Anti-Fireblight Potential of the Non-Ribosomal Templated Fabclavines, Synthesized by Xenorhabdus szentirmaii (EMC) and X. budapestensis (EMA)

1. Introduction

1.1. Fire Blight Severely Impacts Global Apple and Pear Production

The causative factor of fire blight (FB), the Gram-negative phytopathogen Erwinia amylovora (Ea), is one of the most important pome fruit pathogens worldwide [1,2,3]. The areas where the distribution of Ea overlaps its host production area is considerable in all continents and are expected to expand further under future climatic conditions [3], however the severe economic losses caused by Ea could be reduced by half by using appropriate control measures [3].

In Hungary, the symptoms of FB (bacterial shoot blight, dieback of pome fruits) were first observed in 1995 on samples from a 5- to 6-year-old apple orchard in Nyárlőrinc [4].

1.2. The Current Control Measures Predominantly Rely on Using Antibiotics

FB is one of the most difficult plant diseases to control, because Ea has an extensive host range within the Rosaceae family (Pyracantha, Cotoneaster, Crataegus, Sorbus, Pyracantha, Cotoneaster etc.), which often serve as hidden foci of infection (Hevesi, personal communication).

Among the limited number of control options currently available, prophylactic application of antibiotics during the bloom period still seems the most effective [5]. Historically, antibiotics have been used in plant medicine since the 1950s to control certain bacterial diseases of high-value fruit, vegetable, and ornamental plants [6], although their utilization in plant protection is far lower than in animal husbandry [7] without reports of adverse effects on human health or persistent impacts on the environment [6]. Springtime antibiotic sprays suppress pathogen growth on flowers and leaf surfaces before infection, however use of antibiotics after infection is ineffective [7]

Extensive use of conventional clinically or veterinary applicable antibiotics like streptomycin (Sm), oxytetracycline (oTet), and kasugamycin (Ksg) raises concerns regarding resistance development and its environmental impacts [2]. Sm as a plant medicine has generally been used in many countries, while the use of oTet, oxolinic acid, and gentamicin is limited to only a few countries [7]. Antibiotics are applied only during periods of high disease risk; consequently, most orchards are not treated annually [7].

The management of FB has always been complicated by limitations on the use of antibiotics in agriculture, due to the risk of antibiotic resistance development, and the limited efficacy of alternative control agents. Even though successful in controlling FB, preventive antibiotic sprays also affect non-target bacteria, aiding the selection of resistance, which could ultimately be transferred to pathogens like Ea [8].

In plant pathogens, the occurrence of resistant mutants to oTet is rare, but those to Sm in Ea impeded control since it has appeared in the USA [6].

The effect of Sm, oTet and Ksg applied on populations of Ea on apple flower stigmas in three field seasons was assessed [9]. Sm and Ksg caused statistically significant reduction of Ea populations on stigmas, although the effect of oTet was more variable: the disease incidence was significantly higher for oxytetracycline-treated flowers compared with the other antibiotic treatments during 2 of 3 years of the study [9].

The extensive and often inappropriate use of antibiotics has led to the rapid emergence and spread of antibiotic resistance, reducing their effectiveness against pathogenic microorganisms in general [10], and also could lead to consequences similar to the resistance crisis that has now developed in animal husbandry and human medicine [11]. For instance, as a result of extensive use of Sm in the USA from the 1950’s the prevalence of Sm^R Ea isolates has increased significantly in North America [12] .Moreover, extensive use of Sm to control FB has led to natural selection for Sm^R strains all over the world, and as alternatives oTet and Ksg have been permitted to be used to control this serious bacterial disease. OTet and Ksg have been approved and applied in the USA against FB since 1974 and 2014, respectively, despite the appearance of oTet^R Ea strains in California in 2007[14].

As for Ksg^R [15,16,17], although natural Ksg^R strains have not yet been reported, but Ksg^R Ea were experientally created by chemical mutagenesis [18]. Furthermore, a gene encoding the novel acetyltransferase, AAC(2’)-IIa, responsible for enzymatic inactivation of Ksg, appeared in a possibly transferable genomic island IncP of rice-pathogen bacteria Burkholderia glumae and Acidovorax avenae [19]. All these seem to indicate that Ksg^R may also easily emerge in nature. In plant pathogens, Ksg^R has unambiguously been evolving through the acquisition of a resistance determinant via horizontal gene transfer [13].

The emergence and spread of antibiotic-resistant bacteria represent a major global public health concern [20]. Resistance genes are frequently associated with mobile or mobilizable genetic elements (MGEs), such as genomic islands [21] which facilitate their horizontal transfer among bacterial species and contribute to the continuous evolution of bacterial resistomes [22]. Despite these concerns, antibiotics including Sm, oTet and Ksg are still widely used for the control of economically important bacterial plant diseases [23]. In plant pathogenic bacteria (PPB) the best-documented vector of antibiotic resistance genes (ARGs) is the transposon Tn5393, which carries the streptomycin resistance genes strA and strB. Closely related Tn5393 variants have also been identified in important human pathogens, including Salmonella enterica and Klebsiella pneumoniae, highlighting the potential for ARG exchange between environmental and clinically relevant bacteria. Although Tn5393 has a relatively simple structure in PPB, it has evolved more complex associations with other MGEs and ARGs in human- and animal-associated bacteria[23].

As for control measures other than those based on using antibiotics, phage-based biocontrol [24], also called phage therapy [25,26], is an emerging method for managing plant pathogens. Phage therapy has recently come into fashion as an approach that avoids unintended selection of life-threatening multidrug-resistant pathogenic bacteria and addresses the growing awareness of the transfer of resistance genes between pathogens [27]. Technologies for using large host-range lytic bacteriophages, like “Keyvirus” [28], for disease management have recently been developed [24,29,30,31]. The advantages of phage therapy include its minimal impact on microbial community equilibrium, the lack of detrimental impacts on plants and beneficial microorganisms, and its capacity to eradicate drug-resistant bacteria [29]. In Korea, a phage cocktail in combination with Ksg was suggested as a potential treatment [32]. Phage resistance, however, is a crucial challenge that should be overcome to enhance the effectiveness of phage therapy.

1.3. Antimicrobial Peptides Against Fire Blight

Antimicrobial peptides (AMPs) [33] are a diverse group of molecules found in a wide range of organisms and act as a defense mechanism against different kinds of infectious pathogens [34], including multidrug-resistant ones [35]. By combining laboratory evolution, genome sequencing and functional analyses, recent works have charted the map of evolutionary trade-offs between antibiotics and have explored the underlying molecular mechanisms. Strikingly, mutations that caused some kinds of antibiotic resistance in bacteria simultaneously enhanced sensitivity to many other unrelated drugs (collateral sensitivity [36]). Antibiotic-resistant bacteria often show collateral sensitivity to AMPs practically without cross-resistance [37]. AMP resistance and antibiotic resistance genes differ in their mobilization patterns. In addition, the rate of horizontal transfer of AMP resistance genes is less frequent than that of antibiotic resistance genes [38,39]. Considering their numerous advantages, searching for AMPs with anti-FB potential seems a promising research field.

Several AMPs have recently been tested for anti-FB potential. The first ones were those produced by Pantoea species , like P. ananatis strain BCA19, which have been used as biological control antagonists of Ea [40]. The genus Pantoea comprises a diverse group of plant-associated bacteria, including both economically important plant pathogens [41] and beneficial strains. Among the latter, Pantoea agglomerans strain HIP32 has been reported as an effective biological control agent against plant pathogens [42,43]. Beneficial Pantoea strains typically produce one or more antimicrobial compounds that contribute to their antagonistic activity. For instance, the epiphytic strain P. agglomerans 48b/90 (Pa48b), a promising biocontrol agent against Ea, produces the broad-spectrum antimicrobial compound 2-amino-3-(oxirane-2,3-dicarboxamido)-propanoyl-valine (APV) [44]. In addition, some Pantoea species evaluated as biological control agents against FB produce histidine-reversible antibiotics, including microcin Eh252 (MccEh252), and pantocin A[43]. Among these, pantocin A is a novel ribosomal-encoded and post-translationally modified natural peptide product [43]. Another promising candidate for the control of FB is serratamid produced by Serratia plymuthica, which showed antibacterial activity against 15 phytopathogenic bacteria, including Ea [45]. AMP-producing Bacillus and Paenibacillus strains also represent promising sources of novel antimicrobial compounds. Genomic analysis of antagonistic isolates revealed numerous biosynthetic gene clusters encoding non-ribosomal peptides (NRPs), polyketides (PKs), NRP–PK hybrids and other bioactive metabolites [46].In addition to naturally occurring bacterial AMPs, synthetic AMPs have also shown promising activity against Ea [47].

An excellent and comprehensive methodology to explore the antibacterial activities and practical usefulness of AMP molecules as anti-FB action has been elaborated by an international (Morocco -Italian) research cooperation sponsored by the National Research Council of Italy (CNR). In one of their recent articles [34], giving an account of results on nine candidate AMP molecules reported against Ea.

1.4. The Aim of This Study

To contribute to the ongoing search for novel antimicrobial compounds for the control of FB, we investigated the antibacterial potential of fabclavine-containing cell-free culture media (CFCMs) produced by the entomopathogenic nematode (EPN) symbionts Xenorhabdus budapestensis (EMA) and X. szentirmaii (EMC) [48,49,50,51,52,53] Fabclavines have previously been reported to exhibit potent antibacterial activity against several PPB, including Ea. [54,55]. To specifically evaluate the contribution of fabclavines to the antibacterial activity of EMA and EMC, genetically engineered mutant strains with altered antimicrobial peptide production were generated. In these mutants, the biosynthesis of most antimicrobial secondary metabolites was silenced by deletion of hfq, while fabclavine production was selectively restored under the control of an L-arabinose-inducible promoter. CFCMs obtained from the wild-type and mutant strains were subsequently evaluated against Ea.

Given the increasing concern over antibiotic resistance and the restrictions associated with the agricultural use of conventional antibiotics, we further evaluated the antibacterial activity of EMA- and EMC-derived CFCMs against multidrug-resistant (MDR) bacteria.

Applying antimicrobial peptide (AMP) molecules, produced by soil-borne organisms like EPN symbiotic entomopathogenic bacteria (EPB) for protecting soil-born plants, seems a preferable alternative to the use of antibiotics. The natural role of peptide antimicrobials, produced by the prokaryotic partner of entomopathogenic-nematode/bacterium (EPN/EPB) symbiotic associations, is to sustain monoxenic conditions for the EPB in the gut of the semi-anabiotic infective dauer juvenile EPN. They keep pathobiome conditions balanced for the EPN/EPB complex in polyxenic (soil, vanquished insect cadaver) niches.

The functional annotation of the draft genome of EMC revealed 71 genes encoding non-ribosomal peptide synthases (NRPS) and polyketide synthases (PKS). The large spatial Xenorhabdus AMP (fabclavine) was discovered in EMA [56], and its biosynthetic pathwaywas described in EMC [57]. The AMPs produced by EMA and EMC are promising candidates for controlling MDR prokaryotic and eukaryotic pathogens including bacteria, oomycetes, fungi and protozoa [49].

2. Results

2.1. Generation of Inducible Fabclavine-Producing Xenorhabdus Strains by Promoter Exchange

To investigate and compare the antibacterial effects of fabclavines (and fabclavine biosynthetic precursors) of EMA and EMC, we first generated mutant strains in which only the fabclavine biosynthetic gene cluster (BGC) responsible for fabclavine production is inducibly active, while the other antimicrobial producing BGCs are silent. Previously, we generated Δhfq mutants of both Xenorhabdus species [58] in which expression of most BGCs had been turned off [59]. Using our newly constructed Δhfq mutants, L-arabinose-inducible fabclavine-producing knock-in mutant strains (fcl KI strains) were generated by exchanging the native promoter of the fcl operon to the Para_BAD promoter according to the easyPACId (easy Promoter Acttivated Compound Idebtification) technique [59,60].

For the promoter exchange, a conditionally replicating, mobilizable, and selectable basic plasmid vector was first assembled (pBZS20, Table 5) containing the replication origin R6Kγ of plasmid R6K, the conjugative transfer origin, oriT, of plasmid RK2, and a Km^R gene from Tn5 along with the Para_BAD promoter and araC gene under the control of Para_C promoter. Then, approx. 0.6 kb fragment starting from the ATG start codon of the first gene of the EMA and EMC fcl operon was amplified and inserted into pBZS20, downstream of the Para_BAD promoter and its Shine-Dalgarno box, thereby placing the fcl gene fragments (serving as homology for targeted integration of the plasmid into the chromosome by homologous recombination) under the control of the Para_BAD promoter.

The resulting promoter exchange vectors pBZS29 and pBZS31 (Km^R) were transformed into E. coli S17-1 λpir strain (Sm^R), which allows their R6Kγ-based replication and supports their mobilization via the RK2 oriT, and mobilized into EMC and EMA Δhfq mutants (Ap^R), respectively. After matings, Km^R transconjugant knock-in (KI) recombinant colonies were obtained after 48-72 hours incubation.

Following the antibiotic resistance phenotype tests, several Km^RAp^RSm^S colonies were further analysed by colony PCRs specific for the Δhfq alleles of both strains [58], and for the vector-chromosome junction at the first gene of fcl operon, indicating the correct recombinational integration. The amplicons obtained from vector-chromosome junctions, including the fusion of Para_BAD promoter and the first gene of fcl operon, were sequenced, which proved that the fcl operon was placed under the L-arabinose-inducible promoter in konck-in mutants of both EMA and EMC Δhfq strains (Figure S1., and sequence files in Supplementary Materials 2 and 3). These KI-mutant strains were then used to produce cell-free conditioned media (CFCMs) under inducing and non-inducing conditions, and these CFCMs were applied in the following of LC-MS measurements and bioassays to analyse their antibacterial potential against several selected bacterial species.

Figure 1. Schematic overview of the generation of L-arabinose-inducible fabclavine-producing knock-in (fcl KI) strains. Plasmid pBZS29 was used for the generation of the EMA fcl KI strain, whereas pBZS31 was used for the generation of the EMC fcl KI strain. The blue box represents the 0.6 kb 5′ region of the first gene of the fcl BGC used as the homologous recombination fragment.

Figure 1. Schematic overview of the generation of L-arabinose-inducible fabclavine-producing knock-in (fcl KI) strains. Plasmid pBZS29 was used for the generation of the EMA fcl KI strain, whereas pBZS31 was used for the generation of the EMC fcl KI strain. The blue box represents the 0.6 kb 5′ region of the first gene of the fcl BGC used as the homologous recombination fragment.

2.2. LC-MS Analysis of Induced and Non-Induced CFCMs of EMA and EMC fcl KI Strains

LC-HRMS-based targeted screening measurements were performed on induced and non-induced EMA and EMC fcl KI CFCM samples (Sample #1: induced EMA fcl KI CFCM, sample #2: non-induced EMA fcl KI CFCM, sample #3: induced EMC fcl KI CFCM, sample #4: non-induced EMC fcl KI CFCM). The screening strategy was based on the panel of 32 target compounds previously identified by [61] (Table 1).

Inspection of the molecular structures revealed that these compounds contain multiple nitrogen atoms, which are readily protonated under LC-MS conditions and therefore exhibit excellent ionization efficiency in positive electrospray ionization mode. Consequently, multiply charged ions were expected to dominate the mass spectra. As anticipated, all target compounds were detected as ions carrying between one and five positive charges (+1 to +5).

Accordingly, the targeted screening workflow was designed to include the extraction of all five charge states for each target compound. Extracted ion chromatograms (XICs) corresponding to these ions were generated for every analyte in each sample. A compound was considered positively identified only when at least two charge states were detected at the same retention time, providing strong evidence for the presence of the respective compound.

The same screening procedure was applied to the non-induced samples. As expected, no significant peaks corresponding to the target compounds were detected in these controls. The extracted ion chromatograms of the positively identified target compounds are shown in Figure 2 and Figure 3.

Owing to the high number of basic nitrogen atoms, the target compounds are predominantly protonated under acidic chromatographic conditions, resulting in reduced retention on the reversed-phase stationary phase. Since the high resolving power of the mass spectrometer enables selective visualization of individual ions by extracted ion chromatograms (XICs), baseline chromatographic separation of the target compounds was not considered necessary.

For several target compounds, multiple peaks were observed in the extracted ion chromatograms. Detailed examination of the corresponding high-resolution mass spectra demonstrated that these peaks were not attributable to chromatographically separated isomers. Instead, they originated from overlapping isotope peaks of compounds with different elemental compositions, typically differing in mass by only 1–2 Da.

Based on the targeted screening results, compounds 1, 2, 3, 4, 6, 7, 8, 17, 18, 19, 22, 23, 25, 27, 29, and 30 were unequivocally identified in the induced EMA fcl KI CFCM (sample #1), with compounds 1–8 showing the highest signal intensities. In contrast, EMC fcl KI CFCM (sample #3) was characterized by the predominant presence of compounds 15–21, whereas the lower-numbered target compounds were not detected. The extracted ion chromatograms and high-resolution mass spectra supporting these identifications are provided in the Supplementary Material 4.

2.3. Analyses of Induced and Non-Induced CFCMs Using the Agar Well Diffusion Assay

The antibacterial activity of CFCMs obtained from the wild-type, Δhfq mutant and fcl KI mutant (induced and non-induced) EMA and EMC strains was assessed against Erwinia amylovora Ea1, extended spectrum β-lactamase producing Escherichia coli (E. coli ESBL), Pseudomonas aeruginosa (Pa), methicillin resistant Staphylococcus pseudintermedius (MRSP) and Enterococcus faecium (ATCC6057, Ef) using the agar well diffusion assay (Figure 4 and Figure 5, see also Figure S5). After overnight incubation the diameter of the inhibition zones were measured. Pa was not inhibited by any of the tested CFCMs. In contrast, CFCM from the wild-type and induced fcl KI strains exhibited antibacterial activity against all other tested bacteria (Table 2). The Δhfq mutants of EMA and EMC showed reduced antibacterial activity compared to the corresponding wild-type and induced fcl KI strains. The EMA Δhfq CFCM retained weak residual activity against E. coli ESBL, MRSP and Ea1, producing inhibition zones that were considerably smaller than those of the corresponding wild-type and induced fcl KI strains, whereas no antibacterial activity was detected for the EMC Δhfq mutant. Similarly, the non-induced fcl KI mutants exhibited little or no antibacterial activity. No residual antibacterial activity was detected for the non-induced EMA fcl KI CFCM against any of the tested bacteria. In contrast, the non-induced EMC fcl KI CFCM produced faint, barely measurable inhibition zone against Ea1, whereas no residual activity was observed against the other tested bacteria. These findings indicate that the antibacterial activity of EMA and EMC strongly depends on fabclavine production.

2.4. In Planta Bioassay

To assess the potential plant protection application of CFCMs obtained from EMA and EMC fcl KI strains against fire blight, a preventive in planta bioassay was performed on Idared apple flowers. Induced and non-induced EMA and EMC fcl KI CFCMs were applied at different dilutions. kasumin and streptomycin were used as positive control. Seven days after inoculation with Ea1 [4,62], disease severity was assessed in all flowers (n = 30 per treatment) using the rating scale described by [63] (Figure 6 and Table S6). Based on this rating scale, infection frequency, severity of infection, and the infection index were determined using the following formulas:

$$\mathrm{F}\mathrm{r}\mathrm{e}\mathrm{q}\mathrm{u}\mathrm{e}\mathrm{n}\mathrm{c}\mathrm{y} \mathrm{o}\mathrm{f} \mathrm{i}\mathrm{n}\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\left({\mathrm{I}}_{\mathrm{f}\mathrm{q}}\right)={\displaystyle \frac{\mathrm{N}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{i}\mathrm{n}\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{t}\mathrm{e}\mathrm{d} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s}}{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l} \mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s}}}\times 100$$

$$\mathrm{S}\mathrm{e}\mathrm{v}\mathrm{e}\mathrm{r}\mathrm{i}\mathrm{t}\mathrm{y} \mathrm{o}\mathrm{f} \mathrm{i}\mathrm{n}\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\left({\mathrm{S}}_{\mathrm{i}}\right)={\displaystyle \frac{\mathrm{N}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{i}\mathrm{n}\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{t}\mathrm{e}\mathrm{d} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s} \mathrm{x} \mathrm{s}\mathrm{c}\mathrm{a}\mathrm{l}\mathrm{e} \mathrm{v}\mathrm{a}\mathrm{l}\mathrm{u}\mathrm{e}}{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l} \mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s} \mathrm{x} \mathrm{m}\mathrm{a}\mathrm{x}\mathrm{i}\mathrm{m}\mathrm{a}\mathrm{l} \mathrm{s}\mathrm{c}\mathrm{a}\mathrm{l}\mathrm{e} \mathrm{v}\mathrm{a}\mathrm{l}\mathrm{u}\mathrm{e}}}\times 100$$

$$\mathrm{I}\mathrm{n}\mathrm{f}\mathrm{e}\mathrm{c}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n} \mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}={\displaystyle \frac{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l} \mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s} \mathrm{x} \mathrm{s}\mathrm{c}\mathrm{a}\mathrm{l}\mathrm{e} \mathrm{v}\mathrm{a}\mathrm{l}\mathrm{u}\mathrm{e}}{\mathrm{T}\mathrm{o}\mathrm{t}\mathrm{a}\mathrm{l} \mathrm{n}\mathrm{u}\mathrm{m}\mathrm{b}\mathrm{e}\mathrm{r} \mathrm{o}\mathrm{f} \mathrm{f}\mathrm{l}\mathrm{o}\mathrm{w}\mathrm{e}\mathrm{r}\mathrm{s}}}$$

Preventive treatment of apple flowers with CFCM derived from induced and non-induced fcl KI mutants of EMA and EMC resulted in different levels of protection against fire blight, as reflected by the infection frequency, severity of infection, and infection index (Figure 7, Figure 8 and Figure 9). The frequency of fire blight infection differed markedly among the treatments (Figure 7). The non-induced EMC CFCM did not reduce infection, with all flowers becoming infected at every tested concentration, similarly to the untreated control. In contrast, induction substantially improved the efficacy of the EMC-derived CFCM, reducing infection frequency to 20% at the highest concentration. Unexpectedly, the non-induced EMA CFCM also reduced infection frequency, and its efficacy increased with increasing concentration. Nevertheless, induction further enhanced the protective effect of the EMA-derived CFCM (Figure 7). Among the positive controls, streptomycin provided the highest level of protection, while kasumin also markedly reduced infection frequency compared to the untreated control.

A similar trend was observed for infection severity (Figure 8). The highest infection severity values were recorded for the untreated control and the non-induced EMC treatments, whereas induction substantially reduced symptom development in both EMA and EMC. Similar to the infection frequency results, the non-induced EMA CFCM also reduced disease severity compared to the untreated control, although the induced EMA treatment provided further improvement. Streptomycin resulted in the lowest infection severity values, while kasumin also considerably reduced symptom development. The induced EMA and EMC CFCMs resulted in symptom severity comparable to that observed after streptomycin treatment.

The combined effect of infection frequency and disease severity is reflected by the infection index (Figure 9). Consistent with the previous parameters, the untreated control and the non-induced EMC treatments exhibited the highest infection index values at all tested concentrations. In contrast, induction markedly reduced the infection index of the EMC-derived CFCM. The non-induced EMA CFCM also lowered the infection index compared to the untreated control in a concentration-dependent manner, while induction further improved its efficacy. Among the positive controls, Streptomycin showed the strongest protective effect, whereas kasumin also substantially reduced the infection index. At the highest tested concentrations, the induced EMA and EMC CFCMs achieved infection index values comparable to those obtained with streptomycin, demonstrating a strong protective effect against fire blight.

3. Discussion

The goal of this project is to contribute to the international efforts to control FB, the most significant threat to commercial fruit (apple, pear, [64] and plum [65]) production globally, and in Hungary [66,67].

The aim of this study is to utilize the fabclavine [56] producing potential of two entomopathogenic nematode (EPN) symbiont entomopathogenic bacterium (EPB) species [48,49], in controlling FB [53,54]. The type strains of both species had been identified, characterized, and deposited by us into DSMZ Braunschweig with Prof. Erko Stackebrandt, who used to be the Head of this Institution, [48,49].

Among the limited number of control options for controlling FB currently available, prophylactic application of antibiotics during the bloom period still seems the most effective [5]. Apart from the resistance problems (discussed in the Introduction), the results were not unambiguous when some antibiotics were used for subsequent years [13,68]. Streptomycin and kasugamycin caused statistically significant reduction of Ea-populations on stigmas in 4- to 5-day periods. The effect of oxytetracycline was more variable: the disease incidence was significantly higher for oxytetracycline-treated flowers compared with the other antibiotic treatments during 2 of 3 years of the study [9].

But concerns about resistance problems themselves justify the need for new antibiotics with novel modes of action like RejuAgro A, [2], and antimicrobial peptides [34], preferably those produced by natural antagonistic bacteria like pantocine [43].

Amongst the “pioneers” of this research trend, we tested complete, and fractionated cell-free conditioned liquid culture media (CFCM) of several (about 80) antimicrobial producing EPB belonging to the Xenorabdus and Photorhabdus genera on different plant-pathogenic bacteria (PPB) in vitro [53,55], and found that Xenorhabdus budapestensis, (EMA) and X. szentirmaii (EMC) were unambiguously far the best antimicrobial producers. This fact was confirmed several times in other bioassays [50,51,52,53,58,69,70,71].

Data unambiguously indicated that the most active antimicrobial ingredients of these CFCMs are the fabclavines [56,72], which also exert strong antibacterial activity on Ea cells in vitro [55]. Fabclavines are non-ribosomal, enzymatically biosynthesized antimicrobial peptides (NRP AMP) synthesized by an enzyme complex encoded by the fabclavine biosynthetic gene cluster (fcl BGC), both in EMA and EMC [57,61]. The gene expression of the fcl BGC is under the regulation of the hfq regulatory gene and is also co-regulated with other BGCs, which are responsible for the biosynthesis of secondary metabolites with antimicrobial potential during the so-called primary (or „Phase-1”, or 1⁰) stage of these bacteria. Phase 1 is the physiological state of each bacterium scored to EPB species (Xenorabdus and Photorhabdus) while it exists as a symbiont [73,74]. In this publication, we intend to test this hypothesis.

Neither of the fcl KI mutants we created by using the easyPACId method are supposed to produce any antimicrobial compounds in the absence of arabinose. Consequently, if our hypothesis were correct, the CFCMs of the uninduced cultures should be inactive, while those of the induced cultures should exert antibacterial effects.

The results confirm the hypothesis. The CFCMs of the induced fcl KI mutants exerted a strong antibacterial effect on each of the fabclavine-sensitive test bacteria including Ea1 according to the agar diffusion test data (Figures 4,5 and S5, Table 2). The chemical analysis made it unambiguous that the fabclavine synthesis went on perfectly in the induced cultures of both EMA and EMC fcl KI mutants, but neither fabclavine nor any intermediary molecule indicating biosynthetic activity was found in the non-induced fcl KI mutant CFCMs. In Figure 4, the results of the agar well diffusion assay allow comparison of the antibacterial activity of the CFCM from wild-type (wt), Δhfq mutant, and induced and non-induced cultures of fcl KI mutant strains of EMA against Ea1 (left panel) and MRSP (right panel). It can be seen that the antibacterial activities of the CFCMs of the wild-type and the induced fcl KI mutant strains are very similar to each other. So do the CFCMs of the Δhfq and the non-induced fcl KI mutant strains. In fact, the CFCM of the EMA Δhfq mutant shows hardly detectable but not ignorable antibacterial activity, which must be independent of the hfq-regulated gene expression.

To learn whether phytotoxic side effects caused (for instance) by some unknown ingredients of the CFCMs might influence the results, preliminary in planta experiments were run and repeated three times. The first time, at extreme (100%) humidity, we observed some phytotoxic-looking symptoms (dark spots on the petals), independently of whether the tested CFCM sample was taken from a Δhfq mutant, induced or not-induced EMA or EMC fcl KI mutant culture. The second or third time, when we reduced the humidity, we did not observe any phytotoxic symptoms, not even when testing the phytotoxic effect of higher doses than published here. Years ago we experienced the same in a field experiment (Földes, unpublished) carried out in extreme (extremely high temperature, high UV conditions) environmental conditions.

As for the in planta experiments, our data seem to support the arguments for giving priority to antibiotics and/or antimicrobial peptides, like fabclavine with strong bactericidal activity as first line armature of preventive or curative chemotherapy against FB. Considering that the bactericidal activity of fabclavine seems to be comparable with that of the commercial antibiotics (like kasumin and Streptomycin) presently used, we suggest taking the option of the practical agricultural application of fabclavine against FB into serious consideration, especially because of the hazards of antibiotic resistance gene contamination [75] and the importance of mobility-resolved resistome architecture [22].

It is a practical question to answer whether the application of purified fabclavine or fabclavine derivatives or simply the whole or partially purified/fractionated CFCM preparation of some appropriate mutant (like our EMC fcl KI mutant) should be recommended for further study. We would appreciate to get a chance to explore the antibacterial activities and practical usefulness of our fabclavine-derived AMP molecules as anti-FB action in a system like that elaborated by an international (Morocco -Italian) research cooperation sponsored by the National Research Council of Italy [34].

4. Materials and Methods

4.1. Microbial Strains and Techniques

Xenorhabdus budapestensis DSM16342 (EMA) and X. szenttirmaii DSM16338 (EMC) wild type strains were discovered and deposited at the German Collection of Microorganisms and Cell Cultures (DSMZ) (Lengyel et al., 2005, Table 3). We generated Δhfq mutants of both strains to switch off the antimicrobial secondary metabolite production (Bode et al., 2019), and then we generated fabclavine promoter knock-in mutant strains (fcl KI) from the Δhfq mutants, which produce only fabclavines from the antimicrobial metabolite repertoire. During this process E. coli S17-1 λpir strain was used to mobilize the KI vector into EMA and EMC Δhfq strains. S17-1 λpir was cultured at 37 °C in LB broth supplemented with 50 μg/mL streptomycin. For the cultivation of Xenorhabdus bacteria LB liquid medium, LB agar and LBTA agar plates were used. LBTA indicator plates are modified LB agar plates supplemented with 5 μg/mL bromothymol blue (BTB, Sigma-Aldrich, St. Louis, MO, USA) and 8 μg/mL 2,3,5-triphenyltetrazolium chloride (TTC, Sigma-Aldrich, St. Louis, MO, USA) and used to distinguish between secondary metabolite producing (phase 1) and non-producing (phase 2) variants [53,76]. Fcl KI mutants were cultured in media supplemented with kanamycin (Km) in final concentration of 50 μg/mL. All Xenorhabdus strains were grown at 30 °C.

For the in planta bioassay, Erwinia amylovora strain Ea1 was used[4]. The strain, which had been stored at -196 °C, was propagated on King-B medium (Merck, Darmstadt, Germany). Ea1 was also used in the agar well diffusion assay, for which it was cultured in LB medium at 30 °C in a rotary shaker at 180 rpm.

In the agar well diffusion assay, besides Ea1, three antibiotic-multiresistant bacterial strains were used. Extended spectrum beta-lactamase producing Escherichia coli (E. coli ESBL), Pseudomonas aeruginosa (Pa) and methicillin resistant Staphylococcus pseudintermedius (MRSP) were provided by P. Mag and Á. Jerzsele from the Department of Pharmacology and Toxicology of the University of Veterinary Medicine, Budapest and Enterococcus faecium (ATCC6057, Ef) was provided by Prof. Cs. Pál from the Hun-Ren Biological Research Centre, Szeged, Hungary. These bacterial strains were cultured in LB medium at 37 °C in a rotary shaker at 180 rpm.

4.2. Generation of Inducible Fabclavine-Producing Knock-In Mutant (fcl KI) Xenorhabdus budapestensis and X. szentirmaii

We generated L-arabinose-inducible fabclavine-producing mutants (fcl KI) from the Δhfq mutants of EMA and EMC [58] by exchanging the native promoter of the fcl operon to the Para_BAD promoter according to the easyPACId technique [59,60].

4.2.1. Exchange of the Promoter of the fcl Operon

Standard molecular biology procedures were carried out according to [78]. For the promoter exchange, a basic plasmid vector pBZS20 (this work, Table 5) containing the conditional replication origin R6Kγ of plasmid R6K, the oriT of plasmid RK2, the Para_BAD promoter and araC gene under the control of Para_C promoter and the APH(3')-II family aminoglycoside O-phosphotransferase gene (a Km^R cassette from Tn5) was constructed. First, the 1.6 kb ClaI-PstI fragment of pJKI625 containing the Para_BAD promoter along with the araC gene was inserted into the ClaI-PstI digested pSG76-K resulting in pBZS19. Then, the 150 bp transfer origin (oriT) region of IncP plasmid RK2 (positions 51115-51276 bp) was cut out from pJKI664 with AccI and ligated into the ClaI site of pBZS19 resulting in pBZS20. Finally, the first 575 bp of the first gene of the fcl operon of EMA (Xbud_02634 see Figure S1) was amplified using primers fabcl_EMA_Ndfor and fabcl_EMA_Prev, while the first 675 bp of the homologous gene of EMC (Xsze_RS18325 see Figure S1) was amplified with primers fabcl_EMC_Ndfor and fabcl_EMC_Prev (Table 4 and Figure S1).

Table 4. List of primers used in this work.

Primer	sequence (5’-3’)	Reference
fabcl_EMA_Ndfor	aaacatatgtccaagacgtattttttgcatg	this work
fabcl_EMA_Prev	aactgcagctgtcttcattccactcaag	this work
fabcl_EMC_Ndfor	aaacatatgtctgagacatattttttacatgatagaaaaattcg	this work
fabcl_EMC_Prev	aactgcaggctactggcacaagcagc	this work
fabcl_EMA_test	gcaaggctgctggcac	this work
fabcl_EMC_test	ccgcccatcgctggaag	this work
hfqseqfor	tctcatgatgagatggtttatcgtg	[58]
hfqseqrev	gcacaggagaaacacctgcgg	[58]
ParaBfor	gcacggcgtcacactttgc	this work
araC_5out	taacctttcattcccagcggtc	this work

Table 4. List of primers used in this work.

Primer	sequence (5’-3’)	Reference
fabcl_EMA_Ndfor	aaacatatgtccaagacgtattttttgcatg	this work
fabcl_EMA_Prev	aactgcagctgtcttcattccactcaag	this work
fabcl_EMC_Ndfor	aaacatatgtctgagacatattttttacatgatagaaaaattcg	this work
fabcl_EMC_Prev	aactgcaggctactggcacaagcagc	this work
fabcl_EMA_test	gcaaggctgctggcac	this work
fabcl_EMC_test	ccgcccatcgctggaag	this work
hfqseqfor	tctcatgatgagatggtttatcgtg	[58]
hfqseqrev	gcacaggagaaacacctgcgg	[58]
ParaBfor	gcacggcgtcacactttgc	this work
araC_5out	taacctttcattcccagcggtc	this work

Table 5. Relevant features of plasmids used in this study.

Name	Relevant features	References
pSG76-K	R6Kγ-based KmR replicon	[79]
pJKI625	A p15A-based KmR plasmid containing the ParaBAD promoter and the araC gene	[80]
pJKI664	A pEMBL19 derivative containing the oriT of RK2	[81]
pBZS19	pSG76-K derivative containing the ParaBAD promoter and the araC gene	this work
pBZS20	pBZS19 derivative containing the replication origin R6Kγ, oriT from pJKI664, ParaBAD promoter and araC gene under the control of ParaC promoter, and KmR cassette	this work
pBZS29	fcl KI vector for EMC derived from pBZS20	this work
pBZS31	fcl KI vector for EMA derived from pBZS20	this work

Table 5. Relevant features of plasmids used in this study.

Name	Relevant features	References
pSG76-K	R6Kγ-based KmR replicon	[79]
pJKI625	A p15A-based KmR plasmid containing the ParaBAD promoter and the araC gene	[80]
pJKI664	A pEMBL19 derivative containing the oriT of RK2	[81]
pBZS19	pSG76-K derivative containing the ParaBAD promoter and the araC gene	this work
pBZS20	pBZS19 derivative containing the replication origin R6Kγ, oriT from pJKI664, ParaBAD promoter and araC gene under the control of ParaC promoter, and KmR cassette	this work
pBZS29	fcl KI vector for EMC derived from pBZS20	this work
pBZS31	fcl KI vector for EMA derived from pBZS20	this work

PCR amplifications were carried out using 0.2 μM primers, 0.2 mM dNTP, 1.5 units of Phusion polymerase (Thermo Scientific, Waltham, MA, USA) in 1× HF buffer in a final volume of 25 μL. As template 0.5 μL of EMA and EMC overnight cultures were applied. Cycling was the following: denaturation at 98 °C for 2 min, 30× (98 °C for 10 s, 55 °C for 30 s, 72 °C for 60 s), finalized by 72 °C for 5 min.

The amplicons were EtOH-precipitated, dried under vacuum for 15 min and dissolved in 20 μL of TE buffer (10 mM Tris 1 mM EDTA, pH 8.0), then were digested with NdeI-PstI and ligated into pBZS20 linearized with NdeI-PstI. For ligation reactions ~100 ng of pBZS20 DNA and 300-500 ng of digested amplicon DNA was used with 2.5 units of T4 ligase (Thermo Scientific, Waltham, MA, USA) in 1× ligase buffer in a final volume of 10 μL. The reaction mixes were overnight incubated at 16°C and XbaI-XhoI-digested for 1 hour before transformation to eliminate uncut pBZS20 plasmids.

5 μL of ligation mixes were transformed into E. coli S17-1 λpir strain, allowing replication of the R6Kγ-based plasmids. Transformants were selected on LB plates supplemented with 50 μg/mL kanamycin. (Duchefa Biochemie, Haarlem, The Netherlands) by overnight incubation at 37 °C. Plasmid DNA was purified from 5 mL LB+Km cultures grown overnight at 37 °C using QIAprep Spin Miniprep Kit, and after verification by restriction analysis, appropriate clones were Sanger sequenced (Eurofins BIOMI Ltd. Gödöllő, Hungary) using primer ParaBfor (Table 4) on ABI 3500xL Genetic Analyzer (Life Technologies, Carlsbad, CA, USA).

4.2.2. Generating the fcl Knock-in Mutants

The resulting knock-in (KI) vectors pBZS29 and pBZS31 were mobilized into EMC and EMA Δhfq mutants, respectively, from E. coli S17-1 λpir. Donor cultures were grown overnight at 37 °C in LB broth supplemented with streptomycin (Sm) and kanamycin (Km), while recipients were grown overnight at 30 °C in LB broth supplemented with ampicillin (Ap). Concentration of antibiotics were 50 μg/mL for Sm and Km and 150 μg/mL for Ap unless otherwise specified.

Construction of Fabclavine Producing Strains by Conjugation

For conjugation into EMA Δhfq strain, 100 μL of overnight (ON) S17-1 λpir/pBZS31 donor culture was mixed with 900 μL of ON recipient culture, cells were spinned down at 3000 rpm in a benchtop centrifuge, washed twice in 0.9% NaCl solution and spread onto LB plates, which were incubated for 4 hours at 30 °C, then bacterial lawn was resuspended with 3 mL of 0.9% NaCl solution. The mixture was plated on LB+Km+Sm (donor) and LB+Ap (recipient), while transconjugant recombinants were selected on LB+Km+5×Ap plates (containing 750 μg/mL Ap) incubated 48-72 hours at 30 °C. Higher Ap concentration was necessary to inhibit the growth of the donor strain.

For conjugation into EMC Δhfq strain, ON S17-1 λpir/pBZS29 donor culture was 5× diluted in 5 mL fresh LB+Sm+Km broth and grown to approx. 0.6-0.7 OD₆₀₀. The recipient EMC Δhfq strain grown overnight in LB+Ap was 4× diluted in 9 mL fresh LB+Ap and grown for 2 hours at 30 °C to approx. 1.5 OD₆₀₀. 1 mL donor and 2 mL recipient cultures were mixed, centrifuged for 1 min at 3000 rpm and washed with 0.9% NaCl solution, then spread onto LB agar plates and incubated for 4 hours at 37 °C, then overnight at 30 °C. After incubation bacterial lawn from the LB plates was resuspended in 3 mL 0.9 % NaCl solution. The mixture was titered on LB+Km+Sm (donor) and LB+Ap (recipient). Cells were centrifuged and spread onto LB+2×Km+5×Ap+X-gal agar plates (containing 100 μg/mL kanamycin, 750 μg/mL ampicillin and 0.004% X-gal (Thermo Scientific, Waltham, MA, USA)). Transconjugant recombinants were detected after 2 days of incubation at 30 °C as white colonies among the blue background colonies of the donor.

Verification of KI Recombinants

The Km^RAp^RSm^S colonies were tested with colony PCR using primers hfqseqfor and hfqseqrev indicative of both Xenorhabdus Δhfq strains, and primers ParaBfor and fabcl_EMA_test or fabcl_EMC_test (Table 4), indicative of the correct recombination. Colony PCRs were carried out using 0.2 μM primers, 0.2 mM dNTP, 2.5 mM MgCl₂, 1 unit of Dream Taq polymerase and 1 μL of overnight culture in 1× Taq buffer (Thermo Scientific, Waltham, MA, USA) in 25 μL final volume. Cycling was the following: denaturation at 94 °C for 2 min, 35× (94 °C for 20 s, 55 °C for 30 s, 72 °C for 45 s), finalized by 72 °C for 5 min. From the clones proved positive for both PCRs, broader junction region of the insert was amplified with primers araC_5out and fabcl_EMA_test or fabcl_EMC_test using Phusion polymerase as described above. The obtained amplicons were purified using QIAQuick PCR Purification Kit (QIAgen, Hilden, Germany) and Sanger sequenced with primer ParaBfor (Eurofins BIOMI Ltd. Gödöllő, Hungary) (Figure S1., and sequence files in Supplementary Materials 2 and 3).

4.3. Preparation of Cell-Free Conditioned Media (CFCM)

For the preparation of CFCM one loopful of bacteria was inoculated into 5 mL LB (with the addition of 50 μg/mL Km in case of fcl KI mutants) and incubated overnight at 30 °C on a rotary shaker. From this overnight culture 2.5 mL was transferred into 50 mL sterile LB or LB + Km and incubated again overnight at 30 °C with shaking. From these cultures 25 mL was transferred into 1 L LB and incubated at 30 °C and at speed of 150 rpm for 5 days. Fcl KI mutant cultures were prepared without induction or with the addition of 0.2 % L-arabinose to induce fabclavine production. To obtain cell-free supernatant, cultures were centrifuged at 6000 rpm for 20 min at 4 °C and filtered through 0.22 μm Millipore filter. CFCM were stored at 4 °C until use.

4.4. LC-MS Analysis of Induced and Non-Induced CFCM of EMA ad EMC fcl KI Strains

Induced and non-induced CFCM obtained from EMA and EMC fcl KI strains were subjected to targeted accurate-mass screening using a TripleTOF 5600+ hybrid quadrupole time-of-flight LC–MS/MS system (SCIEX, MA, USA) equipped with a DuoSpray ion source and coupled to a Shimadzu Prominence LC-20 UFLC system (Shimadzu, Japan) consisting of a binary pump, an autosampler, and a thermostated column compartment. Data acquisition and processing were performed using Analyst TF software version 1.7.1 (SCIEX Instruments, CA, USA).

Chromatographic separation was achieved on a Waters XSelect CSH C18 column (150 mm × 4.6 mm, 3.5 µm). Gradient elution was performed using 0.1% formic acid in water as mobile phase A and 0.1% formic acid in acetonitrile (ACN) as mobile phase B. The initial mobile phase composition of 10% B was maintained for 1 min, followed by a linear increase to 95% B at 9 min. The mobile phase composition was maintained at 95% B from 9 to 12 min and then returned to the initial conditions (10% B) between 12 and 12.5 min. The initial conditions were maintained until 15 min. The flow rate was set to 1.0 mL/min. The column temperature was maintained at 40 °C, and the injection volume was 5 µL.

Nitrogen was used as the nebulizer gas (GS1), heater gas (GS2), and curtain gas (CUR), with the corresponding pressures set to 45, 45, and 40 psi, respectively. Data were acquired in positive electrospray ionization mode over an m/z range of 100–2000, with an accumulation time of 1 s. The source temperature was set to 450 °C, and the ion spray voltage was 5000 V. The declustering potential was set to 80 V. The mass resolution of the instrument was at least 25,000.

PeakView software version 2.2 (SCIEX, Redwood City, CA, USA) was used for targeted screening based on the elemental compositions of the expected compounds. For peptide-like compounds, the corresponding singly and multiply charged ions, including doubly and triply charged species, were considered. Putative matches were manually evaluated, and the co-elution of ions corresponding to different charge states of the same compound was verified.

4.5. Agar Well Diffusion Assay

The antibacterial activity of CFCM derived from wild type (wt), Δhfq mutant, and induced and non-induced fcl KI mutant strains of EMA and EMC was evaluated using an agar well diffusion assay against Ea1, E. coli ESBL, Pa, MRSP, and Ef following the method of Fodor et al. (2012) with minor modifications. Experiments were carried out on LB agar plates in 90 mm Petri dishes containing 20 mL LB agar. Before the experiment, a loopful of each test bacteria from deep frozen stock cultures was inoculated into 5 mL LB medium and incubated overnight. From the ON cultures 300 µL was mixed with 2.7 mL 0.75 % soft agar maintained at approximately 45 °C and immediately overlaid onto the LB agar plate. After this layer solidified, wells with 8 mm diameter were made and filled with 100 µL CFCM. Plates with Ea1 were incubated at 30 °C, other plates were incubated at 37 °C ON corresponding to the optimal growth temperatures of the respective test organisms. After incubation, diameters of the inhibition zones were measured. Each test was performed in triplicate.

4.6. In Planta Bioassay

Flowers of the Idared apple variety susceptible to fire blight disease were collected at the balloon stage right before blooming to prevent any potential contamination in the field and placed individually in test tubes containing 10 % (w/v) aqueous solution of sucrose and kept in transparent plastic boxes at 24+/-0.5 °C and 85 % relative humidity during the experiment, as described by [82] (Figure 10). The humidity was maintained by a 42% (v/v) glycerol solution (422 mL glycerol (Acidum-2 Kft., Debrecen, Hungary) + 578 mL water) at the bottom of the boxes. Under these microclimatic conditions, the flowers bloom simultaneously after 24 hours.

Freshly bloomed flowers were treated preventatively with induced and non-induced CFCM obtained from the fcl KI EMA and EMC mutant strains and with Kasumin 2 L (Hokko Chemical, Tokyo, Japan) and Streptomycin 20 WP (Meiji Seika Kaisha, Tokyo, Japan, Table 6). Flowers were sprayed with various concentrations of the treatment agents (dilutions concerning CFCM of EMA and EMC, and ppm, concerning Kasumin 2L and Streptomycin 20 WP formulations).

Twenty-four hours after treatment, flower pistils were inoculated with 5 × 10⁷ CFU/mL suspension of Ea1 suspended in physiological saline using a microcapillary. Thirty flowers per treatment were inoculated whereas uninoculated flowers served as water-treated controls. On the 7th day after inoculation, all the flowers were sectioned longitudinally and scored for disease severity using the rating scale reported by [63], where 0 = no necrosis, 1 = detectable necrosis, 2 = up to half of the ovary was necrotic, 3 = necrosis affecting half to all the ovary,4 = necrosis extending beyond ovary and into peduncle and 5 = like 4, but bacterial ooze visible (Figure 6). Using the infection scale, infection frequencies and the severity of infection were estimated, and the infection index was calculated.

5. Conclusions

The CFCM derived from the fcl KI mutant strains of both EMA and EMC exhibited strong bactericidal effect against cells of the target organism, Erwinia amylovora Ea1, which causes fire blight (FB). This effect was also observed against multidrug-resistant strains of (fabclavine-sensitive) Gram-negative bacteria, such as Escherichia coli (E. coli ESBL), as well as (fabclavine-sensitive) Gram-positive bacteria, including Enterococcus faecium (ATCC6057, Ef), Staphylococcus pseudointermedius (MRSP), and earlier on Staphylococcus aureus (MRSA) in vitro. The in planta tests of these CFCMs proved that the prophylactic efficacy of both induced fcl KI strains is unambiguous and comparable to that of the commercially available “kasumin” and streptomycin preparations comparatively tested. No sign of phytotoxic effects on the treated flowers was observed. Based on these results, we propose further studies on the FB-control potential of either the whole CFCM from appropriately selected Δhfq; fcl KI Xenorhabdus mutants as “biopreparations”, or selected end-products (fabclavine) or biosynthetic intermediates, as a new antibiotics. As the CFCM analysis indicates, different mutants may produce different intermediates (maybe with similar or altered cellular effects).

Before deciding to carry on this research direction, we need to subject both the CFCMs to a comprehensive methodology to explore the antibacterial activities and practical usefulness of AMP molecules as anti-FB action, as elaborated by an international (Morocco -Italian) research cooperation sponsored by the National Research Council of Italy (CNR) [34].