasized the need for higher education institutions (HEIs) to fulfill a significant role in the green transition, and that they tend to fall short of the achievement of this objective. Multiple studies indicate that HEIs assign high importance to the integration of environmental sustainability on a strategic level but generally lack dedicated policies of integration in operational aspects. This paper analyzes the state of the art on research on HEI sustainability and maps institutional sustainability self-assessment models, tools, and guidelines. The mapping was conducted in four prominent research areas: 1) sustainability integration in educational activities, pedagogical perspectives, and systemic transformations; 2) benchmarking sustainability of organizational transformation and operational op-timization, and links between developmental priorities and educational settings; 3) whole-system approaches focusing on the design and implementation of whole-institution sustainability plans; and, 4) HEI sustainability culture and operations. Best practices were selected on criteria of 1) the effectiveness of self-assessment models, tools, and guidelines in each respective research area; 2) the degree of integration of systems thinking and/or modelling; and 3) the incorporation of qualitative indicators for stakeholder engagement.

Klebsiella pneumoniae is a leading cause of healthcare acquired infections. The severity of the infections is multifactorial including virulence and antimicrobial resistance properties. The objective of the study was to investigate the virulence determinants of K. pneumoniae strains colonizing patients hospitalized in the intensive care units (ICU) of a tertiary hospital in Uganda. A hospital based cross-sectional study involving 103 patients admitted in the ICU of Mulago National Referral hospital was conducted from January 2022 to April 2022. A total of 31 identified clinical strains of K. pneumoniae isolated from rectal swabs of the same number of patients were characterized. Susceptibility testing of colistin was performed by broth microdilution method, thereafter, 5 colistin resistant K. pneumoniae were purposefully selected for whole genome sequencing. Bioinformatics analysis was performed using established web-based tools to detect virulence genes, sequence type and other genomic features. Numerous virulence factor genes related to pathogenicity of K. pneumoniae were identified. They ranged from those related to colonization to those of persistence and dissemination including capsule genes (wzi), siderophore systems; yersiniabactin (ybt15), aerobactin (iutA), enterobactin (entC, entD, entF, entS, fepB, fepD, fepG, fes), and salmochelin (iroN), secretion systems; type II (T2SS) and type VI (T6SS-1). Furthermore, the isolates harbored outer membrane protein (ompA) gene, biofilm synthesis gene (fimH) and several adhesion genes. The results demonstrate the dual-risk of K. pneumoniae strains combining high level of virulence and colistin resistance which is a great concern as it leads to unmanageable infection outbreaks with high morbidity and mortality.

Apple red flesh coloration is a result of the performance of biochemical pathway involved in the biosynthesis of anthocyanins and anthocyanidins. Based on apple genome analysis, high number of regulatory genes, mainly transcription factors such as MYB, which are components of regulatory complex MYB-bHLH-WD40, and several structural genes (PAL, 4CL, CHS, CHI, F3H, DFR, ANS, UFGT) involved in anthocyanin biosynthesis have been identified so far. In this study, we investigated previously unrecognized genes involved in the constitution of red-flesh apple phenotype. These genes could be concerned as molecular markers for early selection of new apple cultivars. Based on comparative transcriptome analysis of apples with different fruit flesh coloration, we successfully identified and characterized ten genes from plant hormone transduction pathway of: auxin (GH3); cytokinins (B-ARR); gibberellins (DELLA); abscisic acid (SnRK2 and ABF); brassinosteroids (BRI1, BZR1 and TCH4); jasmonic acid (MYC2); and salicylic acid (NPR1). In presented studies an analysis of their expression profiles was performed in immature and ripe fruits of red-fleshed cultivars. Generally, we have uncovered, the set of the novel genes, mediating regulation of the abscisic acid, salicylic acid, cytokinins and jasmonic acid signaling and preliminarily described their role in anthocyanin biosynthesis, accumulation and degradation. Their expression was not characterized in apple fruits so far. Presented study, allowed to underline the relationship of genes from hormone signal transduction pathway with UFGT gene, directly responsible for anthocyanin color transformation as well as confirmed their crucial role of plant hormone regulation and anthocyanin accumulation during apple fruit ripening.

Hypervirulent Klebsiella pneumoniae (hvKp) is a variant that has been increasingly linked to severe, life threatening infections including pyogenic liver abscess and bloodstream infections. HvKp belonging to the capsular serotypes K1 and K2 have been reported worldwide, however very scarce studies are available on the their genomics and virulence. In the current study we report four hypermucoviscous hvKp ESBL clinical strains of capsular serotype K1 and K2 isolated from pus and urine of critically ill patients in tertiary care hospitals in Oman. These strains belong to diverse sequence types (STs) namely ST-23(K1), ST-231(K2), ST-881(K2), and ST-14(K2). To study their virulence, Galleria Mellonella model and resistance to human serum killing were used. The G. mellonella model revealed that the K1/ST-23 isolate is the most virulent as 50% of the larvae died in the first day, followed by isolate K2/ST-231 for which 75% of the larvae died in the second day and isolate K2/ST-14 for which 50% of the larvae died in the second day. Resistance to human serum killing showed there was complete inhibition of bacterial growth of all four isolates by the end of the first hour and up to the third hour. For ST-23(K1), ST-231(K2), ST-881(K2), and ST-14(K2), there was a gradual decrease in the number of colonies up to the second to third hour, which indicates neutralization of bacterial cells by the serum components. However, this was followed by sudden increase of bacterial growth, indicating possible resistance of bacteria against human serum bactericidal activity. Whole genome sequencing (WGS) revealed that hvKp strains display unique genetic arrangement of k-loci. Whole genome SNP-based phylogenetic analysis revealed that these hvKp isolates are phylogenetically distinct, belonging to diverse clades and belong to different STs in comparison to global isolates. This is the first report from Oman detailing the WGS of hvKp clinical isolates and assessing their resistance and virulence genomics, which reinforce our understanding of their epidemiology and dissemination in clinical settings.

DNA-binding transcription factors are broadly characterized as proteins that bind to specific sequences within genomic DNA and modulate the expression of downstream genes. This study focused on KojR—a transcription factor involved in the metabolism of kojic acid, which is an organic acid synthesized in Aspergillus oryzae and is known for its tyrosinase-inhibitory properties. However, the regulatory mechanism underlying KojR-mediated kojic acid synthesis in remains unclear. Hence, we aimed to obtain a comprehensive identification of KojR-associated genes using genomic Systematic Evolution of Ligands by Exponential enrichment (gSELEX-Seq) and RNA-Seq. During the genome-wide exploration of KojR-binding sites via gSELEX-Seq and identification of KojR-dependent differentially expressed genes (DEGs) using RNA-Seq, we confirmed that KojR directly regulates kojT, as was previously reported. We also observed that kojA expression, which may be controlled by KojR, was significantly reduced in a ΔkojR strain. Notably, no binding of KojR to the kojA promoter region was detected. Furthermore, certain KojR-dependent DEGs identified in the present study were associated with enzymes implicated in the carbon metabolic pathway of A. oryzae. This strongly indicates that KojR plays a central role in carbon metabolism in A. oryzae.

Vaccine development against SARS-CoV-2 has been highly successful in slowing down the COVID-19 pandemic. A wide spectrum of approaches including vaccines based on whole viruses, protein subunits and peptides, viral vectors, and nucleic acids have been developed in parallel. For all types of COVID-19 vaccines, good safety and efficacy have been obtained in both preclinical animal studies and in clinical trials in humans. Moreover, emergency use authorization has been granted for all types of COVID-19 vaccines. Although high safety has been demonstrated, rare cases of severe adverse events have been detected after global mass vaccinations. Emerging SARS-CoV-2 variants possessing enhanced infectivity have affected vaccine protection efficacy requiring re-design and re-engineering of novel COVID-19 vaccine candidates. Furthermore, insight into preparedness against emerging SARS-CoV-2 variants and other future viral infections is given.

New insights into the causes and mechanisms of congenital heart disease (CHD) have been gained through the use of next-generation sequencing. Examination of the whole exome sequence detects detrimental gene variations modifying single or contiguous nucleotides, that are characterised as pathogenicity based on statistical assessments of families. and correlates with congenital heart disease, elevated expression during heart development, and reduction of harmful protein-coding mutations in the general population. Patients with CHD and extracardiac abnormalities enriched for gene classes meeting these criteria. CHDs and extracardiac defects, supporting a common set of pathways in the organogenesis of CHDs. Single-cell transcriptomics data reveal the expression of genes associated with CHD in specific cell lineages, and emerging evidence suggests that genetic variants disrupt multicellular genes essential for cardiogenesis. Metrics and units are being tracked in whole genome sequence studies.

To accurately predict the matching relationships between the various components and the engine performance in the whole aero-engine environment, this study introduces a two-dimensional throughflow simulation method for the whole aero-engine. This method is based on individual throughflow solvers for the turbo-machinery and the combustor. It establishes a throughflow simulation model for the whole engine by integrating with the compressor-turbine co-operating equations and boundary conditions. The turbo-machinery throughflow solver employs a circumferentially averaged form of the time-dependent Navier-Stokes equations (N-S) as the governing equation. The combustor solver uses the Reynolds Average Navier-Stokes (RANS) method to solve flow and chemical reaction processes by constructing turbulence, combustion, and radiation models. The accuracy of the component solver is validated using Pratt & Whitney’s three-stage axial compressor (P&W3S1) and General Electric’s high-pressure turbine (GE-EEE HPT), and the predicted results are consistent with the experimental data. Finally, the developed throughflow method is applied to simulate the throttling characteristics of the WZ-X turboshaft engine. The results predicted by the throughflow program are consistent with the GasTurb calculations, including the trends of shaft power delivered, specific fuel consumption (SFC), inlet airflow, and total pressure ratio of the compressor. The developed method to perform throughflow simulation of the whole aero-engine eliminates the dependence on a general component map. It can quickly obtain the meridian flow field parameters and overall engine characteristics, which is expected to guide the design and modification of the engine in the future.

Basil, renowned for its aromatic properties, exhibits commendable drought tolerance and holds significant value both as an edible and medicinal plant. Recognizing the scarcity of studies addressing basil’s response to drought stress, we undertook a comprehensive analysis of the volatile metabolome and transcriptome of sweet basil across four distinct levels of drought stress. Our metabolic analysis meticulously identified 830 metabolites, with 215 differentially accumulated metabolites discerned. Notably, the primary constituents of sweet basil volatiles exhibited minimal alterations, while the differentially accumulated metabolites were predominantly lipids and terpenes. The transcriptome analysis unveiled 27,181 differentially expressed DEGs, with a predominant focus on metabolic pathways and biosynthesis of secondary metabolites. Integrating insights from both transcriptome and volatile metabolomic analyses highlighted the pivotal roles of Alpha-linolenic acid, flavonoid, and lignin metabolism in fortifying the resistance of sweet basil against drought stress. This holistic approach not only enriches our understanding of the molecular intricacies underpinning basil’s drought resistance but also furnishes valuable insights for the molecular breeding of basil varieties endowed with enhanced drought tolerance.

The diversity of leaf characteristics, including leaf color, is a prominent subject of study in plant science. Leaf color is predominantly determined by the synthesis and functionality of chlorophyll, a key component of photosynthesis. The regulation of chlorophyll synthesis and degradation involves complex gene interactions, and disruptions in these processes can lead to abnormal chlorophyll synthesis and impact leaf color. This study focuses on Bambusa multiplex f. silverstripe, a natural variant with various leaf colors, including green, white, and green-white leaves. The variations in leaf color are attributed to genetic factors and their influence on gene expression. By employing RNA-seq, we investigate the molecular mechanisms behind chlorophyll anomalies and genetic factors in Silverstripe. Our findings shed light on the complexity of gene interactions and regulatory networks that underlie leaf color diversity and provide valuable insights for future research and plant breeding.

Transposable elements (TEs) are repetitive elements which make up around 45% of the human genome. A class of TEs known as SINE-VNTR-Alu (SVA) demonstrate the capacity to mobilise throughout the genome, resulting in SVA polymorphisms for presence or absence within the population. Although studies have previously highlighted the involvement of TEs within neurodegenerative diseases, such as Parkinson’s disease and amyotrophic lateral sclerosis (ALS), however the exact mechanism has yet to be identified. In this study we used whole genome sequencing and RNA sequencing data of ALS patients and healthy controls from the New York Genome Center ALS Consortium, to elucidate the influence of reference SVA elements on gene expression genome-wide within central nervous system (CNS) tissues. To investigate this, we applied matrix expression quantitative trait loci analysis and demonstrated that reference SVA insertion polymorphisms can significantly modulate the expression of numerous genes, preferentially in the trans position, and in a tissue-specific manner. We also highlight that SVAs significantly regulate mitochondrial genes as well as genes within the HLA and MAPT loci, previously associated within neurodegenerative disease. In conclusion, this study continues to bring to light the effects of polymorphic SVAs on gene regulation and further highlights the importance of TEs within disease pathology.

Whole-body electromyostimulation (WB-EMS) can be considered as a time-efficient, joint-friendly and highly customizable training technology that attracts a wide range of users. The present evidence map aimed to provide an overview of different non-athletic cohorts addressed by WB-EMS research. Based on a comprehensive systematic search according to PRISMA, eighty-six eligible longitudinal trials were identified that correspond with our eligibility criteria. In summary, WB-EMS research sufficiently covers all adult age categories in males and females. Most cohorts addressed (58%) were predominately or exclusively overweight/obese and in about 60% of them, diseases or conditions were inclusion criteria for the trials. Cohorts specifically addressed by WB-EMS trials suffer from cancer/neoplasm (n=7), obesity (n=6), diabetes mellitus (n=5), the metabolic syndrome (n=2), nervous system diseases (n=2), chronic heart failure (n=4), stroke (n=1), peripheral arterial diseases (n=2), knee arthrosis (n=1), sarcopenia (n=3), chronic unspecific low back pain (n=4), and osteopenia (n=3). Chronic kidney disease was an eligibility criterion in five WB-EMS trials. Finally, three studies included only critically ill patients, two further studies considered frailty as an inclusion criterion. Of importance, no adverse effects of the WB-EMS intervention were reported. In summary, evidence gaps of WB-EMS research were particular evident for cohorts with diseases of the nervous and cerebrovascular system.

The lengthy maturation period is the key cause of the reduced hot pepper market value. An experiment was performed to assess the effects of R/B/W light qualities on reducing the maturation period. The maturation period was shortened by 16 days under 4R:1B:5W compared to the control. The appearance of the first flower is a limiting factor affecting the maturation period. It exhibited a dark purple color and an abnormal petal under 4R:1B:5W compared to the control, which was associated with increased contents of flavonoids, total organic acids, and phenolics and decreased total amino acid and carbohydrate contents. Plant hormone, flavonoid, ABC transporters, key metabolites (such as amino acid, carbohydrate, organic acid) was associated with first flower development. Ethylene response factors (ERFs) mediated by light, especially ERF021, were identified as potential hub regulators during the development of the first flower due to their involvement in all the associated metabolic pathways.

Universal Stress Protein (USP) plays an important regulatory role in the response to abiotic stress. Most of the research related to USP so far has been conducted on plant models such as Arabidopsis, rice, and cotton. The potato is one of the four major food crops in the world. Therefore, it is of great significance to study the expression pattern of the potato StUSP gene family under abiotic stress conditions. In this study, a total of 108 USP genes were identified from the genome of the Atlantic potato, divided into four subgroups. And based on the genetic structure, the physical and chemical properties of proteins and other aspects of their biological characteristics are comprehensively analyzed. Collinear analysis showed that the homologous genes of StUSPs and four other representative species (Arabidopsis, rice, coyote tobacco, and tomato) were highly conserved. The cis-regulatory elements of the StUSPs promoter are involved in plant hormones, environmental stress, mechanical damage, and light response. RNA-seq analysis showed that under different abiotic stresses, there are differences in the expression patterns of members of each subgroup. WGCNA co-expression analysis of the central gene showed that the differential co-expression gene is mainly involved in the plant-pathogen response process, plant hormone signal transduction, and the biosynthesis process of secondary metabolites. Through qRT-PCR analysis, it was confirmed that StUSP13, StUSP14, StUSP15, and StUSP41 may be important candidate genes involved in the response to adversity stress in potatoes. The results of this study provide the basis for further research on the functional analysis of StUSPs in the potato response to adversity stress.

To support pathologists in breast tumor diagnosis, deep learning plays a crucial role in the development of histological whole slide image (WSI) classification methods. However, automatic classification is challenging due to the high-resolution data and the scarcity of representative training data. To tackle these limitations, we propose a deep learning-based breast tumor gigapixel histological image multi-classifier integrated with a high-resolution data augmentation model to process the entire slide by exploring its local and global information and generating its different synthetic versions. The key idea is to perform classification and augmentation in feature latent space, reducing the computational cost while preserving the class label of the input. We adopt a deep learning-based multi-classification method and evaluate the contribution given by a Conditional Generative Adversarial Network-based data augmentation model on the classifier’s performance for three tumor classes in the BRIGHT Challenge dataset. The proposed method has allowed us to achieve an average F1 equal to 69.5, considering only the WSI dataset of the Challenge. The results are comparable to those obtained by the Challenge winning method (71.6), also trained on the annotated tumor region dataset of the Challenge.

Flax seed is one of the richest plant sources of linolenic acid (LIN) and also contains unsaturated linoleic acid (LIO) and oleic acid (OLE). Stearoyl-ACP desaturases (SAD) and fatty acid desaturases (FAD) play a key role in the synthesis of flax fatty acids (FA). We sequenced flax seed transcriptomes at the 3, 7, 14, 21, and 28 day after flowering (DAF) for ten flax varieties with different oil FA compositions grown under three temperature/watering conditions. Expression levels of 25 genes of SAD, FAD2, and FAD3 families were evaluated. FAD3b, FAD3a, FAD2b-2, SAD3-1, SAD2-1, SAD2-2, SAD3-2, FAD2a-1, and FAD2a-2 had the highest expression levels, which changed significantly during seed development. These genes probably play a key role in the FA synthesis in flax seeds. High temperature and insufficient watering shifted the maximum expression levels of the FAD and SAD genes to earlier development stages, while the opposite trend was observed for low temperature and excessive watering. Differences in FAD and SAD expression profiles under different growth conditions could contribute to the FA composition of linseed oil. Stop codons in the FAD3a gene, resulting in reduced LIN content, decreased the level of the FAD3a transcript. Some difference in reaching the maximum expression level during seed development was observed between 1) SAD3-1, SAD3-2, and FAD2b-2 and 2) SAD2-1, SAD2-2, FAD2a-1, FAD2a-2, FAD3a, and FAD3b. These groups possibly contribute somewhat differently to the synthesis of FA at different development stages.

Trichothecene mycotoxin T-2 toxin is an important environmental pollutant and poses a global threat to human and animal health. T-2 toxin could induce nephrotoxicity, however, the precise molecular mechanism remains unclear. In this study, the mice were intraperitoneally administrated with a single dose of 2 mg/kg T-2 toxin. The kidney function and ultrastructural observation were also assessed and found T-2 toxin exposure could cause kidney damage. Transmission electron microscopy showed a significant swelling and vacuolization of the mitochondria of renal cell. A total of 1122, 58, and 391 differential expression genes (DEGs) that were predominantly expressed in kidney tissues at 1 d, 3 d, and 7 d after T-2 toxin exposure, respectively. Early transcriptomic changes at 1 d after exposure were down-regulation of DEGs involved in the cell cycle, p53 signaling pathway, and cellular senescence, while up-regulation of DEGs referred to the ribosome pathway. The temporal variations in gene expression pattern in T-2 toxin exposure in mice kidney were presented and cellular metabolism was disturbed at the exposure recovery period with 7 d. In conclusion, this study, for the first time, provided a comprehensive comparative transcriptomic analysis of gene regulation in T-2 toxin exposure-induced nephrotoxicity at different temporal periods and explored the nephrotoxicity mechanism of T-2 toxin at the mRNA level.

REV-ERBα and its paralog, REV-ERBβ encoded by NR1D1 and NR1D2 genes, are key nuclear receptors that link the circadian timing system and metabolic homeostasis. Since heme is an endogenous ligand, REV-ERBs have been considered key components of the circadian molecular clock that can be pharmacologically targeted to treat various circadian rhythm-related diseases, such as cardiometabolic, inflammatory, and neuropsychiatric diseases, as well as cancer. REV-ERBs are believed to be functionally redundant and compensatory, although they often affect the expression of gene subsets in an isoform-specific manner. Therefore, this study aimed to identify the redundant and distinct roles of each isoform in controlling its target genes by comparing the transcriptome profiles of a panel of mutant U2OS human osteosarcoma cells in which either NR1D1 or NR1D2 was ablated. Indeed, our transcriptomic analyses revealed that most REV-ERB-regulated genes were controlled by redundant or even additive actions. However, the RNA expression profiles of each single mutant cell line also provided strong evidence for isoform-dependent actions. For example, REV-ERBα were more responsible for regulating the NF-κΒ signaling pathway, whereas a group of extracellular matrix components required REV-ERBβ to maintain their expression. We found that REV-ERBs have isoform-selective functions in the regulation of certain circadian output pathways, despite their overlapping roles in the circadian molecular clock. Thus, the development of isoform-selective REV-ERB modulators may help treat metabolic disturbances and certain types of cancer.

In recent years, magnetic fields have emerged as a non-thermophysical treatment with a signifi-cant impact on microbial fermentation processes. Brassica trispora is a microorganism known for its indus-trial-scale production of lycopene and high yield of single cells. This study aimed to in-vestigate the impact of low frequency magnetic fields on lycopene synthesis by Brassica trispora and elucidate the underlying mechanism for enhancing lycopene yield. The results indicated that both the intensity and duration of the magnetic field treatment influenced the cell. Exposing the cell to a 0.5 mT magnetic field for 48 hours on the second day of fermentation resulted in a lyco-pene yield of 1473.16 mg/L, representing a re-markable increase of 216.1% compared to the con-trol group. Transcriptome analysis revealed that al-ternating magnetic field significantly up-regulated genes related to ROS and cell membrane structure, leading to a substantial increase in lycopene production. Scanning electron microscopy revealed that the magnetic field treatment resulted in rough, loose, wrinkled surface morphology of the mycelium, along with a few mi-cropores, thereby altering the cell membrane permeability to some extent. Moreover, there was a significant increase in intracellular ROS content, cell membrane permeability, key enzyme activi-ty involved in lycopene metabolism, and ROS-related enzyme activity. In conclusion, the alter-nating fre-quency magnetic field can activate a self-protective mechanism that enhances lyco-pene synthesis by modulating intracellular ROS content and cell membrane structure. These find-ings not only deepen our understanding of the impact of magnetic fields on microbial growth and metabolism but also provide valuable insights for developing innovative approaches to en-hance carotenoid fermentation.

Sarcomas are a heterogenous group of tumours that commonly carry poor prognosis with limited therapeutic options. Adolescents and young adults (AYA) with sarcoma are a unique and under-studied patient population that have only achieved modest survival gains compared to other groups. We present our institutional experience of AYA with sarcoma who underwent comprehensive molecular profiling (CMP) using either large-panel targeted DNA sequencing or whole genome and transcriptome sequencing and evaluated the feasibility and clinical impact of this approach. Genomic variants detected were determined to be clinically relevant and actionable following the Molecular Tumour Board evaluation. Clinicians provided feedback regarding the utility of testing three months after reporting. Twenty-five patients who were recruited for CMP are included in this analysis. The median time from consent to final molecular report was 45 days (interquartile range 37-57). Potentially actionable variants were detected for 14 patients (56%) and new treatment recommendations were identified for 12 patients (48%). Pathogenic germline variants were identified in three patients (12%), and one patient had a change of diagnosis. Implementation for CMP for AYA with sarcoma is clinically valuable, feasible and should be increasingly integrated into routine clinical practice as technologies and turnaround times continue to improve.

Pollination in angiosperms depends on a complex communication between pollen grains and stigmas, classified as wet or dry, depending on the presence or absence of secretions at the stigma surface, respectively. In species with wet stigma, the cuticle is disrupted and the presence of exudates is indicative of their receptivity. Most stigma studies are focused on few species and families, many of them with self-incompatibility systems. However, there is scarce knowledge about the stigma composition in Fabaceae, the third angiosperm family, whose stigmas have been classified as semidry. Here we report the first transcriptome profiling and DEGs of Vicia faba L. styles and stigmas from autofertile (flowers able to self-fertilize in absence of manipulation whose exudate is released spontaneously) and autosterile (flowers that need to be manipulated to break the cuticle and release the exudates to be receptive) inbred lines. From the 76,269 contigs obtained from the de novo assembly, only 45,1% of the sequences were annotated with at least one GO term. A total of 115,920, 75,489 and 70,801 annotations were assigned to Biological Process (BP), Cellular Component (CC) and Molecular Function (MF) categories, respectively and 5,918 differentially expressed genes (DEGs) were identified between the autofertile and the autosterile lines. Among the most enriched metabolic pathways in the DEGs subset were those related with aminoacid biosynthesis, terpenoid metabolism or signal transduction. Some DEGs have been related with previous QTLs identified for autofertility traits, and their putative functions are discussed. Results derived from this work provides an important transcriptomic reference for style-stigma processes to aid understanding of the molecular mechanisms involved in faba bean fertilization.

Tyrosyl-DNA phosphodiesterase 1 (TDP1) is a human DNA repair protein. It is a member of the phospholipase D family based on the structure similarity. TDP1 is a key enzyme involved in repairing stalled topoisomerase 1 (TOP1)-DNA complexes. Previously we obtained with the CRISPR/Cas9 method HEK293A cells with the homozygous knockout of the Tdp1 gene and used knockout cells as a cellular model for studying the mechanisms of anticancer therapy. In this work we studied for the first time by transcriptomic analysis the effect of Tdp1 gene knockout on genes expression changes in human HEK293A cell line. We received original data that may indicate a role of TDP1 in other process besides repair of DNA-TOP1 complex. The differentially expressed genes (DEGs) analysis revealed that TDP1 could be involved in different processes such as cell adhesion and communication, spermatogenesis, mitochondrial function, neurodegeneration, cytokine response, and MAPK pathway signaling.

The infections caused by various bacterial pathogens both in clinical and community settings represent a significant threat to public healthcare worldwide. The growing resistance to antimicrobial drugs acquired by bacterial species causing healthcare-associated infections has already become a life-threatening danger noticed by the World Health Organization. Several groups or lineages of bacterial isolates usually called ‘the clones of high risk’ often drive the spread of resistance within particular species. Thus, it is vitally important to reveal and track the spread of such clones and the mechanisms by which they acquire antibiotic resistance and enhance their survival skills. Currently, the analysis of whole genome sequences for bacterial isolates of interest is increasingly used for these purposes, including epidemiological surveillance and developing of spread prevention measures. However, the availability and uniformity of the data derived from the genomic sequences often represents a bottleneck for such investigations. In this dataset, we present the results of a comprehensive genomic epidemiology analysis of 17,546 genomes of a dangerous bacterial pathogen Acinetobacter baumannii. Important typing information including multilocus sequence typing (MLST)-based sequence types (STs), intrinsic blaOXA-51-like gene variants, capsular (KL) and oligosaccharide (OCL) types, CRISPR-Cas systems, and cgMLST profiles are presented, as well as the assignment of particular isolates to nine known international clones of high risk. The presence of antimicrobial resistance genes within the genomes is also reported. These data will be useful for researchers in the field of A. baumannii genomic epidemiology, resistance analysis and prevention measure development.

Trio-based exome sequencing and high-resolution HLA typing were employed to analyze three patients with autoimmune adrenal insufficiency (AAI), including those with autoimmune polyglandular syndrome (APS) type 2, as well as their parents. Benign or likely benign variants of the AIRE gene were identified in all participants of the study. These variants, coupled with clinical data and the results of antibody studies to type I interferons, helped to exclude APS-1. Patients with APS-2, in contrast to patient with AAI, inherited distinct variants of unknown significance in the CLEC16A gene, which is associated with autoimmune diseases including AAI. Various risk alleles in other genes associated with autoimmunity were identified in all patients. HLA typing of second class loci revealed alleles related to APS types 2, 3, and 4. Nevertheless, the frequencies of the haplotypes identified are substantial in the healthy Russian population, precluding from regarding these alleles as genetic determinants linked to APS development. Immunological examination can detect antibody carriers and predict the risk of autoimmune disease development. In the future, to identify genetic predictors of autoimmune endocrinopathies, it is recommended to analyze the whole genome of patients and their relatives, examining clinically relevant variants in non-coding regions.

Goji berries, long valued in Chinese medicine and cuisine for their wide range of medicinal benefits, are considered a 'superfruit' and functional food. Out of the nearly 100 Lycium species known for their genetic diversity, L. barbarum and L. chinense currently dominate the market. Due to increasing market demand and concerns about food safety and sustainability, Europe and the Americas are expanding the local goji berry production, using as starting material plants originated from China. European breeding programs are focusing on Lycium to develop varieties adapted to local conditions, especially in response to climate change. By 2023, Romania registered seven goji berry varieties, both from L. barbarum and L. chinense species, without incorporating local germplasm. Advanced genomic studies, including NGS sequencing of five cultivated and three wild goji berry plant genomes, have been conducted to analyse their genetic variation, with a particular focus on the BODYGUARD 3 and 4 genes. This research uncovered significant differences between cultivated and wild genotypes, both in the entire genome and specifically in the BODYGUARD genes, providing crucial insights for goji berry breeders to support the development of goji berry cultivation in Romania.

Parkinson's disease (PD) stands as the most prevalent degenerative movement disorder, characterized by the loss of dopaminergic neurons in the substantia nigra of the midbrain. In this study, we assessed the transcriptome by analyzing post-mortem mRNA extracted from the substantia nigra of individuals with PD and healthy controls. A total of 16,148 transcripts were identified, with 92 mRNAs displaying differential expression between PD and control groups. Specifically, 33 mRNAs were significantly upregulated, while 59 mRNAs were downregulated in PD compared to controls. The identification of statistically significant signaling pathways, with an adjusted p-value threshold of 0.05, unveiled noteworthy insights. Particularly, enriched categories included cardiac muscle contraction (involving genes such as ATPase Na+/K+ transporting subunit beta 2 (ATP1B2), solute carrier family 8 member A1 (SLC8A1), and cytochrome c oxidase subunit II (COX2)), GABAergic synapse (involving GABA type A receptor-associated protein like 1 (GABARAPL1), G protein subunit beta 5 (GNB5), and solute carrier family 38 member 2 (SLC38A2)), autophagy (involving GABARAPL1 and tumor protein p53-inducible nuclear protein 2 (TP53INP2)), and Fc gamma R-mediated phagocytosis (involving amphiphysin (AMPH)). These findings uncover new pathophysiological dimensions underlying PD, including the involvement of cardiac muscle contraction and specific mitochondrial activity. This knowledge not only contributes to better diagnostic precision but also paves the way for the development of new targeted therapies.Keywords: mRNAs; RNA sequencing; Parkinson’s disease; transcriptome analysis; substantia nigra

In order to investigate both the physiological and molecular mechanisms underlying the impacts of organic selenium and nano-selenium on drought stress of Pak Choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), we measured photosynthetic pigment, antioxidant, nutritional quality, and performed transcriptome sequencing of leaves using RNA-seq technology. Under drought conditions, the beneficial effects of organic selenium and nano-selenium on weight and quality of ‘Suzhouqing’ were primarily manifested in the following aspects. Firstly, there was an enhancement in photosynthetic capacity through upregulation of light-trapping pigment proteins: Lhca1, Lhca2, Lhca3, Lhca4, Lhcb1, Lhcb2, Lhcb3, Lhcb4 and Lhcb5. Secondly, effective regulation of reactive oxygen species homeostasis was achieved by activating the antioxidant system via up-regulation of glutathione S-transferase. Thirdly, water homeostasis was maintained through glutathione oxidase activity. Lastly, increased expression levels of ABC transporter, adenylate kinase and cysteine desulphurase contributed to elevated total selenium content. In addition, we screened hub core genes related to the above key metabolic pathways through Weighted Gene Co-expression Network Analysis. Since the results were consistent with the up-regulated genes identified in the Kyoto Encyclopedia of Genes and Genomes pathway of differentially expressed genes by transcriptome sequencing analysis, this confirms the accuracy and reliability of the transcriptome sequencing data.

Innovative strategies to control malaria are urgently needed. Exploring the interplay between the Plasmodium sp. parasites and host red blood cells (RBC) offers opportunities for novel antimalarial interventions. Pyruvate kinase deficiency (PKD), characterized by heightened 2,3-diphosphoglycerate (2,3-DPG) concentration, has been associated with protection against malaria. Elevated 2,3-DPG levels, a specific mammalian metabolite, may hinder glycolysis, prompting us to hypothesize its potential contribution to PKD-mediated protection. We investigated the impact of the extracellular supplementation of 2,3-DPG on the Plasmodium falciparum intraerythrocytic developmental cycle in vitro. Results showed an inhibition of parasite growth, resulting from significantly less progeny from 2,3-DPG-treated parasites. We analyzed differential gene expression and the transcriptomic profile of P. falciparum trophozoites, from in vitro cultures submitted or not submitted to the action of 2,3-DPG, using Nanopore Sequencing Technology. The presence of 2,3-DPG in the culture medium was associated to a significant differential expression of 71 genes, mostly associated to GO terms nucleic acid binding, transcription, or monoatomic anion channel. Further, several genes related to the cell cycle control were downregulated in treated parasites. These findings suggest that the presence of this RBC-specific glycolytic metabolite impact the expression of genes transcribed during the parasite trophozoite stage and the number of merozoites released from individual schizonts, which supports the potential role of 2,3-DPG in the mechanism of protection against malaria by PKD.

Sweetpotato is an important miscellaneous grain crop in China, which is threatened by a variety of diseases and insect pests in the process of cultivation and production. sweetpotato stem rot is one of the common sweetpotato diseases, which seriously affects the yield and quality of sweetpotato. However, there are few studies on the mechanism of resistance to stem rot in sweetpotato. In this study, transcriptome sequencing analysis was carried out on the samples at different stages (T1, T2, T3) of stem rot pathogen infecting Xushu 48, and 44839 (T1-VS-T2), 81436 (T1-VS-T2) and 61932 (T2-VS-T3) differentially expressed genes (DEGs) were obtained. The DEGs were mainly concentrated in Alanine, aspartate and glutamate metabolism (ko00250), Carbon fixation in photosynthetic organisms (ko00710) and Amino sugar and nucleotide sugar metabolism (ko00520) and some candidate genes related to plant pathogen infection, such as receptor-like protein kinase (RLK5, RLK7), LRR receptor-like serine/threonine-protein kinase (SERK1), bHLH137, ERF9, MYB73 and NAC053, were screened. The results of this study provide genetic resources for the research on stem rot resistance of sweetpotato and provide theoretical basis for sweetpotato resistance breeding.

The Developing Countries Vaccine Manufacturing Network coordinated a multi-laboratory study funded by the US National Institute for Innovation in Manufacturing Biopharmaceuticals to assess the performance of the Pertussis Serological Potency Test (PSPT) in the laboratories of seven whole-cell pertussis vaccine (wP) manufacturers and three National Control Laboratories based in Southeast Asian countries. To this end, common protocols for the immunization of mice and serological testing by ELISA were shared with all laboratories. Each laboratory used their own wP vaccines and the reference vaccine routinely used in the regulatory required mouse protection test (MPT) and assayed the products both in the MPT and PSPT. Whereas in all laboratories the PSPT showed decreased serum IgG levels after immunization with sub-potent compared to potent final batches, some issues were encountered during execution of the assay, which prevented drawing of definitive conclusions on assay performance. Nevertheless, the study provided the participants with the opportunity to familiarize themselves with the PSPT protocols and revealed the next steps to be addressed for implementation of the method.

Poa crymophila is a perennial, cold-tolerant, native grass species, widely distributed to the Qing-hai-Tibet Plateau. However, the molecular mechanism behind the cold stress tolerance and role of key regulatory genes and pathways of P. crymophila are poorly understood yet. Therefore, the present study investigated the physiological and transcriptome responses of P. crymophila’s roots, stems, and leaves under cold stress to explore the molecular mechanism of cold tolerance. Results of the present study suggested that cold stress significantly changed the physiologic characteristics of roots, stems, and leaves of P. crymophila. In addition, the transcriptome results showed that 4434, 8793, and 14942 differentially expressed genes (DEGs) were identified in roots, stems, and leaves, respectively; however, 464 DEGs were commonly identified in these three tissues. The Gene On-tology (GO) results showed that a large numbers of DEGs were significantly enriched in the pho-tosynthetic related categories in leaves. In addition, the “response to stimulus” category was sig-nificantly enriched in roots and stems. The Kyoto Encyclopedia of Genes and Genomes (KEGG) results showed that DEGs involved in “phenylpropanoid biosynthesis” were significantly enriched in roots, “photosynthesis” and “circadian rhythm-plant” pathways significantly enriched in stems and leaves, starch and sucrose metabolism, and galactose metabolism were pathways significantly enriched in three tissues. Weighted gene coexpression network analysis (WGCNA) identified Hub genes involved in P. crymophila cold response. This study provides new insights into the molecular mechanisms underlying the cold tolerance of P. crymophila belowground and aboveground tissues. In addition, specific genes involved in Ca2+ signaling, ROS scavenging system, hormones, circadian clock, photosynthesis, and transcription factors (TFs) were identified in P. crymophila. The identi-fication of key genes may provide valuable resources for further functional genomic and breeding studies.

Colorectal cancer is a high-incidence tumor that has a high mortality rate due to its frequent metastasis to the liver. The difference in genes, proteins, and immune microenvironment between the primary and metastatic sites causes them to show different responses to treatment. Colorectal cancer liver metastasis patients also tend to show poorer treatment response and prognosis. Therefore, in this paper, we summarize the heterogeneity exhibited after colorectal cancer liver metastasis from five aspects (gene, transcriptome, protein, metabolism, and immunity), and we found that except for the genetic heterogeneity, the other four aspects exhibite significant heterogeneity, which might serve as a new therapeutic direction and a prognostic marker for patients with liver metastasis. Finally, the therapeutic modalities regarding tumors are rapidly evolving, and we have also summarize the new clinical therapeutic modalities currently proposed based on these heterogeneities, aiming to provide new therapeutic ideas for the clinical treatment of patients with colorectal cancer liver metastases.

Phantom Limb Pain (PLP) is a challenging condition affecting a significant proportion of amputees. In this article we describe the case of a 54-year-old Paralympic athlete with Phantom Limb Syndrome following right leg amputation and widespread sports-related enthesitic pain, who underwent a Whole Body Cryostimulation (WBC) cycle, an emerging treatment known for its rapid pain-relieving and anti-inflammatory effects. Assessments were conducted before and after a 10-session WBC cycle, including pain and quality of life assessment, and use of medications. A substantial reduction in enthesitic pain, PLP intensity, paresthesia, tingling related to atmospheric events and an improved function and quality of life were reported after the WBC cycle and lasted for two weeks. One month after WBC, the enthesitic pain following sports activity and PLP gradually returned but with lesser intensity. Similarly, the stump's sensitivity to atmospheric changes returned but with lower frequency. Pain at night remained lower than before WBC with significantly improved quality of sleep. This case study suggests that WBC could be a valuable adjuvant treatment for alleviating PLP. Controlled studies are warranted to validate the findings of this case-report and elucidate the mechanisms underlying the positive effects of WBC in this condition.

Whole blood viscosity, a hemorheological factor, is currently used for diagnosis, as it is correlated with various vascular diseases that are difficult to diagnose early with a general blood test. It was determined that it was necessary to set reference intervals for further studies and utilization of whole blood viscosity in cats, a representative companion animal, and this study was conducted. 50 healthy cats were recruited for the study and whole blood viscosity, complete blood count, and serum chemistry tests were performed. The reference intervals of whole blood viscosity were 15.169 to 43.684 cP at a shear rate of 1 s-1 reflecting diastole, and 3.524 to 5.544 cP at a shear rate of 300 s-1 reflecting systole. Red blood cells, hematocrit, hemoglobin, white blood cells, and neutrophils in the complete blood count, and total protein, albumin, globulin, and cholesterol in the serum chemistry were significantly correlated with whole blood viscosity. The results of this study set reference intervals of whole blood viscosity for healthy cats in a wide shear rate range that has not yet been fully established and investigated its correlation with other blood indicators.

Research on Cas9 nucleases from different organisms holds great promise for advancing genome engineering and gene therapy tools as it could provide novel structural insights into CRISPR editing mechanisms, expanding its application area in biology and medicine. The current study focuses on generating a construct to express a compact Cas9 nuclease (AnoCas9) from the thermophilic microorganism Anoxybacillus flavithermus. Next, distinctive AnoCas9 properties are investigated. AnoCas9 gene is expressed in E.coli producing a polypeptide fused with the maltose-binding protein (MBP-AnoCas9). His-Tag in its structure enables purification using metal-chelate chromatography followed by the cleavage of the polypeptide by TEV protease. Bioinformatical analysis of the CRISPR array found in the genome of an Anoxybacillus flavithermus strain helps predict a functional PAM sequence for AnoCas9, which is supported by in vitro experiments. The purified protein demonstrates nuclease activity in the presence of crRNA:tracrRNA duplex in the 37-60 °С range, with maximum activity observed at 45-55 °С. The analysis of FAM-labeled dsDNA substrate cleavage has allowed us to determine the functional AnoCas9 PAM motif as 5’-NNNNCDAA-3’. Thus, AnoCas9 adds to the repertoire of thermophilic Cas9 effectors and its properties suggest application in areas requiring the presence of thermostable CRISPR/Cas systems.

Aspergillus montevidensis is an important domesticated fungus that has been applied to produce many traditional fermented foods under high osmotic conditions. However, the detailed mechanisms of tolerance to osmotic stress remain largely unknown. Here, we construct a target-deleted strain (ΔLeuRS) of A. montevidensis and found that the ΔLeuRS mutants grew slowly and suppressed the development of the cleistothecium compared to the wide-type strains (WT) under salt-stressed conditions. Furthermore, differentially expressed genes (P<0.0001) governed by LeuRS were involved in salt tolerance, ABC transporter, amino acid metabolism, sugar metabolism, and reproduction process. The ΔLeuRS strains compared to WT strains under short- and long-term salinity stress especially altered accumulation levels of metabolites, such as amino acids and derivatives, carbohydrates, organic acids, and fatty acids. The study provides new insights into the underlying mechanisms of salinity tolerance and lays a foundation for favor improvement of foods fermented with A. montevidensis.

In this work, we tried to emphasize whole transcriptome expression changes in the Wistar rats brainstem two hours after acute stress. Most of the genes were upregulated. We detected massive shift of neuropeptides Crh, Trh,Cga, Tshb, Uts2b, Tac4, Lep and neuropeptide receptors Hcrtr1, Sstr5, Bdkrb2, Crhr2 signaling, as well as Glutamate Grin3b, Grm2 and GABA Gpr156, Acetylcholine Chrm4,Chrne, Adreno- Adra2b receptors expression uprising. Intensive increase in expression of intermediate filaments Krt83/Krt86/Krt80/Krt84/Krt87/Krt4/Krt76 and motor proteins Myo7a, Klc3 was detected. Remarkably, at this time we also observed signs of microglia activation. Both expression of anti-inflammatory cytokines Il13, Ccl24 and proinflammatory cytokin’s receptors Il9r, Il12rb1, Tnfrsf14, Tnfrsf13c, Tnfrsf25, Tnfrsf1b were increased. In the Wnt signaling pathway, we have seen increased expression of ligands-receptors Wnt1, Wnt11, Ror2, and also negative regulators Notum, Sfrp5, Sost. Also we conducted cDNA libraries normalization with duplex specific nuclease and compared results. On the basis of our RNAseq data, we chose reference genes for RT-qPCR best suitable for experiments with acute stress.

Neptunea cumingii is an economically important marine shellfish found in the Yellow Sea and Bohai Sea areas of China. However, due to environmental factors, such as global warming, Neptunea cumingii resources are in decline along the coast of China. In this study, samples of Neptunea cumingii were collected in Zhangzidao and Yantai during spring, summer， autumn, and winter to clarify the gene expression patterns and regulatory mechanisms in the gills in different seasons. Transcriptome analysis was conducted using Neptunea cumingii gill tissues and genes with significantly different expression levels were extracted for functional verification. The most genes with differences in expression（DEGs） were found in comparisons of the winter and summer samples. Gene enrichment analysis based on Gene Ontology and Kyoto Encyclopedia of Genes and Genomes terms showed that these DEGs were mainly involved in immune and metabolic pathways, and they had significant effects on oxidative stress, body metabolism, and protein synthesis in Neptunea cumingii. Further screening of DEGs identified 34 genes related to temperature regulation comprising 13 genes with roles in innate immunity in shellfish, 12 genes related to oxidative stress, and nine genes related to protein synthesis and energy metabolism. Eleven DEGs were randomly selected for qPCR verification and the results were consistent with the transcriptome analysis results. In summary, the transcriptome results differed significantly between seasons in the gill tissues of Neptunea cumingii. The expression levels of immune regulatory genes could be promoted in Neptunea cumingii during the high temperature season, whereas the expression of these genes may be inhibited in the low temperature season. The results obtained in this study provide insights into the molecular defense mechanisms that might allow Neptunea cumingii to adapt to climate change.

Bacillus subtilis NCD-2 showed a promising biocontrol effect against plant soil-borne diseases, and was developed as a commercial microbial fungicide against cotton verticillium wilt in China. Spores were main ingredient of the fungicide and played the crucial role in biological control of plant diseases. Therefore, the key to reducing the cost of fungicide was to find ways to increase the number of spores of strain NCD-2 during fermentation. In this study, 755 substances were evaluated by Phenotype Microarray technology, and 5 kinds of carbon sources and 1 kind of nitrogen source were found to promote the metabolism of strain NCD-2. Among carbon sources L-arabinose showed strongest ability to promote the bacteria growth and sporulation of strain NCD-2. When L-arabinose was used as a single carbon source, it could increase the bacteria concentration and the sporulation efficiency of strain NCD-2 by 2.04 times and 1.99 times, respectively, compared with D-glucose. Moreover, L-arabinose could significantly decrease the autolysis of strain NCD-2 revealed by microscopy observation. The mechanism for promoting the sporulation by L-arabinose was analysed by RNA-seq sequencing. Results showed that total of 790, 923 and 1270 genes were up-regulated and 639, 850 and 1001 genes were down-regulated under L-arabinose supplies when cultured at 8 h, 12 h and 16 h, respectively. Fourteen differentially expressed genes associated with arabinose transportation and sporulation were selected for qRT-PCR analysis, and the result showed basically consistent expression trend with transcriptome. Notably, genes associated with arabinose metabolism, sporulation, spore resistance to heat and spore coat formation were significantly up-regulated, and genes associated with sporulation-delaying protein were significantly down-regulated under L-arabinose supplies. msmX gene which was involved in arabinose transport in Bacillus genus was deleted, and the mutant decreased the growth and sporulation by 53.71% and 86.46%, respectively, when compared to strain NCD-2 wild type. Complementary of the mutant by importing intact msmX gene could restore the growth and sporulation of the mutant strain. In conclusion, arabinose played an important role in regulating the growth and sporulation of strain NCD-2.

Background: Post-Covid condition can reduce activity and quality of life, resulting in a significant socioeconomic and health burden. Understanding its impact on patients' health is important for the development of personalized rehabilitation interventions. An independent association between obesity and post-covid condition was found because of complications and comorbidities. Methods: Sixteen patients with obesity and post-COVID symptoms (i.e., dyspnea, pain, poor sleep quality, muscle fatigue) admitted to the Istituto Auxologico Italiano, Piancavallo (VB), Italy, were recruited for a four-week rehabilitation program including conventional exercise therapy, nutritional intervention, psychological support and whole-body cryostimulation (WBC). Results: All participants attended all sessions of the program. Anthropometric data showed statistically significant changes in weight, waist circumference and body mass index. Biochemical analyses showed significant reductions in lipid and inflammatory profiles. There was a significant improvement in physical performance, reduction in pain and improvement in psychological well-being. Conclusion: A multidisciplinary rehabilitation protocol including WBC designed for patients with obesity and post-covid condition is safe and feasible. The overall improvements demonstrate that multidisciplinary rehabilitation was effective on post COVID patients and suggest that the use of WBC is safe and could play a role as a booster in rehabilitation programs.

Multidrug resistance (MDR) among gram-negative bacteria is a global public health threat because it has exhausted all standard therapeutic options. This has necessitated clinicians to reconsider colistin, an “old sort” antibiotic which was deemed toxic for clinical use. Unfortunately, swift resistance towards colistin by K. pneumoniae has been reported in different parts of the world. The study aimed at investigating the genetic determinants of colistin resistance in K. pneumoniae isolated from patients admitted in a tertiary care hospital in Kampala, Uganda. 31 archived multidrug resistant K. pneumoniae isolates obtained from rectal swabs of patients admitted to the Mulago Hospital ICU were retrieved. From this collection, we selected 7 colistin resistant K. pneumoniae isolates for whole genome sequencing and molecular profile analysis. In silico sequence data analyses were performed using established web-based bioinformatics tools. The sequence analysis of the genes involved in colistin resistance revealed several non-synonymous mutations in nucleotide sequences of pmrA, pmrB, phoP, phoQ and mgrB genes. Insertion transposase genes for the insertion sequences IS1 and IS5 which are highly implicated in colistin resistance via modification or inactivation of mgrB gene were identified in all isolates and were located in the chromosomal DNA at different genomic positions. No plasmid-borne mcr genes were detected. More so, the strains harbored numerous multidrug resistant genes. This study underscores the need of genomic surveillance of K. pneumoniae strains to limit further spread of colistin resistance genes to avert the potential risk of pandrug resistance. And high throughput sequencing is imperative.

Since severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was first reported in Wuhan, China in December 2019, it has spread rapidly, and many coronavirus disease (COVID-19) cases have occurred in Gwangju, South Korea. Viral mutations following the COVID-19 epidemic have increased interest in the characteristics of epidemics in this region, and pathogen genetic analysis is required for infection control and prevention. In this study, SARS-CoV-2 whole-genome analysis was performed on samples from patients with COVID-19 in Gwangju from 2020 to 2022 to identify the trends in COVID-19 prevalence and to analyze the phylogenetic tree of dominant variants. B.41 and B.1.497 prevailed in 2020, the early stage of the COVID-19 outbreak; then, B.1.619.1 mainly occurred until June 2021. B.1.617.2, classified as sublineage AY.69 and AY.122, occurred continuously from July to December 2021. Since strict measures to strengthen national quarantine management had been implemented in South Korea until this time, mutations phylogenetic analysis was also able to infer the epidemiological relationship between infection transmission routes. Since the first identification of the Omicron variant in late December 2021, the spread of infection has been very rapid, and weekly whole-genome analysis of specimens has enabled us to monitor new Omicron sublineage occurring in Gwangju. Our study suggests that conducting reginal surveillance in addition to nation-level genomic surveillance will enable more rapid and detailed variant surveillance, which will be helpful in the overall prevention and management of infectious diseases.

Background: This prospective study assesses the use of Rapid Remote Online Cytological Evaluation analysis for diagnosing endoscopical achieved biopsies. It focuses on its effectiveness in identifying benign and malignant conditions using digital image processing. Methods: The study was conducted between April 2021 and September 2022 and involved a total of 314 Rapid Remote Online Cytological Evaluations (17 brush, 143 fine needle aspirations and 154 imprint cytologies) analyses performed on 239 patients at the LungenClinic Grosshansdorf. During on-site evaluation via telecytology, the time requirement was determined and the findings were compared with the cyto-/histological and final diagnoses. Results: By means of Rapid Remote Online Evaluation, 86 cytological benign and 190 malignant and 38 findings of unclear diagnosis were recorded (Ø assessment time 100 sec., range 11 - 370sec.). In 27 of the 38 cases with unclear diagnosis, the final findings were malignant tumours and only 6 were benign changes. The diagnosis of another five of these 38 cases remained unclear. Excluding these 38 findings, the Rapid Remote online cytology achieved a sensitivity of 78.6% with a specificity of 99.5% and a correct classification rate of 93.1% with regard to the final diagnosis of all cases. As expected, an increase in the sensitivity rate for the cytological detection of malignant tumours (76.1% vs. 92.5%) was found especially in fine-needle aspirations. Conclusions: Rapid remote online analysis allows fast quantitative and qualitative evaluation of clinically obtained cytological specimens. With a correct classification rate of more than 93%, sampling deficiencies can be corrected promptly and diagnostic and therapeutic approaches can be derived.

Functional neurological disorders (FND) are relatively frequent disabling conditions. Given their complexity, multidisciplinary rehabilitation is envisaged. Whole-body cryostimulation (WBC) represents a promising adjuvant treatment, mainly because of its anti-inflammatory and exercise-mimicking effects. Here, we propose a novel use of WBC in a wheelchair-ridden 61-year-old woman diagnosed with FND and other comorbidities, who, after several therapeutic and rehabilitation failures, underwent a multidisciplinary rehabilitation program including WBC. The 4-week program included physiotherapy, nutritional intervention, psychological support, and WBC. Questionnaires to assess disease impact, pain level, perceived fatigue and sleep quality were administered. At discharge, improvements in body composition, haematological biomarkers, physical performance, and questionnaire scores were observed. The patient was able to walk with a walker for medium distances, even outdoors. We observed unprecedented improvements, particularly in functional parameters and questionnaire scores. Although we cannot ascertain to which extent WBC per se contributed to the improvements measured, subjective reporting and our clinical observation were that WBC, the only intervention not previously experienced by the patient, acted as a booster for the rehabilitation interventions. Further research will be necessary to rule out any possible placebo effect and to assess the effects of WBC on FND.

Ornamental kale (Brassica oleracea var. acephala) is an attractive ornamental plant with a range of leaf colors and shapes. Breeding new varieties of ornamental kale has proven challenging due to its lengthy breeding cycle and the limited availability of genetic markers. Microspore culture is an effective approach to generate new materials and genetic maps are a prerequisite for quantitative trait loci analysis, MAS, fine gene mapping, and genome sequence assembly. In this study, a F1DH ornamental kale population comprising 300 DH lines was constructed using microspore culture. A high-density genetic map was developed by conducting whole-genome sequencing on 150 individuals from the F1DH population. The genetic map contained 1,696 bin-markers with 982,642 single-nucleotide polymorphisms (SNPs) spanning a total distance of 775.81 cM on all nine chromosomes with an average distance between markers of 0.46 cM. The ornamental kale genetic map contained substantially more SNP markers compared with published genetic maps for other B. oleracea crops. The F1DH progenies provide an excellent resource for germplasm innovation and breeding new varieties of ornamental kale. The high-density genetic map provides crucial insights for gene mapping and unraveling the molecular mechanisms behind important agronomic traits in ornamental kale.

In recent years, frequent occurrences of low temperature disasters due to global climate change have significantly impacted the normal growth of crops. Research has indicated that inorganic selenium (which is more toxic) can not only enhance the effects of low temperature stress but also increase selenium content on plants; however, there is a scarcity of studies investigating the impacts of organic selenium and nano-selenium on crops. In order to investigate whether organic selenium and nano-selenium can enhance low-temperature tolerance and increase selenium content in pak choi (Brassica chinensis var. pekinensis. cv. ‘Suzhouqing’), different concentrations (0, 5, 10, 20 mg L-1) of exogenous selenium were applied in this experiment to assess their effects on plant growth, nutritional quality and antioxidant properties. RNA-Seq technology was used to sequence the transcriptome of the leaves. Based on the transcriptome data, a Weighted Gene Co-expression Network Analysis (WGCNA) was employed to construct a network that associates with physiological traits related to stress resistance. Two highly correlated gene co-expression modules were identified, and within them, nine hub genes associated with endocytosis, antioxidant stress, absorption, transport, and metabolism of selenium were discovered. The results indicated that the beneficial effects on yield and total selenium content under low temperature were attributed to (1) protection of photosynthetic pigments for enhancing photosynthetic capacity by the up-regulation of LHca2, LHcb1, LHca1, LHcb4 in KEGG pathway: photosynthesis-antenna proteins; (2) activation of antioxidant system for efficient ROS homeostasis such as SOD, POD and CAT by the genes such as Superoxide dismutase, Monodehydroascorbate and (3) selenium absorption by endocytosis, seleninum transportation by ABC transporter gene family and selenium metabolism related genes such as Cysteine synthase, Glutaredoxin. These findings provide a foundation for further investigation into the molecular mechanisms underlying the effects of organic selenium and nano-selenium on cyanochloride production at low temperatures.

Cancer researchers are fascinated by the chemistry of diverse natural products which show exciting potential as anticancer agents. In this study, we aimed to investigate the anticancer properties of watermelon rind extract (WRE) by examining its effects on cell proliferation, apoptosis, senescence, and global gene expression in human renal cell adenocarcinoma cells (HRAC-769-P) in vitro. Our metabolome data analysis of WRE exhibited untargeted phyto-constituents and targeted citrulline (22.29 µg/mg). HRAC-769-P cells were cultured in RPMI-1640 media and treated with 22.4, 44.8, 67.2, 88.6, 112, 134.4, and 156.8 mg mL-1 for 24, 48, and 72 hrs. At 24 hrs after treatment, (88.6 mg ml-1 of WRE) cell proliferation significantly reduced, more than 34% compared to the control. Cell viability decreased 48 and 72 hours after treatment to 45% and 37%, respectively. We also examined poly caspase, SA-beta-galactosidase (SA-beta-gal), and wound healing activities using WRE. All treatments induced an early poly caspase response and a significant reduction in cell migration. Further, we analyzed the transcript profile of the cells grown at 44.8 mg ml-1 of WRE after 6 hours using RNA sequencing (RNAseq) analysis. We identified 186 differentially expressed genes (DEGs), including 149 upregulated genes and 37 downregulated genes, in cells treated with WRE compared to the control. The differentially expressed genes were associated with NF-Kappa B signaling and TNF pathways. Crucial apoptosis-related genes such as BMF, NPTX1, NFKBIA, NFKBIE, and NFKBID might induce intrinsic and extrinsic apoptosis. Another possible mechanism is a high quantity of citrulline may lead to induction of apoptosis by the production of increased nitric oxide. Hence, our study suggests the potential anticancer properties of WRE and provides insights into its effects on cellular processes and gene expression in HRAC-769-P cells.

Vancomisin resistant enterococcus(VRE), is a resistant microorganism which colonizates and causes infections in hospitalized patients. It was aimed to show the spread of vancomycin-resistant Enterococcus (fVREfm) step-by-step in all intensive care units, which started with the growth of vancomycin-resistant Enterococcus faecium (VREfm) on 02.12.2021 in the blood culture of a patient hospitalized in the anesthesia intensive care unit of our hospital and was found to have reached epidemic size in the surveys. Rectal swab samples were taken from all patients hospitalized in intensive care units, VRE colonization was determined and the VanA and VanB resistance genes associated with vancomycin resistance of VREfm isolates were determined by PCR method, and clonal association analysis was performed by Arbitrarily Primed-PCR (AP-PCR) and Pulsed-Field Gel Electrophoresis. In our study, VRE was detected in 61 of 2601 rectal swab samples. 54 (85.52%) of the VRE isolates were Enterococcus faecium, 3 (4.91%) was Enterococcus faecalis, 3 (4.91%) was Enterococcus gallinorum, 1 (1.63%) was Enterococcus casseliflavus. It was determined that all of the 54 VREfm isolates, which were the most detected among all VRE isolates, carried the vanA gene. In the clonal association analysis of the isolates by AP-PCR and PFGE methods, it was found that they had 12 different genotypes, 48 of them were included in any cluster, the clustering rate was 88.8%, and the largest cluster was genotype 1 cluster with 36 isolates. Of the 54 patients with VREfm isolated recently, 18.51 percent of the clinical samples were isolated before the survey, and 9.24% were isolated after the survey. It was determined that 100% of VREfm isolates were resistant to ampicillin, levofloxacin, ciprofloxacin, high-level gentamicin, trimethoprim-sulfamethoxazole, teicoplanin, 7.4% to tigecycline and 1.85% to linezolid. In our study, in the clonal association analysis performed by isolating VREfm in rectal swab samples, it was found that 88.8% of the samples were indistinguishably similar and the increase in the number of VREfm infections after the index case in our hospital was associated with the epidemic. VREfm infections cause long term hospitalization, costs and also deaths, which shows the seriousness of the event, and the importance of the combination of epidemiological and molecular analysis in epidemic research.

Listerias of the phylogenetic lineage II (PLII) are common in the European environment, and are hypovirulent. Despite this, they caused more than a third of sporadic cases of listeriosis, and multi-country foodborne outbreaks. L. monocytogenes ST37 is one of them. During the COVID-19 pandemic ST37 appeared in the clinical cases and ranked second in occurrence among food isolates in the Moscow region. The aim of this study was to describe the genomic features of ST37 isolates from different sources. All clinical cases of ST37 were in the cohort of male patients (age, 48-81 years) with meningitis-septicemia manifestation, and COVID-19 or Influenza in the anamnesis. The core genomes of the fish isolates were closely related. The clinical and meat isolates revealed a large diversity. Prophages (2-4/genome) were the source of the unique genes. Two clinical isolates displayed the pseudolysogeny, and excided prophages were A006-like. Absence of the plasmids, the assortment of virulence factors and resistance determinants in chromosome corresponded to the hypovirulent characteristics. However, all clinical isolates caused severe disease with deaths in four cases. Thus, these studies allow us to speculate that a previous viral infection increases a human susceptibility to listeriosis.

Monoclonal antibodies (mAbs) are an important treatment option for COVID-19 caused by SARS-CoV-2, especially in immunosuppressed patients. However, this treatment option can become ineffective due to mutations in the SARS-CoV-2 genome, mainly in the receptor binding domain (RBD) of the spike (S) protein. In the present study 7950 SARS-CoV-2 positive samples from the Uppsala and Örebro regions of central Sweden collected between March 2022 and May 2023 were whole-genome sequenced using next-generation sequencing, mainly with the Nanopore sequencing method. Pango lineages were determined and all single nucleotide polymorphism (SNP) mutations that occurred in these samples were identified. The dominant sublineages changed over time and mutations conferring resistance to currently available mAbs became common. Notable ones are R346T and K444T mutations in the RBD that confer significant resistance against tixagevimab and cilgavimab mAbs. Further, mutations conferring a high-fold resistance to bebtelovimab, such as the K444T and V445P mutations, were also observed in the samples. This study highlights that resistance mutations have over time rendered currently available mAbs ineffective against SARS-CoV-2 in most patients. Therefore, there is a need for continued surveillance of resistance mutations and the development of new mAbs that target more conserved regions of the RBD.

Pigs are susceptible to cold stress due to the absence of brown fat caused by the partial deletion of uncoupling protein 1 during their evolution. Some local pig breeds in China, exhibit potential cold adaptability, but research has primarily focused on fat and intestinal tissues. Skeletal muscle plays a key role in adaptive thermogenesis in mammals, yet the molecular mechanism of cold adaptation in porcine skeletal muscle remains poorly understood. This study investigated the cold adaptability of two pig breeds, Mashen pigs (MS) and Large White pigs (LW), in a 4-day cold (4°C) or room temperature (25°C) environment. We recorded phenotypic changes and collected blood, and longissimus dorsi muscle for transcriptome sequencing. Finally, a candidate gene was randomly selected for functional exploration in porcine skeletal muscle satellite cells. A decrease in body temperature and body weight in both LW and MS pigs under cold stress, accompanied by increased shivering frequency and respiratory frequency. However, MS pigs demonstrated stable physiological homeostasis, indicating a certain level of cold adaptability. LW pigs primarily responded to cold stress by regulating heat production and Glycolipid energy metabolism. MS pigs exhibited a distinct response to cold stress, involving regulation of heat production, energy metabolism pathways, robust fatty acid oxidation ability, and stronger immune response. Furthermore, the functional exploration of PRSS8 in porcine skeletal muscle satellite cells revealed it affected cellular energy metabolism and thermogenesis by regulating ERK phosphorylation. These findings shed light on the diverse transcriptional responses of skeletal muscle in LW and MS pigs under cold stress, offering valuable insights into the molecular mechanisms underlying cold adaptation in pigs.

Alternative splicing (AS) is a gene regulatory mechanism modulating gene expression in multiple ways. AS is prevalent in all eukaryotes including plants. AS generates two or more mRNAs from the precursor mRNA (pre-mRNA) to regulate transcriptome complexity and proteome diversity. Advances in next-generation sequencing, omics technology and bioinformatics tools, and computational methods provide new opportunities to quantify and visualize AS-based quantitative trait variation associated with plant growth, development, reproduction, and stress tolerance. Domestication, polyploidization and environmental perturbation may evolve novel splicing variants associated with agronomically beneficial traits. To date, pre-mRNAs from many genes are spliced into multiple transcripts that cause phenotypic variation for complex traits, both in model plant Arabidopsis and field crops. Cataloguing and exploiting such variation may provide new paths to enhance climate resilience, resource-use efficiency, productivity, and nutritional quality of staple food crops. This review provides insights into AS variation alongside gene expression analysis to select for novel phenotypic diversity for use in breeding programs. AS contributes to heterosis, enhances plant symbiosis (mycorrhiza and rhizobium), and provides a mechanistic link between the core clock genes and diverse environmental clues.

The genome sequencing technologies reveal the molecular mechanisms of differentiated thyroid cancer (DTC). Unlike somatic mutation analysis from thyroidectomy samples, germline mutations showing genetic susceptibility to DTC are less understood. The study aimed to assess the prevalence of germline mutations predisposing to DTC in a cohort of Polish individuals based on their whole genome sequencing (WGS) data. We analyzed sequencing data from 1076 unrelated individuals, released openly for academic and clinical research as The Thousand Polish Genomes database (https://1000polishgenomes.com). The list of genes chosen for further analysis was based on the review of previous studies. The cohort contained 104 variants located within the coding and noncoding DNA sequences of 90 genes selected by ClinVar classification as pathogenic and potentially pathogenic. The frequency of variants in the Polish cohort (our study) was compared to the frequency estimated for the non-Finnish European population, obtained from the gnomAD database (gnomad.broadinstitute.org). Statistically significant variants included 23 genes. Even though the Polish population is genetically similar to other European populations, there are significant differences in variant frequencies contributing to the disease development and progression, such as RET, CHECK2, BRCA1, SLC26A4 or TERT. Further studies are needed to identify genomic variants associated directly with DTC.

Conjugative transposons in Gram-negative bacteria have a significant role in the dissemination of antibiotic-resistance-conferring genes between bacteria. This study aims to genomically characterize plasmids and conjugative transposons carrying integrons in clinical isolates of Klebsiella pneumoniae. Genetic composition of conjugative transposons and phenotypic assessment of 50 multidrug-resistant K. pneumoniae isolates from Tertiary-care Hospital (SQUH), Muscat, Oman was investigated. Horizontal transferability was investigated by filter- mating conjugation experiments. Whole genome sequencing (WGS) was performed to determine the sequence type (ST), acquired resistome and plasmidome of integron-carrying strains. Class 1 integron was detected in 96% of isolates and among integron-positive isolates, 18 stains contained variable regions. Horizontal transferability by conjugation confirmed the successful transfer of integrons between cells and WGS confirmed their presence in conjugative plasmids. Dihydrofolate reductase (dfrA14) was the most prevalent (34.8%) gene cassettes in class 1 integrons. MLST analysis detected predominantly ST-231 and ST-395. BlaOXA-232 and blaCTX-M-15 were the most frequently detected carbapenems and beta-lactamases in sequenced isolates. This study highlighted the high transmissibility of MDR-conferring conjugative plasmids in clinical isolates of K. pneumoniae. Therefore, the wise use of antibiotics and the adherence to effective infection control measures are necessary to limit further dissemination of multidrug-resistant organisms.

Horseshoe crabs represent the most ancestral chelicerate lineage characterized by marine ecology and the possession of lateral compound eyes. While considered living fossils, recent studies reported an unusual number of Pax6 transcription factor genes in the Atlantic horseshoe crab Limulus polyphemus. Pax genes encode a family of ancient metazoan transcription factors, which comprise seven subfamilies. Among these, the members of the Pax6 subfamily confer critical functions in the development of the head, the visual system, and further body plan components. Arthropods are characterized by two Pax6 subfamily homologs that were discovered in Drosophila and named eyeless (ey) and twin of eyeless (toy). However, whole genome sequence searches uncovered three homologs of ey and two homologs of toy in L. polyphemus. These numbers are explained by the occurrence of three whole genome duplications (WGD) in the lineage to the last common ancestor of L. polyphemus and its closely related three additional members of the extant horseshoe crab species cluster. Here we report comparative sequence evidence for the functional conservation of the five L. polyphemus Pax6 transcription factor homologs. Our analyses reveal that all paralogs are conserved in the approximately 135 million-year-old horseshoe crab species cluster and that they evolve under strong purifying selection. These findings identify subfunctionalization as the likeliest post-WGD outcome for the five Pax6 homologs. While awaiting confirmation by gene expression studies, this scenario would reconcile the discrepancy between the WGD-expanded gene repertoires and phenotypic stasis in the horseshoe crabs.

Autophagy is an evolutionarily conserved mechanism for degrading and recycling different cellular components in both normal development and stress conditions. Our recent research demonstrated that autophagy-mediated compartmental cytoplasmic deletion is essential for pollen germination. However, how autophagy regulates pollen germination to ensure its fertility remains largely unknown. Here, we applied multi-omic analyses to investigate the downstream pathways of autophagy in the process of pollen germination. Although ATG2 and ATG5 play similar roles in regulating pollen germination, high-throughput transcriptomic analysis reveals that silencing ATG5 has greater impact on the transcriptome than silencing ATG2. Cross-comparisons of transcriptome and proteome analysis reveal that gene expression at mRNA level and protein level are differentially affected by autophagy. Furthermore, high-throughput metabolomics analysis demonstrates that pathways related amino acid metabolism and aminoacyl-tRNA biosynthesis can be affected by both ATG2 and ATG5 silencing. Collectively, our multi-omic analyses reveal a central role of autophagy in cellular metabolism, which is critical for the initiation of pollen germination and the guarantee of pollen fertility.

Climate change-induced temperature fluctuations pose a significant threat to crop production, particularly in the Southern Hemisphere. This study investigates the transcriptome and physiological responses of rapeseed to post-flowering temperature increases, providing valuable insights into the molecular mechanisms underlying rapeseed tolerance to heat stress. Two rapeseed genotypes, Lumen and Solar, were assessed under control and heat stress conditions in field experiments conducted in Valdivia, Chile. Results showed that seed yield and seed number were negatively affected by heat stress, with genotype-specific responses. Lumen exhibited a 9.3% average seed yield reduction, while Solar showed a 28.7% reduction. RNA-seq analysis of siliques and seeds revealed tissue-specific responses to heat stress, with siliques being more sensitive to temperature stress. Hierarchical clustering analysis identified distinct gene clusters reflecting different aspects of heat stress adaptation in siliques, with a role for protein folding in maintaining silique development and seed quality under high temperature conditions. In seeds, three distinct patterns of heat-responsive gene expression were observed, with genes involved in protein folding and response to heat showing genotype-specific expression. Gene coexpression network analysis revealed major modules for rapeseed yield and quality, as well as the trade-off between seed number and seed weight. Overall, this study contributes to understanding the molecular mechanisms underlying rapeseed tolerance to heat stress and can inform crop improvement strategies targeting yield optimization under changing environmental conditions.

The focus of recent research shifts towards complex ‘whole organism’ responses (i.e., in multiple functional traits) in adaptation to or to defend against stressors under complex environmental conditions. This increasing complexity is challenging to analyse and demands sophisticated tools to drive meaningful conclusions from those data. Trait-based regression models, multivariate analyses, like principal component analyses, and plasticity indices can be used to tackle challenges with those complex investigations. But those methods have substantial limitations, like the need for high sample size, multi-dimensionality of results or the need for trait coordination in high-dimensional space, or the calculation on the population level, which might buffer or cover the de facto occurring individual effects. To improve and simplify studies on ‘whole organism’ responses, analyses, and their interpretation, we developed the Index for Adaptive Responses. This straightforward framework can unite all traits of an organism in one number. A newly developed transformation method, included in this framework, comprises a normalisation and standardisation to a baseline or control without changing the data or variance structure of the original data. We assessed the performance and accuracy of the framework with an application in an extensive predator-prey case study, with simulations and application examples using literature data. We show that the Index for Adaptive Responses respects adaptations as well as maladaptations and outperforms established approaches. The framework is robust against outliers and non-gaussian distribution. We further show that the qualitative prediction of the adaptiveness of included traits is highly accurate, even under challenging conditions, e.g., low replicate numbers. Functions and algorithms of the framework are provided with an R package but can easily be translated into other programming languages. The Index for Adaptive Responses will simplify future research on complex adaptive responses and improves our understanding of these responses’ ecological as well as evolutionary implications.

Glucose is an important carbon sources for microbial growth, and its content in infertile soils is essential for the growth of the bacterium. Since the mechanism of oligotrophic bacterium adaptation in barren soils is unclear, the research employed RNA Seq technology to examine the impact of glucose concentration on the low nutrient bacteria BS-G1 in soil affected by desertification. RNA-Seq revealed that differentially expressed genes（DEG）histidine metabolism, glutamate synthesis, HIF-1 signalling pathway, sporulation, and TCA cycle pathway of BS-G1 were significantly enriched in 0.015 g/L glucose concentration, compared with 10 g/L glucose concentration. DEG amino acids system, two-component system, Metal Ion Transport, and nitrogen metabolism system of B. subtilis BS-G1 were significantly enriched in 5 g/L glucose concentration, compared with 10 g/L glucose concentration. In addition, The present study identified its regulation pattern and key genes under the low glucose environment (7 mRNAs, 16 sRNAs). This study primarily investigates the variances in the regulatory pathways of oligotrophic bacteria BS-G1, which holds substantial importance in comprehending the mechanism underlying the limited sugar tolerance of oligotrophic bacteria.

Background: Mutations in TBCK can generate truncated TBCK protein aggregates that abolish the normal function of the gene. Alterations in TBCK function have been implicated in developmental and neurogenetic disorders, as well as the progression of certain forms of cancer. Despite TBCK's involvement in various human diseases, the underlying mechanism for cancer pathogenesis remains poorly understood. Methods: To further explore loss of function mutations in TBCK, we introduced a CRISPR-mediated knockout system capable of deleting the human TBCK gene. Transcriptome analysis based on RNA-seq data was utilized to illustrate important roles of TBCK in cancer initiation and progression. Results: The effectiveness of our targeted CRISPR knockout system (sgTBCK) was validated in multiple human cancer models, including PDAC MIAPaCa-2 and Fibrosarcoma HT1080. Our clear and straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR can be applied to any gene of interest, which highlights the versatility, reproducibility, and user-friendliness of this approach. The application of our TBCK knockout system for transcriptome analysis showed TBCK's involvement in multiple hallmark cancer pathways, such as TNF-α signaling, Apoptosis, Hypoxia, P53, and Epithelial Mesenchymal Transition, emphasizing the importance of TBCK mutations in cancer initiation and progression. Conclusions: We generated a straightforward workflow, detailed protocol, and schematic diagram for knocking out human TBCK via CRISPR and confirmed that the sgRNA against TBCK (GTTCGAGAAAGGAAACCTGTG) was specific for human TBCK. To date, this is the first report that has combined a CRISPR-Cas9 knockout system with transcriptome analysis to uncover potential mechanisms of TBCK in cancer progression.

Standardized protocols were specifically designed and developed for clinical information collection and obtaining trio genomic information from infants affected with congenital anomalies (CA) and their parents, as well as securing human biological resources. Two large areas of these protocols include clinical and genomic information collection on CA which were difficult to diagnose using pre-existing screening methods. The following are three essential items for the clinical information collection protocol: establishment of a consent system for collecting and utilizing research resources, establishment of criteria for target patient selection, and collection of clinical and epidemiological information. A total of 138 cases consisting of 45 families of infants with CA and their parent trios have provided human-derived resources and genomic information. Whole genome sequencing data have been generated for all participants, and standardized protocols for resource collection and manufacturing have been developed. Phenotype information according to the Human Phenotype Ontology term and major test findings were recorded. It is important to keep updating and recording clinical symptoms and genetic diagnosis that are newly added or changed over time. The unique significance of this study is to develop a protocol that enables long-term tracking by adding growth and development tests that reflect important characteristics of newborns. By using these clinical and genetic information collection protocols for CA, it will be possible to establish an essential platform for early genetic diagnosis and diagnostic research, and further present new genetic diagnostic guidelines in the near future.