Submitted:
10 July 2026
Posted:
13 July 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Ethical Approval and Animal Care
2.2. Rat Kindling and Treatment
2.3. Tissue Collection
2.4. Reduced Representation Bisulfite Sequencing (RRBS)
2.5. Differential Methylation Analysis and Pathway Enrichment
2.6. Quantitative Real-Time PCR (qPCR)
2.7. Statistical Analysis
3. Results
3.1. Sarcosine Suppresses Hippocampal Kindling-Induced Epileptogenesis
3.2. Genome-Wide DNA Methylation Changes Associated with Kindling and Sarcosine Treatment
3.3. Comparative Pathway Enrichment Signatures Associated with Epileptogenesis and Sarcosine Treatment
3.4. Kindling-Associated Methylation Pathways Identified by Metascape Enrichment Analysis
3.5. Sarcosine-Associated Methylation Pathways Identified by Metascape Enrichment Analysis
3.6. Transcriptional Validation of Methylation-Associated Candidate Genes
4. Discussion
4.1. Mechanistic Insight Into Kindling-Induced Epileptogenesis
4.2. Epigenetic Context of the qPCR-Validated Genes
4.3. Kindling-Associated Methylation Pathways
4.4. Sarcosine-Associated Epigenetic Remodeling
4.5. Epigenetic Impact of Anti-Epileptogenic Interventions
4.6. Clinical Implications and Future Directions
4.7. Study Limitations
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Vezzani, A.; Balosso, S.; Ravizza, T. Neuroinflammatory pathways as treatment targets and biomarkers in epilepsy. Nat. Rev. Neurol. 2019, 15(8), 459–472. [Google Scholar] [CrossRef] [PubMed]
- Younus, I.; Reddy, D.S. Epigenetic interventions for epileptogenesis: A new frontier for curing epilepsy. Pharmacol. Ther. 2017, 177, 108–122. [Google Scholar] [CrossRef] [PubMed]
- Berger, T.C.; Tauboll, E.; Heuser, K. The potential role of DNA methylation as preventive treatment target of epileptogenesis. Front Cell Neurosci. 2022, 16, 931356. [Google Scholar] [CrossRef] [PubMed]
- Miller-Delaney, S.F.; et al. Differential DNA methylation profiles of coding and non-coding genes define hippocampal sclerosis in human temporal lobe epilepsy. Brain 2015, 138 Pt 3, 616–31. [Google Scholar] [PubMed]
- Caramaschi, D.; et al. Epigenome-wide association study of seizures in childhood and adolescence. Clin. Epigenet. 2020, 12(1), 8. [Google Scholar] [CrossRef]
- Zhu, Q.; et al. Increased expression of DNA methyltransferase 1 and 3a in human temporal lobe epilepsy. J. Mol. Neurosci. 2012, 46(2), 420–6. [Google Scholar] [PubMed]
- Pedersen, S.; et al. Genome-wide decrease in DNA methylation in adults with epilepsy treated with modified ketogenic diet: A prospective study. Epilepsia 2022, 63(9), 2413–2426. [Google Scholar] [CrossRef] [PubMed]
- Tao, H.; et al. DNA Methylation Signature of Epileptic Encephalopathy-Related Pathogenic Genes Encoding Ion Channels in Temporal Lobe Epilepsy. Front Neurol. 2021, 12, 692412. [Google Scholar] [CrossRef] [PubMed]
- Miller-Delaney, S.F.; et al. Differential DNA methylation patterns define status epilepticus and epileptic tolerance. J. Neurosci. 2012, 32(5), 1577–88. [Google Scholar] [CrossRef] [PubMed]
- Kobow, K.; Blumcke, I. The emerging role of DNA methylation in epileptogenesis. Epilepsia 2012, 53 Suppl 9, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Berger, T.C.; et al. Neuronal and glial DNA methylation and gene expression changes in early epileptogenesis. PLoS ONE 2019, 14(12), e0226575. [Google Scholar] [CrossRef] [PubMed]
- Hauser, R.M.; Henshall, D.C.; Lubin, F.D. The Epigenetics of Epilepsy and Its Progression. Neuroscientist 2018, 24(2), 186–200. [Google Scholar] [PubMed]
- Debski, K.J.; et al. Etiology matters - Genomic DNA Methylation Patterns in Three Rat Models of Acquired Epilepsy. Sci. Rep. 2016, 6, 25668. [Google Scholar] [PubMed]
- Navarrete-Modesto, V.; et al. The molecular hallmarks of epigenetic effects mediated by antiepileptic drugs. Epilepsy Res. 2019, 149, 53–65. [Google Scholar] [CrossRef] [PubMed]
- Kwan, P.; Schachter, S.C.; Brodie, M.J. Drug-resistant epilepsy. N Engl. J. Med. 2011, 365(10), 919–26. [Google Scholar] [CrossRef] [PubMed]
- Purnell, B.S.; et al. Commonalities in gene expression and methylation changes across two rat models of acquired epilepsy. Sci. Rep. 2026, 16(1), 5095. [Google Scholar] [CrossRef] [PubMed]
- Shen, H.Y.; et al. Sarcosine Suppresses Epileptogenesis in Rats With Effects on Hippocampal DNA Methylation. Front Mol. Neurosci. 2020, 13, 97. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.Y.; et al. Effects of sarcosine and N, N-dimethylglycine on NMDA receptor-mediated excitatory field potentials. J. BioMed Sci. 2017, 24(1), 18. [Google Scholar] [CrossRef] [PubMed]
- Racine, R. Kindling: the first decade. Neurosurgery 1978, 3(2), 234–52. [Google Scholar] [CrossRef] [PubMed]
- Carbone, L.; et al. Synergistic Effects of Hyperandrogenemia and Obesogenic Western-style Diet on Transcription and DNA Methylation in Visceral Adipose Tissue of Nonhuman Primates. Sci. Rep. 2019, 9(1), 19232. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.Y.; et al. HDAC8-Selective Inhibition by PCI-34051 Enhances the Anticancer Effects of ACY-241 in Ovarian Cancer Cells. Int. J. Mol. Sci. 2022, 23(15). [Google Scholar] [CrossRef] [PubMed]
- Citraro, R.; et al. Perampanel effects in the WAG/Rij rat model of epileptogenesis, absence epilepsy, and comorbid depressive-like behavior. Epilepsia 2017, 58(2), 231–238. [Google Scholar] [PubMed]
- de Nijs, L.; et al. DNA methyltransferase isoforms expression in the temporal lobe of epilepsy patients with a history of febrile seizures. Clin. Epigenet. 2019, 11(1), 118. [Google Scholar] [CrossRef]
- Dragunow, M.; Robertson, H.A. Kindling stimulation induces c-fos protein(s) in granule cells of the rat dentate gyrus. Nature 1987, 329(6138), 441–2. [Google Scholar] [CrossRef] [PubMed]
- Morgan, J.I.; et al. Mapping patterns of c-fos expression in the central nervous system after seizure. Science 1987, 237(4811), 192–7. [Google Scholar] [CrossRef] [PubMed]
- Cacheaux, L.P.; et al. Transcriptome profiling reveals TGF-beta signaling involvement in epileptogenesis. J. Neurosci. 2009, 29(28), 8927–35. [Google Scholar] [CrossRef] [PubMed]
- Bortoletto, R.; et al. Is It Time to Test the Antiseizure Potential of Palmitoylethanolamide in Human Studies? A Systematic Review of Preclinical Evidence. Brain Sci. 2022, 12(1). [Google Scholar] [CrossRef] [PubMed]
- Coulter, D.A.; Steinhauser, C. Role of astrocytes in epilepsy. Cold Spring Harb. Perspect. Med. 2015, 5(3), a022434. [Google Scholar] [CrossRef] [PubMed]
- Bronisz, E.; Kurkowska-Jastrzebska, I. Matrix Metalloproteinase 9 in Epilepsy: The Role of Neuroinflammation in Seizure Development. In Mediators Inflamm; 2016; p. 7369020. [Google Scholar]
- Maroso, M.; et al. Toll-like receptor 4 and high-mobility group box-1 are involved in ictogenesis and can be targeted to reduce seizures. Nat. Med. 2010, 16(4), 413–9. [Google Scholar] [CrossRef] [PubMed]
- Ben-Ari, Y.; Holmes, G.L. Effects of seizures on developmental processes in the immature brain. Lancet Neurol. 2006, 5(12), 1055–63. [Google Scholar] [CrossRef] [PubMed]
- Dudek, F.E.; Sutula, T.P. Epileptogenesis in the dentate gyrus: a critical perspective. Prog. Brain Res. 2007, 163, 755–73. [Google Scholar] [CrossRef] [PubMed]
- Kahle, K.T.; Staley, K.J. The bumetanide-sensitive Na-K-2Cl cotransporter NKCC1 as a potential target of a novel mechanism-based treatment strategy for neonatal seizures. Neurosurg. Focus 2008, 25(3), E22. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Z.F.; et al. Knockdown of SIK3 in the CA1 Region can Reduce Seizure Susceptibility in Mice by Inhibiting Decreases in GABA(A)R alpha1 Expression. Mol. Neurobiol. 2024, 61(3), 1404–1416. [Google Scholar] [PubMed]
- Broekaart, D.W.; et al. The matrix metalloproteinase inhibitor IPR-179 has antiseizure and antiepileptogenic effects. J. Clin. Invest 2021, 131(1). [Google Scholar] [CrossRef] [PubMed]
- Chaunsali, L.; Tewari, B.P.; Sontheimer, H. Perineuronal Net Dynamics in the Pathophysiology of Epilepsy. Epilepsy Curr. 2021, 21(4), 273–281. [Google Scholar] [CrossRef] [PubMed]
- Lensjo, K.K.; et al. Differential Expression and Cell-Type Specificity of Perineuronal Nets in Hippocampus, Medial Entorhinal Cortex, and Visual Cortex Examined in the Rat and Mouse. eNeuro 2017, 4(3). [Google Scholar] [CrossRef] [PubMed]
- Kobow, K.; et al. Deep sequencing reveals increased DNA methylation in chronic rat epilepsy. Acta Neuropathol. 2013, 126(5), 741–56. [Google Scholar] [CrossRef] [PubMed]
- Gapinska, N.; et al. Effect of SSR504734, a Selective Glycine Transporter Type 1 Inhibitor, on Seizure Thresholds, Neurotransmitter Levels, and Inflammatory Markers in Mice. ACS Chem. Neurosci. 2025, 16(6), 1210–1226. [Google Scholar] [CrossRef] [PubMed]






| Gene | Forward Primer (5’-3’) | Reverse Primer (5’-3’) |
|---|---|---|
| Antxr2 | cgccaattaagggtcgtctg | cgggagaagtttatgcaccg |
| Cacna2d2 | gcgaggtaaacaacgaggac | cactgaagaacctgccaacc |
| Dzip1 | ttccacccgaagaagtaccc | tttcttgagttttggggcgg |
| Fos | tgcaagatccccaatgacct | tgagaagaggcagggtgaag |
| Gpr37l1 | agcagtgtgagagtcagctt | tgttgcagacgttttcaggg |
| Grik2 | actcaggtttgctggatgga | cagggtttgtgtcgattgca |
| Hdac9 | tgtgaatacgaatgcagccg | cttgcaacagccaccatctt |
| Smad7 | ggcttcaccgtgcagattag | tgaagatgacctccagccag |
| Spock2 | actgtgatgacatcgtgggt | ccagatgtagcctccgtcat |
| Unc5a | aagaaggaagggctggactc | ctggtaggtggtagtggtgg |
| Yy1 | gcaagaagagttacctgggc | acctgcttctgttcccactt |
| Gapdh | ggatactgagagcaagagaga | ttatggggtctgggatggaa |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).