Submitted:
09 July 2026
Posted:
13 July 2026
You are already at the latest version
Abstract
Enterococcus faecalis and Enterococcus faecium are commensal bacteria of poultry but also important opportunistic pathogens and key indicators for antimicrobial resistance (AMR) surveillance within a One Health framework. However, data on the presence and resistance of enterococci in breeding hens remain limited despite their critical role in the poultry production pyramid. This study evaluated the prevalence, antimicrobial resistance profiles, and resistance genes of E. faecalis and E. faecium isolated from two commercial breeding hen farms in eastern Spain. A total of 330 isolates were obtained from different production stages and sample types. Species identification was performed by multiplex PCR, antimicrobial susceptibility was assessed using disk diffusion according to CLSI guidelines, and resistance genes (erm and tet) were detected by PCR. A significant age-related shift from E. faecalis in early stages to E. faecium in adult hens was observed. High resistance rates were detected for tetracycline (up to 95.2%) and erythromycin, whereas resistance to critically important antimicrobials such as vancomycin, aminoglycosides, and ampicillin was rare or absent. Significant differences between farms were identified, with higher resistance levels and multidrug resistance for both farms. The most prevalent resistance genes were ermB, tetL, and tetM, frequently co-occurring. This study shows that breeding hens constitute a relevant reservoir of AMR within poultry production systems. Species dynamics and resistance patterns appear to be strongly influenced by age and farm-related factors. These findings highlight the need for continuous AMR surveillance integrating phenotypic and genotypic approaches under a One Health perspective.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Isolation and Identification of Enterococcus spp.
2.3. Antimicrobial Susceptibility Testing
2.4. Molecular Analysis
2.5. Statistical Analysis
3. Results
3.1. Isolation of Enterococcus spp.
3.2. Antimicrobial Resistance
3.3. Antimicrobial Resistance Profiles of Isolates
3.4. Antibiotic Resistance Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- European Food Safety Authority; European Centre for Disease Prevention and Control. The European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2022–2023. EFSA J. 2025, 23, e9237. [Google Scholar] [CrossRef]
- García-Solache, M.; Rice, L.B. The Enterococcus: a model of adaptability to its environment. Clin. Microbiol. Rev. 2019, 32, e00058-18. [Google Scholar] [CrossRef] [PubMed]
- Arias, C.A.; Murray, B.E. The rise of the Enterococcus: beyond vancomycin resistance. Nat. Rev. Microbiol. 2012, 10, 266–278. [Google Scholar] [CrossRef] [PubMed]
- Reynolds, D.L.; Hille, M.M.; Jia, B. Review of Enterococcus faecalis infections of poultry. Avian Dis. 2025, 68, 412–420. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Llorens, J.; Monroy, I.; Torres-Boncompte, J.; Soriano, J.M.; Catalá-Gregori, P.; Sevilla-Navarro, S. Tracking the prevalence of antibiotic resistance in Enterococcus within the Spanish poultry industry: insights from a One Health approach. Antibiotics 2024, 14, 16. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.B.; Seo, K.W.; Jeon, H.Y.; Lim, S.K.; Sung, H.W.; Lee, Y.J. Molecular characterization of erythromycin and tetracycline-resistant Enterococcus faecalis isolated from retail chicken meats. Poult. Sci. 2019, 98, 977–983. [Google Scholar] [CrossRef] [PubMed]
- Osei-Akoto, A.; Abdel-Wareth, A.A.A.; Salahuddin, M.; Goswami, P.K.; Lohakare, J. Sustainable poultry production through novel nutrition and circular resource management. Sustainability 2026, 18, 3673. [Google Scholar] [CrossRef]
- Zaidi, S.E.Z.; Zaheer, R.; Poulin-Laprade, D.; et al. Comparative genomic analysis of Enterococcus across the One Health continuum. Microorganisms 2023, 11, 727. [Google Scholar] [CrossRef] [PubMed]
- Waliaula, P.K.; Kiarie, E.G.; Diarra, M.S. Predisposition factors and control strategies in laying hens: implications for gut microbiota and health. Front. Vet. Sci. 2024, 11, 1474549. [Google Scholar] [CrossRef] [PubMed]
- World Organisation for Animal Health. Tackling antimicrobial resistance using the One Health approach. Available online: https://www.woah.org (accessed on 18 June 2026).
- Sana, S.S.; Atuahene, D.; Nagy, V.; Shaikh, A.M.; Knop, R. The rising threat of antibiotic resistance in poultry: veterinary and One Health perspectives. Vet. Sci. 2025, 12, 1059. [Google Scholar] [CrossRef] [PubMed]
- Rivera-Gomis, J.; Marín, P.; Martínez-Conesa, C.; Otal, J.; Jordán, M.J.; Escudero, E. Antimicrobial resistance in commensal bacteria from laying hen farms in Spain. Animals 2021, 11, 1284. [Google Scholar] [CrossRef] [PubMed]
- Mudenda, S.; Matafwali, S.K.; Malama, S.; Munyeme, M.; Yamba, K.; Muma, J.B. Prevalence and antimicrobial resistance patterns of Enterococcus species isolated from laying hens: a call for AMR surveillance. JAC Antimicrob. Resist. 2022, 4, dlac126. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Belenguer, A.; Doménech, E.; Villagrá, A.; Fenollar, A.; Ferrús, M.A. Antimicrobial resistance of Escherichia coli isolated in newly-hatched chickens and effect of amoxicillin treatment during their growth. Avian Pathol. 2016, 45, 501–507. [Google Scholar] [CrossRef] [PubMed]
- Jesus, R.; Quinteira, S.; Ribeiro, V.; Dantas, R.; Freitas, A.R.; Brito, N.V.; Miranda, C. Silent reservoirs: antibiotic-resistant Escherichia coli in Autochtonous Portuguese laying hens. Pathogens 2026, 15, 163. [Google Scholar] [CrossRef] [PubMed]
- European Commission. National Control Programmes for Salmonella. in Poultry Flocks, Implemented under Regulation (EC) No 2160/2003. Available online: https://hadea.ec.europa.eu/system/files/2022-03/Salmonella_Broiler%20flocks%20of%20Gallus%20Gallus_Spain.pdf (accessed on 21 June 2026).
- Depardieu, F.; Perichon, B.; Courvalin, P. Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR. J. Clin. Microbiol. 2004, 42, 5857–5860. [Google Scholar] [CrossRef] [PubMed]
- CLSI; Clinical and Laboratory Standards Institute. CLSI Supplement M100-S25Performance Standards for Antimicrobial Susceptibility Testing, 25th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2015. [Google Scholar]
- European Food Safety Authority. Report from the Task Force on Zoonoses Data Collection including guidance for harmonized monitoring and reporting of antimicrobial resistance in commensal Escherichia coli and Enterococcus spp. from food animals. EFSA J. 2008, 141, 1–44. [Google Scholar] [CrossRef]
- Khan, A.; Miller, W.R.; Axell-House, D.; Munita, J.M.; Arias, C.A. Antimicrobial susceptibility testing for enterococci. J. Clin. Microbiol. 2022, 60, e00843-21. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Yu, Z.; Michel, F.C.; Wittum, T.; Morrisonet, M. Development and application of real-time PCR assays for quantification of erm genes conferring resistance to Macrolides-Lincosamides-Streptogramin B in livestock manure and manure management systems. Appl. Environ. Microbiol. 2007, 73, 4407–4416. [Google Scholar] [CrossRef] [PubMed]
- Ng, L.K.; Martin, I.; Alfa, M.; Mulvey, M. Multiplex PCR for the detection of tetracycline resistant genes. Mol. Cell. Probes 2001, 15, 209–215. [Google Scholar] [CrossRef] [PubMed]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Harbarth, S.; Hindler, J.F.; Kahlmeter, G.; Olsson-Liljequist, B.; Paterson, D.L.; Rice, L.B.; Stelling, J.; Struelens, M.J.; Vatopoulos, A.; Weber, J.T.; Monnet, D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.R.; Arias, C.A. ESKAPE pathogens: antimicrobial resistance, epidemiology, clinical impact and therapeutics. Nat. Rev. Microbiol. 2024, 22, 598–616. [Google Scholar] [CrossRef] [PubMed]
- Wei, Y.; Palacios Araya, D.; Palmer, K.L. Enterococcus faecium: evolution, adaptation, pathogenesis and emerging therapeutics. Nat. Rev. Microbiol. 2024, 22, 705–721. [Google Scholar] [CrossRef] [PubMed]
- Johnson, C.N.; Sheriff, E.K.; Duerkop, B.A.; Chatterjee, A. Impact of mobile genetic elements on enterococcal adaptation and evolution. J. Bacteriol. 2021, 203, e00177-21. [Google Scholar] [CrossRef] [PubMed]
- de Jong, A.; Simjee, S.; Rose, M.; Moyaert, H.; El Garch, F.; Youala, M. Antimicrobial resistance monitoring in commensal enterococci from healthy cattle, pigs and chickens across Europe during 2004–14: EASSA Study. J. Antimicrob. Chemother. 2019, 74, 921–930. [Google Scholar] [CrossRef] [PubMed]
- EFSA Panel on Animal Health and Welfare; Nielsen, S.S.; Bicout, D.J.; Calistri, P.; Canali, E.; Drewe, J.A.; Garin-Bastuji, B.; Gonzales Rojas, J.L.; Gortázar, C.; Herskin, M.; Michel, V.; Miranda Chueca, M.Á.; Padalino, B.; Pasquali, P.; Roberts, H.C.; Spoolder, H.; Ståhl, K.; Velarde, A.; Viltrop, A.; Winckler, C.; Baldinelli, F.; Broglia, A.; Kohnle, L.; Alvarez, J. Assessment of listing and categorisation of animal diseases within the framework of the Animal Health Law: antimicrobial-resistant Enterococcus cecorum in poultry. EFSA J. 2022, 20, e07126. [Google Scholar] [CrossRef] [PubMed]
- Bortolaia, V.; Espinosa-Gongora, C.; Guardabassi, L. Human health risks associated with antimicrobial-resistant enterococci and Staphylococcus aureus on poultry meat. Clin. Microbiol. Infect. 2016, 22, 130–140. [Google Scholar] [CrossRef] [PubMed]
- Nowakiewicz, A.; Ziółkowska, G.; Trościańczyk, A.; Zięba, P.; Gnat, S. Determination of resistance and virulence genes in Enterococcus faecalis and E. faecium strains isolated from poultry and their genotypic characterization by ADSRRS-fingerprinting. Poult. Sci. 2017, 96, 986–996. [Google Scholar] [CrossRef] [PubMed]
- Stępień-Pyśniak, D.; Hauschild, T.; Dec, M.; Marek, A.; Brzeski, M.; Kosikowska, U. Antimicrobial resistance and genetic diversity of Enterococcus faecalis from yolk sac infections in broiler chicks. Poult. Sci. 2021, 100, 101491. [Google Scholar] [CrossRef] [PubMed]
- Hume, M.E.; Donskey, C.J. Effect of vancomycin, tylosin, and chlortetracycline on vancomycin-resistant Enterococcus faecium colonization of broiler chickens during grow-out. Foodborne Pathog. Dis. 2017, 14, 231–237. [Google Scholar] [CrossRef] [PubMed]
- Schmidt, J.W.; Vikram, A.; Miller, E.; Jones, S.A.; Arthur, T.M. In-feed tylosin phosphate administration to feedlot cattle minimally affects antimicrobial resistance. J. Food Prot. 2020, 83, 350–364. [Google Scholar] [CrossRef] [PubMed]
- Maasjost, J.; Mühldorfer, K.; Cortez de Jäckel, S.; Hafez, H.M. Antimicrobial susceptibility patterns of Enterococcus faecalis and Enterococcus faecium isolated from poultry flocks in Germany. Avian Dis. 2015, 59, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Idress, M.; Khan, P.; Khan, A.; Khan, S.; Waqas, M.; Kamran, M.; Khan, Z.A. Veterinary antibiotics and antibiotic resistance genes in agroecosystems: occurrence, environmental fate, risks, and remediation strategies. Environ. Sci. Pollut. Res. Int. 2026, 33, 6879–6893. [Google Scholar] [CrossRef] [PubMed]
- Kerek, Á.; Tornyos, G.; Radnai, L.; Kaszab, E.; Bali, K.; Jerzsele, Á. Integrated phenotypic and genomic profiling of antimicrobial resistance and virulence-associated determinants in poultry-derived Enterococcus spp. from Hungary. Vet. Sci. 2026, 13, 187. [Google Scholar] [CrossRef] [PubMed]
- Mechoub, D.; Dhaouadi, S.; Meguenni, N.; Fatnassi, N.; Akkou, M.; Marañón-Clemente, I.; Torres, C.; Boubaker-Elandoulsi, R.; Titouche, Y. First comprehensive molecular and phenotypic insights into multidrug resistance and virulence in poultry-associated Enterococcus spp. in Algeria. Mol. Biol. Rep. 2026, 53, 497. [Google Scholar] [CrossRef] [PubMed]
- Lu, Z.; McInnes, R.S.; Allen, F.; Gadar, K.; van Schaik, W. Resistance to last-resort antibiotics in enterococci. FEMS Microbiol. Rev. 2025, 49, fuaf057. [Google Scholar] [CrossRef] [PubMed]
- Nilsson, O.; Börjesson, S.; Landén, A.; Bengtsson, B. Vertical transmission of Escherichia coli carrying plasmid-mediated AmpC through the broiler production pyramid. J. Antimicrob. Chemother. 2014, 69, 1497–1500. [Google Scholar] [CrossRef] [PubMed]
- Baron, S.; Jouy, E.; Larvor, E.; Eono, F.; Bougeard, S.; Kempf, I. Impact of third-generation-cephalosporin administration in hatcheries on fecal Escherichia coli antimicrobial resistance in broilers and layers. Antimicrob. Agents Chemother. 2014, 58. [Google Scholar] [CrossRef] [PubMed]
- Sodagari, H.R.; Varga, C.; Habib, I.; Sahibzada, S. Comparison of antimicrobial resistance among commensal Escherichia coli isolated from retail table eggs produced by laying hens from the cage and non-cage housing systems in Western Australia. Antibiotics 2023, 12, 588. [Google Scholar] [CrossRef] [PubMed]
| Primers | Specie | Sequence | Primers concentration | Size (bp) | Reference |
|---|---|---|---|---|---|
| DD13(+) | E. faecalis | CACCTGAAGAAACAGGC | 0,4µM | 475 | (Depardieu, et al., 2004) |
| DD3-2(-) | ATGGCTACTTCAATTTCACG | 0,4µM | |||
| FAC1-1(+) | E. faecium | GAGTAAATCACTGAACGA | 0,4µM | 1091 | |
| FAC2-1(-) | CGCTGATGGTATCGATTCAT | 0,4µM |
| Primers | Sequence | Primer concentration | Size (bp) | Reference |
|---|---|---|---|---|
| erm(A)-106f | GAA ATY GGR TCA GGA AAA GG | 0,5μM | 332 | (Chen, et al., 2007) |
| erm(A)-437r | AAY AGY AAA CCY AAA GCT C | 0,5μM | ||
| erm(B)-91f | GAT ACC GTT TAC GAA ATT GG | 0,5μM | 364 | |
| erm(B)-454r | GAA TCG AGA CTT GAG TGT GC | 0,5μM | ||
| tetK-f | TCG ATA GGA ACA GCA GTA | 1,25µM | 169 | (Warsa, et al., 1996) |
| tetK-r | CAG CAG ATC CTA CTC CTT | 1,25µM | ||
| tetM-f | GTG GAC AAA GGT ACA ACG AG | 0,5µM | 406 | |
| tetM-r | CGG TAA AGT TCG TCA CAC AC | 0, µM | ||
| tetL-f | TCG TTA GCG TGC TGT CAT TC | 1µM | 267 | (Ng, et al., 2001) |
| tetL-r | GTA TCC CAC CAA TGT AGC CG | 1µM | ||
| tetO-f | AAC TTA GGC ATT CTG GCT CAC | 1,25µM | 515 | |
| tetO-r | TCC CAC TGT TCC ATA TCG TCA | 1,25µM | ||
| tetS-f | CAT AGA CAA GCC GTT GAC C | 0,5µM | 667 | |
| tetS-r | ATG TTT TTG GAA CGC CAG AG | 0,5µM |
| Farm | Species | Antibiotic | ||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| E | AMP | CIP | VA | C | CN | S | TE | QD | ||
| A |
E. faecalis (47) |
59,6% | 0% | 59,6% | 0% | 59,6% | 0% | 0% | 78,7% | - |
| (28) | (0) | (28) | (0) | (28) | (0) | (0) | (37) | - | ||
|
E. faecium (103) |
58,3% | 1,0% | 5,8% | 0% | 0% | 0% | 0% | 95,2% | 6,8% | |
| (60) | (1) | (6) | (0) | (0) | (0) | (0) | (98) | (7) | ||
| B |
E. faecalis (20) |
10% | 0% | 0% | 0% | 0% | 0% | 0% | 65% | - |
| (2) | (0) | (0) | (0) | (0) | (0) | (0) | 13 | - | ||
|
E. faecium (160) |
16,9% | 0% | 0,6% | 0% | 0% | 0% | 0% | 86,9% | 0,6% | |
| (27) | (0) | (1) | (0) | (0) | (0) | (0) | (139) | (1) | ||
| Farm A | Farm B | |||
|---|---|---|---|---|
| Profile | E. faecalis (47) | E. faecium (103) | E. faecalis (20) | E. faecium (160) |
| E | - | 1% (1) | - | 0,7% (1) |
| TE | 24,3% (9) | 40% (40) | 84,6% (11) | 80,7% (113) |
| E-TE | - | 45% (45) | 15,5% (2) | 17,1% (24) |
| E-AMP | - | 1% (1) | - | - |
| E-QD-TE | - | 7% (7) | - | 0,7% (1) |
| E-TE-CIP | - | 6% (6) | - | 0,7% (1) |
| E-TE-C-CIP | 75,7% (28) | - | - | - |
| Farm | Species | ermA | ermB | tetK | tetL | tetM | tetO | tetS |
|---|---|---|---|---|---|---|---|---|
| Farm A |
E. faecalis (28) |
100% (28) | 100% (28) |
7.1% (2) |
100% (28) |
100% (28) |
0% (0) |
0% (0) |
|
E. faecium (53) |
5.2% (3) | 94.8% (55) |
86.2% (50) | 91.4% (53) |
94.8% (55) | 0% (0) |
1.7% (1) |
|
| Farm B |
E. faecalis (2) |
0% (0) | 100% (2) |
50% (1) |
50% (1) |
50% (1) |
50% (1) |
0% (0) |
|
E. faecium (26) |
0% (0) | 34.6% (9) |
84.6% (22) | 88.5% (23) |
69.2% (18) | 0% (0) |
0% (0) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).