Cardiomyocyte-Specific Bcl11b Knockout Causes Left Ventricular Noncompaction by Dysregulating Pou3f2 and Titin

Wei Bi; Xiaoxi Luo; Yaqi Lv; Lifeng Liu; Youshi Chen; Chenxi Li; Jiani Fu; Shijia Hu; Jianfeng Wang; Xing Chang; Hongjun Shi

doi:10.20944/preprints202606.1044.v1

Submitted:

11 June 2026

Posted:

12 June 2026

You are already at the latest version

Abstract

Left ventricular noncompaction (LVNC) is a cardiomyopathy characterized by excessive trabeculation and deep intertrabecular recesses, yet its molecular mechanisms remain poorly understood. Here, we identify Bcl11b as a novel regulator of cardiomyocyte (CM) growth and ventricular wall maturation. CM-specific deletion of Bcl11b in mice recapitulates key LVNC features, including increased noncompact-ed-to-compacted ratio, impaired compact layer expansion, reduced CM proliferation and size, and systolic dysfunction. Mechanistically, Bcl11b deficiency leads to marked upregulation of Pou3f2, a transcriptional repressor that further suppresses Titin (TTN) expression. Loss of Bcl11b disrupts sarcomere integrity and reduces TTN protein levels, while forced Pou3f2 overexpression similarly represses TTN. Notably, heterozygous loss of Pou3f2 rescues the LVNC phenotype in Bcl11b-deficient hearts, restoring CM growth and TTN expression. Our findings establish a critical relationship among Bcl11b, Pou3f2 and TTN that governs CM proliferation and hypertrophic maturation during cardiac development. Dysregulation of this regulatory network impairs ventricular compaction and contributes to the development of LVNC, providing new insights into disease pathogenesis and potential therapeutic targets.

Keywords:

Bcl11b

;

LVNC

;

Pou3f2

;

Titin

Subject:

Biology and Life Sciences - Cell and Developmental Biology

1. Introduction

Left ventricular noncompaction (LVNC) is a cardiomyopathy defined by excessive trabeculation and deep intertrabecular recesses within the ventricular wall [1,2]. It ranks as the third most common cardiomyopathy, with an estimated prevalence of 0.01–0.3% in adults and up to 9.2% among children diagnosed with cardiomyopathies [3,4]. The clinical presentation varies widely, from asymptomatic individuals to those suffering from progressive heart failure, life-threatening arrhythmias, thromboembolic events, and sudden cardiac death. Despite growing recognition of LVNC as a distinct clinical entity, the molecular pathways driving its pathogenesis remain poorly understood.

Ventricular trabeculation and compaction are fundamental morphogenetic processes that shape the ventricular walls during heart development. Trabeculation begins when the ventricular chambers balloon outward from the primitive heart tube, with cardiomyocytes (CMs) forming a complex meshwork of finger-like projections into the lumen [5,6]. This sponge-like network provides essential mechanical strength to the developing ventricular wall before the establishment of coronary circulation. Subsequently, the compact layer undergoes substantial proliferative expansion, gradually thickening and integrating with the adjacent trabecular meshwork to form a mature, robust ventricular wall [7]. Failure of proper compact layer growth, or conversely excessive trabecular proliferation, can lead to LVNC [8]. Reciprocal signals between endocardium and myocardium orchestrate these events. Notably, NOTCH and NRG signaling have been identified to be the master regulators of trabecular formation by controlling ECM degradation and synthesis that are critical for trabecular rearrangement and growth [6]. Mouse models with disrupted Notch/Nrg signaling, including Mib1, Fkbp1a, and Nkx2-5 mutants, recapitulate LVNC features such as hypertrabeculation, reduced compaction, and systolic dysfunction [9,10,11,12].

Despite these insights, Notch/Nrg pathway mutations are rarely found in LVNC patients, suggesting other mechanisms predominate [13]. More than 40 genes have been linked to LVNC, with mutations in sarcomere genes, particularly MYH7, MYBPC3, ACTC1, and Titin (TTN), accounting for over 40% of identified variants; these mutations are also frequently associated with dilated cardiomyopathy (DCM) and hypertrophic cardiomyopathy (HCM) phenotypes [14,15]. Truncating TTN variants (TTNtv) are among the most frequent genetic causes, underscoring titin’s essential role in ventricular integrity [16]. Homozygous deletion of TTN in mice caused embryonic lethality while heterozygous TTNtv mice showed normal cardiac function [17]. Patient-mimicking mutants generally fail to display classic LVNC. Instead, they develop dilated cardiomyopathy-like features dominated by progressive systolic dysfunction without striking trabecular abnormalities [17]. This phenotypic divergence has greatly hindered mechanistic understanding of TTN-mediated LVNC.

In this study, we identify Bcl11b as a novel regulator of CM gene expression and CM growth. Loss of Bcl11b function upregulates Pou3f2 and reduces TTN expression, thereby recapitulating key LVNC features, including excessive trabeculation, deep recesses, and impaired contractility. These findings provide new insights into the molecular mechanisms by which Bcl11b and its downstream targets, Pou3f2 and TTN, regulate cardiac development and contribute to congenital heart disease (CHD).

2. Results

2.1. CM-Specific Knockout Bcl11b Causes LVNC During Heart Development

During mouse heart development, Bcl11b expression peaks at E12.5 and then declined sharply after birth in left ventricles (Figure 1A), suggesting a critical role during the embryonic stage. In the left ventricle, Bcl11b was mainly expressed by CMs (Figure 1B-C) and located in CM nuclei (Figure A1A). To investigate the function of Bcl11b in heart development, we generated CM-specific conditional knockout mice by crossing Bcl11b^f/f mice with Nkx2.5-Cre, Nfatc1-Cre and cTnT-Cre lines to ablate Bcl11b specifically in cardiac progenitor cells [18], endocardial derived cells [19] and CMs [20], respectively. At E18.5, Nfatc1-Cre; Bcl11b^f/f mice did not exhibit any obvious heart defects. In contract, Nkx2.5-Cre; Bcl11b^f/f mice and cTnT-Cre; Bcl11b^f/f mice displayed a comparable 50% incidence of cardiac defects, with the LVNC being the predominate phenotype (Figure 1D and A1B-C). Both cTnT-Cre; Bcl11b^f/f (CM-KO) and cTnT-Cre; Bcl11b^f/+ (CM-KD) mice display elevated non-compaction to compaction ratio (NC/C) compared to wildtype littermates, with more severe elevation observed in homozygous mutants (Figure 1E). Further histological analysis revealed slower expansion of compact layer from E14.5 contributed the major part to the increased NC/C ratio in hypertrabeculated ventricles of cTnT-Cre; Bcl11b^f/f mice at E18.5 (Figure 1F).

A proportion of the Nkx2.5-Cre; Bcl11b^f/f mice and cTnT-Cre; Bcl11b^f/f mice died within 3 days after birth. Statistical analysis showed that the proportion of the survived Nkx2.5-Cre knockout mice at postnatal day 3 deviated from Mendelian expectations, whereas that the cTnT-Cre knockouts did not (Figure A1D). These results indicate that, in addition to inducing LVNC when deleted in CMs, Bcl11b is also essential in non-CM derivatives of the Nkx2.5 lineage, and its deletion in these cells can be partially lethal.

The surviving cTnT-Cre; Bcl11b^f/f mice exhibited a significant reduction in heart weight (HW), tibia length (TL), and the HW/TL ratio compared with controls at P21 (Figure A2A-D). Importantly, WGA staining of myocardial tissues revealed a marked decrease in CM size in these knockout mice (Figure A2A, E), indicating that deletion of Bcl11b in CMs leads to impaired growth and developmental delay. Further echocardiographic analysis showed decreased systolic function accompanied by ventricular wall thinning (Figure A2F-P). Taken together, these findings suggest that Bcl11b is an essential transcription factor for CMs during heart development and its deletion in CMs (cTnT-Cre; Bcl11b^f/f) leads to noncompaction cardiomyopathy and impaired systolic function.

2.2. Absence of Bcl11b Disrupts CM Proliferation and Physiological Hypertrophy

Precise spatiotemporal regulation of CM proliferation and hypertrophic growth/maturation is essential for proper cardiac development [7,21] and disruption of these processes leads to cardiac pathologies, including LVNC [9,22]. We therefore examined the impact of Bcl111b deletion on these cellular events. As shown in Figure 2A, the proportion of proliferative phospho-histone H3 (PH3) positive CMs was significantly reduced in CM-KO hearts. Furthermore, cardiomyocyte sizes as revealed by wheat germ agglutinin (WGA) staining were significantly reduced in CM-KO hearts (Figure 2B). No significant difference in apoptotic rates was observed between CM-KO and control hearts (Figure 2C).

Collectively, these findings indicate that cardiomyocyte-specific deletion of Bcl11b impairs CM growth rather than survival, thereby contributing to myocardial noncompaction.

2.3. Bcl11b Suppresses Pou3f2 Expression in the CMs

Bcl11b functions as transcriptional factor that regulates diverse cellular processes through gene activation or repression during development and diseases [23,24]. To elucidate the molecular mechanisms by which Bcl11b contributes to LVNC, we performed bulk RNA sequencing of left ventricular tissues from CM-KO and Bcl11b^f/f littermate control mice at E16.5. Differential expression analysis identified 1128 upregulated genes and 1260 downregulated genes in CM-KO ventricles compared with controls (Figure 3A).

Among the most significantly dysregulated genes, Pou3f2 emerged as a top candidates following Bcl11b ablation. In parallel, TTN, a gene implicated in LVNC pathogenesis in both humans and mice [25], was markedly downregulated. These expression changes were further validated by qRT–PCR (Figure 3B-D). Notably, although several kinase signaling pathways involved in CM development, including Akt, Erk1/2, and YAP, as well as previously reported downstream targets of Bcl11b, such as PKA and PKG, have been implicated in cardiac biology [26,27,28], none of these pathways was significantly altered following CM-specific deletion of Bcl11b (Figure 3E, F). In contrast, Pou3f2 protein was robustly upregulated (Figure 3E, F), accompanied by a pronounced reduction in TTN protein expression (Figure 3G, H). Based on these findings, we propose that a Bcl11b-Pou3f2-TTN regulatory network might underlie the development of LVNC in this model.

2.4. Dysregulated Pou3f2 Impairs TTN Expression and Sarcomere Integrity

Pou3f2 is a transcriptional regulator [29]. To determine whether Pou3f2 regulates TTN expression, we performed IF staining for Pou3f2 and TTN. In CM-KO hearts, nuclear Pou3f2 expression was markedly increased than in Bcl11b^f/f controls (Figure 4A). Consistently, the proportion of sarcomeric TTN staining in compact layer at E16.5 was significantly reduced in CM-KO hearts compared with controls (Figure 4B). Moreover, the intensity of TTN filaments was markedly disrupted following Bcl11b knockdown in isolated CMs (Figure 4C), indicating impaired sarcomere integrity. In vitro, following siRNA transfection, Pou3f2 expression was significantly upregulated in the siRNA-Bcl11b group compared with the NC group (Figure A3A). Furthermore, IF analysis showed increased nuclear Pou3f2 expression accompanied by loss of TTN integrity in the siRNA-Bcl11b group compared with the NC group (Figure A3B–C).

To further define the functional role of Pou3f2, we overexpressed murine Pou3f2 in wild-type mouse hearts using adeno-associated virus serotype 9 (AAV9). Western blot analysis showed that Pou3f2 protein levels in ventricular tissues of wild type (WT) hearts were markedly increased following AAV9 infection in a dose-dependent manner (Figure 4D). TTN protein levels were significantly reduced 4 days after AAV9-cTnT-Pou3f2 injection compared with controls (AAV9-cTnT-NC) (Figure 4E). Thus Pou3f2 represses TTN expression, potentially leading to LVNC.

2.5. Loss of Pou3f2 Rescues the LVNC Phenotype in Bcl11b-Deficient Mice

To further test the Bcl11b-Pou3f2-TTN regulatory network underlying LVNC development, we generated Pou3f2^-/- mice using crisper-cas9-midiated genome editing and crossed them with CM-KD mice. Western blot analysis showed that Pou3f2 protein levels in ventricular tissues of E16.5 hearts were significantly decreased in offspring Pou3f2^+/-; CM-KO than Pou3f2^+/+; CM-KO mice (Figure 5A). Light-sheet imaging of cardiac morphology at E18.5 revealed that Pou3f2 heterozygous null efficiently rescued the incidence of LVNC in Bcl11b-deficient hearts (Figure 5B). IF staining for PH3 (Figure 5C) and WGA (Figure 5D) at E16.5 further confirmed that Pou3f2 loss restored CM growth that were reduced following Bcl11b deletion.

In vitro, we transfected Pou3f2 siRNA into isolated neonatal mice CMs (NMCMs) derived from CM-KO and Bcl11b^f/f mice. Knockdown of Pou3f2 markedly suppressed the elevated Pou3f2 expression observed in Bcl11b-deficient NMCMs (Figure 5E) and restored sarcomere TTN levels (Figure 5F). Consistently, co-transfection of Pou3f2 siRNA with or without Bcl11b siRNA produced comparable rescue effects (Figure A4), further supports a functional interaction between Bcl11b and Pou3f2 and their regulatory role on TTN expression and impairment on ventricular compaction.

3. Discussion

A major conclusion from this work is that blocking Bcl11b-Pou3f2-TTN network during heart development impairs CM growth and causes LVNC. We show that a cardiac Bcl11b maintains formation of compaction layer during embryogenesis. Bcl11b functions, at least in part, by repressing expression of Pou3f2. The absence of Bcl11b in mice and NMCMs leads to the up-regulation of Pou3f2 in nucleus, which efficiently inhibit expression of TTN. The disruption of Bcl11b-Pou3f2-TTN pattern leads to the reduction of CM number and size during embryonic heart development.

LVNC is characterized by excessive growth of the trabecular layer or thinning of the compaction layer. Although genetic screening of LVNC patients has identified numerous gene mutations [30,31,32], the molecular and cellular mechanisms underlying the disorganization between ventricular trabeculation and compaction in LVNC remain poorly understood, partly owing to patient heterogeneity and the lack of suitable genetic models [33]. Beyond its well-established role in T-cell and neuronal development [23,34,35,36,37,38,39], Bcl11b functions as a transcriptional repressor by interacting with the RNA polymerase II-regulatory complex pTEFb at the MYH7 promoter in the hearts of mice with hypertrophic cardiomyopathy [40]. Thus, Bcl11b might contribute to the regulation of the size of heart sarcomeres in physiological or pathological conditions. Here we demonstrated that specific knockout of Bcl11b in embryonic CMs causes an LVNC phenotype due to impaired CM growth and TTN integrity in compact layer.

Previous studies have reported hypertrabeculation in mice with endothelial cell–specific defects in ADAMTS1 [41], Fkbp1a [10], Jarid2 [42,43], Ino80 [44], ptbp1 [45] and Nrg1 [6,46,47], which is subsequently accompanied by embryonic or neonatal lethality except of Nfatc1-Cre;Ptbp1^fl/fl and Tie2-Cre;Ptbp1^fl/fl. In contrast, CM-specific deletion of Mib1 resulted in dilated hearts with a thin compact myocardium and enlarged noncompacted trabeculae, and notably, some mutant mice survived into adulthood [9,48]. Together, these findings suggest that endothelial cells and CMs may play sequential roles during distinct stages of ventricular trabeculation and compaction, although the precise mechanisms require further investigation. Our findings further emphasize that cell type–specific gene expression and its temporal dynamics are critical determinants of LVNC pathogenesis. Moreover, the survival of mice exhibiting LVNC features into adulthood provides an opportunity to explore potential pharmacological and therapeutic strategies for clinical translation.

Pou3f2 is upregulated in neocortical progenitor cells during the early stages of embryonic brain development and plays important roles in neural formation and cell fate determination [49,50,51,52]. Although the relationship between Bcl11b and Pou3f2 has not been fully elucidated, several lines of evidence suggest an antagonistic interaction between these two transcription factors. First, Bcl11b⁺ and Pou3f2⁺ cells occupy opposing regions of the developing brain, both in neurons differentiated from human hESCs [53] and in the mous neocortex [54]. Second, Pou3f2 expression is reduced in Bcl11b⁺ cell population isolated from the frozen mouse neocortex by FIN-seq [55]. Third, in the somatosensory cortex of Pou3f3/2-cKO mice, the expression of upper the upper-layer markers RORβ and CUX1 are absent, accompanied by an increased number of cells expressing the deep-layer markers TLE4 and Bcl11b [56]. Our findings extend these observations by demonstrating that, in the heart, Bcl11b represses Pou3f2 expression to preserve TTN integrity and maintain normal CM growth. Pou3f2 overexpression was reported to repress proliferation in primary human NSCs [29] and in stem cell models of ASD [57,58], whereas, Pou3f2 knockdown significantly increased the ratio of EdU-positive NPCs [59]. Consistent with these findings, both siRNA-mediated silencing and genetic ablation of Pou3f2 mitigated the inhibitory effects of CM-specific Bcl11b deficiency on CM growth, supporting a role for Pou3f2 as a negative downstream effector of Bcl11b.

Numerous TTN mutations have been identified in patients with LVNC [16,60,61]. In addition, the dynamic changes in TTN isoforms during cardiac development and disease progression have been well characterized [25,62,63,64,65]. However, the functional significance and regulatory mechanisms of TTN expression changes during heart development remain incompletely understood. Furthermore, primary cultures of rat CMs undergo a transition from an undifferentiated mononuclear stage to a fully differentiated and contractile state, accompanied by the induction of TTN expression. However, when these cells are seeded at low density, TTN expression is completely down regulated [66], suggesting that TTN may regulate the balance between CM proliferation and maturation. In addition, increased TTN expression has been shown to reverse skeletal muscle atrophy in mice [67,68]. In our study, we clarified that Pou3f2 decreased expression level of TTN, ultimately cause LVNC. Notably, genetic ablation of Pou3f2 effectively rescued these defects in Bcl11b knockout mice. Collectively, these findings suggest that TTN acts as a critical downstream effector of the Bcl11b–Pou3f2 regulatory axis and highlight its essential role in coordinating CM growth and maturation during heart development.

In summary, our findings provide new insights into the mechanisms whereby a Bcl11b and its downstream pou3f2 and TTN regulate CM proliferation and heart development (Figure 6).

4. Materials and Methods

4.1. Mice

All animal procedures were approved by the Institutional Animal Care and Use Committee of Westlake University and conducted in compliance with institutional guidelines (IACUC Protocol #25-102-SHJ & #26-008-CX). The Bcl11b^flox/flox (Bcl11b^f/f) mice (C57BL/6 background) were kindly provided by Shang Cai’s lab, as previously reported [69,70]. The Nkx2.5-Cre and cTnT-Cre were purchased from Jackson Laboratory, nfatc1-Cre mice were purchased from GemPharmatech.

Pou3f2 knockout mice were generated using the Crispr-cas9 genome editing approach [71]. Briefly, single guide RNA (sgRNA) was designed using the IDT CRISPR tool (https://sg.idtdna.com/pages) and synthesized by GenScript. Equimolar amounts of sgRNA and Cas9 protein were mixed in RNase-free water to produce a microinjection solution with a final ribonucleoprotein (RNP) concentration of 2 µM. The RNP mixture was microinjected into C57BL/6J zygotes, which were subsequently transferred into pseudopregnant recipient females to produce founder mice. The sgRNA sequences and genotyping primers are listed in the Supplementary Table A1. All mouse strains were maintained on a C57BL/6J genetic background for subsequent experiments.

4.2. Lightsheet Fluorescence Microscopy (LFM) and Morphological Analysis

Fetal hearts were harvested at embryonic stage day 18.5 (E18.5) and were imaged using the Zeiss Lightsheet Z7 microscope as previously described [72]. In briefly, hearts were fixed overnight in a mixed solution of 10% neutral buffered formalin and 2.5% glutaraldehyde after dissected with phosphate-buffered saline (PBS), then rinsed twice in PBS, and dehydrated in 50%, 75%, and 100% ethanol in turn. Samples were transferred into tube containing BABB solution for tissue clearing and mounted into the instrument chamber filled with 85% glycerol. Whole Hearts were scanned and Imaris 10.2.0 software was used to 3D reconstruction of the image stacks for morphological analysis. Heart morphology was assessed in 3D mode independently by two trained personnel.

4.3. Compact Layer and Noncompact Layer Measurement

Lightsheet 3D images were analyzed using Imaris (version 10.2.0). The long-axis four-chamber view was used to measure the thickness of the compact myocardial layer and the non-compact myocardial layer. Papillary muscles, which were clearly identifiable and served as anatomical landmarks for the measurement plane, were excluded from the measurements. The compact myocardial layer was defined as the myocardial layer extending from the epicardial surface to the troughs of the trabeculae, showing homogeneous signal intensity. The non-compact myocardial layer was defined as a sponge-like myocardial layer with discontinuous, interspaced signal intensity. For each heart, thickness measurements were taken at five positions and averaged. The same anatomical locations were used consistently across all hearts.

4.4. Mice Echocardiography

P21 mouse transthoracic echocardiography was performed using a Vevo 3100 imaging system equipped with an MS400 transducer. Mice were anaesthetized with isoflurane (1% for maintenance), and body temperature was maintained at 37°C. Chest hair was removed with depilatory cream, and ultrasound gel was applied to the thorax. Images were acquired when the heart rate stabilized between 450 and 510 beats per minute.

Left ventricle ejection fraction (LVEF) and left ventricle fractional shortening (LVFS) were measured in M-mode. Transmitral inflow velocities (E and A) were obtained by pulsed-wave Doppler, and myocardial velocities (E’ and A’) were measured using tissue Doppler imaging. All parameters represent the average of three consecutive cardiac cycles.

4.5. Immunofluorescence Staining and TUNEL Assay

Hearts were fixed in 4% paraformaldehyde (PFA) in PBS at 4 °C with gentle agitation on a rocker for 1–3 days, depending on tissue size. Samples were then dehydrated and embedded in paraffin (or OCT) following to standard laboratory procedures. Serial sections (7 µm) were prepared for immunofluorescence staining and TUNEL assays.

For immunofluorescence staining, sections were incubated in preheated sodium citrate buffer (pH 6.0) at 98°C for 25 min for antigen retrieval. After blocking with 10% goat serum for 30 min at room temperature, sections were incubated with primary antibodies at 4°C overnight, followed by incubation with appropriate Alexa Fluor–conjugated secondary antibodies for 1 h at room temperature. Sections were then counterstained with DAPI and mounted using VECTASHIELD antifade mounting medium (Vector Laboratories). Tyramide signal amplification (TSA) was used to enhance weak immunofluorescence signals (like Bcl11b and Pou3f2). After primary antibody incubation, sections were washed three times with 1×TBST and incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Sections were then treated with amplification solution containing hydrogen peroxide and tyramide-biotin (1:200) for 8–10 min, followed by three washes. Finally, fluorophore-conjugated streptavidin and DAPI were applied for 1 h at room temperature before imaging.

After antigen retrieval, sections were washed with PBS and incubated with WGA for 10 min at room temperature, followed by PBS washes, DAPI staining, and mounting for imaging.

TUNEL staining was performed using the In Situ Cell Death Detection Kit, Fluorescein, according to the manufacturer’s instructions. All Images were acquired using an Olympus FV3000 confocal microscope.

4.6. RNA Isolation and Quantitative Real-Time PCR Assay

Total RNA was extracted from heart ventricle tissues using TRIzol Reagent (Invitrogen). For each sample, 500 ng of RNA was reverse-transcribed into cDNA. Quantitative Real-time PCR was performed using SYBR Green Mix (ABclonal) on a qTOWER real-time PCR system. Primer sequences are listed in the Supplementary Table 1.

4.7. Western Blot Assay

Heart ventricle tissues freshly excised and were snap frozen in liquid nitrogen, then homogenized with homogenizer in tissue lysis buffer (20 mM Tris–HCl, pH 7.4; 150 mM NaCl; 2.5 mM EDTA; 1% Triton X-100; 10% glycerol; 0.1% SDS; 0.5% sodium deoxycholate) supplemented with protease inhibitor and phosphatase inhibitor (1:200) on ice. For cultured primary cardiomyocytes (CMs), the cells were washed by ice-cold PBS and lysed by sonication in RIPA buffer (50 mM Tris–HCl, pH 7.4; 150 mM NaCl; 1 mM EDTA; 1% Triton X-100; 0.1% SDS; 1% sodium deoxycholate) supplemented with protease inhibitor and phosphatase inhibitor on ice. Tissue and cell lysates were centrifuged at 13,000 rpm for 30 min at 4°C to remove insoluble material. Electrophoresed and blotted were performed by standard protocols.

4.8. Neonatal Mice CMs (NMCMs) Isolation and Manipulation

NMCMs were isolated from neonatal hearts as previously described [73] with minor modifications. Briefly, neonatal mice were decapitated, and hearts were rapidly excised and transferred into ice-cold calcium- and magnesium-free HBSS under sterile conditions. After removal of lung tissue, major vessels and blood clots, the hearts were mechanically dissociated into small fragments. Tissues were pre-digested in 0.25% trypsin diluted in HBSS at 4°C for ~10 h. The digestion was terminated by adding complete medium (DMEM/F-12 supplemented with 10% FBS, 100 U/mL penicillin, and 100 μg/mL streptomycin), followed by incubation at 37°C for 10 min. After removal of the supernatant, tissues were further digested with collagenase II (1%) in DMEM/F-12 at 37°C with gentle agitation until complete dissociation. The cell suspension was filtered through a 70 μm cell strainer and centrifuged at 300 × g for 5 min at room temperature. The pellet was resuspended in complete medium and plated onto 10 cm culture dishes for pre-plating at 37°C for 1.5–2 h to allow preferential attachment of non-myocytes (mainly fibroblasts). The supernatant enriched in CMs was collected and either processed for protein analysis or used for subsequent culture.

For CM culture, plates were pre-coated with collagen. Cells were seeded at a density of approximately 2×10⁵ cells/mL and maintained in complete medium at 37°C. After 24 h, the medium was replaced with fresh DMEM/F-12. For siRNA transfection, NMCMs were transfected with specific siRNAs using RNAiMAX according to the manufacturer’s instructions. Cells were incubated for 1–3 days prior to downstream analyses. For immunofluorescence, cells were fixed with 4% paraformaldehyde at room temperature. For protein analysis, cells were lysed in appropriate lysis buffer on ice for subsequent Western blot experiments.

4.9. Bulk RNA Sequencing and Data Analysis

Embryonic hearts at day 16.5 were harvested in cold PBS, and ventricular tissues were dissected and immediately placed in cold TRIzol reagent (Invitrogen). Total RNA was isolated following the manufacturer’s instructions. mRNA-seq libraries were prepaered using Fast RNA-seq Library Prep Kit V2 (Cat.No.RK20306; ABclonal). Sequencing was performed on the Illumina Novaseq 6000 platform using a paired-end 150bp (PE150) strategy.

4.10. Adeno-Associated Viruses 9-pou3f2 Overexpression Assay

AAV9-pou3f2 overexpression and control viruses were purchased from PackGene. The AAV9-pou3f2 overexpression vector expressed Pou3f2 and EGFP under the control of the cardiomyocyte-specific cTnT promoter, whereas the control vector expressed EGFP alone driven by the same promoter. C57BL/6 mice were intracardially injected at postnatal day 3 (P3) with either the overexpression or control virus at a dose of 1×10¹²-3×10¹² viral genomes (vg)/per mouse as previously described [74]. Cardiac-specific transduction efficiency was assessed at day 4 after injection by fluorescence imaging and Western blot analysis.

4.11. Statistical Analysis

Results are presented as mean ± SD. The data were analyzed using an unpaired Student's t-test for comparisons between two groups, and one-way or two-way analysis of variance (ANOVA) with post hoc tests was applied for comparisons involving three or more groups. Statistically significant was considered when p-value <0.05.

Author Contributions

W.B., X.X.L., Y.Q.L., Y.S.C., C.X.L., J.N.F., J.F.W., X.C., and H.J.S. designed and performed experiments. W.B., X.X.L., L.F.L., and H.J.S. analyzed and interpreted data. W.B. and H.J.S. wrote the manuscript with input from all authors. H.J.S. supervised the study.

Funding

This research was supported by grants from the Natural Science Foundation of Zhejiang Province (LZ19H040001).

Institutional Review Board Statement

All animal procedures were approved by the Institutional Animal Care and Use Committee of Westlake University and conducted in compliance with institutional guidelines (IACUC Protocol #25-102-SHJ & #26-008-CX).

Informed Consent Statement

Not applicable.

Data Availability Statement

Further information and requests for resources should be directed to and will be fulfilled by the lead contact, Hongjun Shi (shihongjun@westlake.edu.cn). Materials and resources listed in the key resources table are available upon request.

Acknowledgments

The authors thank Dr. Weike Pei, Dr. Jiemin Jia, and Dr. Lingjuan He (Westlake University) for valuable discussions and experimental advice. We are grateful to Dr. Shang Cai (Westlake University) for providing mouse lines. We also acknowledge the Microscopy Core Facility of Westlake University for technical support and the Westlake Animal Facility for assistance with mouse breeding and husbandry.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:

AAV9	Adeno-associated virus serotype 9
Bcl11b	B-cell leukemia/lymphoma 11b
CHD	Congenital heart disease
CMs	Cardiomyocytes
cTnT	Cardiac troponin T
DCM	Dilated cardiomyopathy
Erk1/2	Extracellular regulated kinase 1/2
GAPDH	Glyceraldehyde-3-phosphate dehydrogenase
HCM	Hypertrophic cardiomyopathy
HF	Heart failure
LVEF	Left ventricular ejection fraction
LVFS	Left ventricular fractional shortening
LVNC	Left ventricular noncompaction cardiomyopathy
NC	Negative control
NKX2.5	NK2 homeobox 5
NOTCH1	Notch receptor 1
PH3	Phospho-histone H3
Pou3f2	POU class 3 homeobox 2
TTN	Titin/connectin
WT	Wild type

Supplemental Information

Figure A1. Bcl11b expression levels after cardiomyocyte-specific knockout and heart defect incidence following Bcl11b deletion and, relative toFigure 1. (A) Bcl11b staining in heart sections from Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. (B) Morphology of E18.5 embryonic hearts from Bcl11b^f/f and Nkx2.5-Cre; Bcl11b^f/f mice. N=43-65. (C) Morphology of E18.5 embryonic hearts from Bcl11b^f/f and Nftac1-Cre; Bcl11b^f/f mice. N=7-22. (D) Survival analysis of mice within the first 3 days after birth. Scale bar = 100 μm. Means±SD are plotted; statistical analysis was performed using the chi-square test with Bonferroni correction for multiple comparisons . ***p < 0.001.

Figure A2. Postnatal development of cardiomyopathy in CM-specific Bcl11b knockout mice, relative toFigure 2. (A) WGA staining of cardiac sections from postnatal day 21 (P21) Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice (the right panel shows a magnified view of the boxed region). (B-D) Quantification analysis of heart weight (HW), tibia length (TL), and the HW/TL ratio from P21 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=9-11. (E) Quantitative analysis of cardiomyocyte size in cardiac sections from P21 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=4. (F-P) Echocardiographic assessment of heart rate, LV ejection fraction (LVEF), LV fractional shortening (LVFS) E/A and E/E’ ratios, as well as left ventricular anterior wall thickness (LVAW), internal diameter (LVID), and posterior wall thickness (LVPW) at systole (s) and diastole (d) in P21 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=7-11. Scale bar = 500 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test. *p < 0.05, **p < 0.01, ***p < 0.001; ns, non-significant.

Figure A3. siRNA-mediated depletion of Bcl11b induces Pou3f2 upregulation, accompanied by further suppression of TTN expression in NMCMs, relative toFigure 5. (A) Changes of Bcl11b and Pou3f2 protein level in isolated NMCMs from wild type (WT) mice after treating with siBcl11b or siNC. N=3. (B) Pou3f2⁺ staining in isolated NMCMs from WT mice after treating with siBcl11b or siNC. N=3. (C) TTN staining in isolated NMCMs from WT mice after treating with siBcl11b or siNC. N=3. Scale bar = 50 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test (B, C), one-way followed by multiple comparisons tests (A). *p < 0.05, **p < 0.01, ***p < 0.001.

Figure A4. siRNA-mediated inhibition of Pou3f2 rescues the downregulation of TTN expression caused by Bcl11b knockdown. TTN staining in isolated NMCMs from WT mice after treating with siBcl11b+siPou3f2, siBcl11b or siNC. N=3-4. Scale bar = 50 μm. Means±SD are plotted; statistics of were performed using one-way followed by multiple comparisons tests. *p < 0.05; ns, non-significant.

Table A1. Sequences of the oligonucleotides, related to STAR methods.

Primers for qRT-PCR
Bcl11b Forward	5’- AGGAGAGTATCTGAGCCAGTG-3’
Bcl11b Reverse	5’- GTTGTGCAAATGTAGCTGGAAG-3’
Pou3f2 Forward	5’- GTTGCCGTTTTGGGGGATTT-3’
Pou3f2 Reverse	5’- AATGGAGAGTGGCCAAGAGC-3’
TTN Forward	5’-AGAAGAGCCTAGCAGCCTGG-3’
TTN Reverse	5’-TGAGCCCCATCATGCAGACC-3’
Gapdh Forward	5’-CATCACTGCCACCCAGAAGACTG-3’
Gapdh Reverse	5’-ATGCCAGTGAGCTTCCCGTTCAG-3’
Sequences of sgRNA used to generate Pou3f2^-/- mice
GCTGTAGTGGTTAGACGCTG
Sequences of siRNA used in vitro
Continued
NC-s	ACGUGACACGUUCGGAGAA/dT//dT/
NC-a	UUCUCCGAACGUGUCACGU/dT//dT/
mBcl11b-1s	CGCAGGCGAGCAAGCUCAA/dT//dT/
mBcl11b-1a	UUGAGCUUGCUCGCCUGCG/dT//dT/
mBcl11b-2s	GCGGCAAGGUCUUCAAGAA/dT//dT/
mBcl11b-2a	UUCUUGAAGACCUUGCCGC/dT//dT/
mPou3f2-8s	GCAGCGUCUAACCACUACA/dT//dT/
mPou3f2-8a	UGUAGUGGUUAGACGCUGC/dT//dT/
mPou3f2-9s	CCACCAGCAUAGACAAGAU/dT//dT/
mPou3f2-9a	AUCUUGUCUAUGCUGGUGG/dT//dT/
Genotyping primers
Bcl11b-flox Forward	5’-AGTTTGCCGGAAGACTCTCTC-3’
Bcl11b-flox Reverse	5’-GGGTGCTCTGGTAATTTTCCTTA-3’
Cre Forward	5’-GTGGCAAAGTGGAGATTGTTG-3’
Cre Reverse	5’-CTCCTGGAAGATGGTGATGG-3’
Pou3f2-wt-Forward	5’-CAGGCTGTAGTGGTTAGACGCTG-3’
Pou3f2-mutant-Reverse	5’-CGAGAGTCATGGCGACCGCTA-3’
Pou3f2-common-Reverse	5’-GCAACAGAAGGCGTCGGAGC-3’

Table A2. KEY RESOURCES TABLE.

REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Anti-Pou3f2	CST	Cat# 12137
Anti-Erk1/2	CST	Cat# 4695; RRID: AB_ 390779
Anti-p-Erk1/2	CST	Cat# 4370; RRID: AB_ 2315112
Anti-Akt	CST	Cat# 4691; RRID: AB_ 915783
Anti-p-Akt	CST	Cat# 4060; RRID: AB_ 2315049
Anti-YAP	CST	Cat# 14074; RRID: AB_2650491
Anti-VASP	CST	Cat# 3132; RRID: AB_2213393
Anti-PKA	CST	Cat# 5842; RRID: AB_10706172
Anti-p-PKA	CST	Cat# 5661; RRID: AB_10707163
Anti-p-VASP	Affbiotech	Cat# AF3338; RRID: AB_2834753
Anti-GAPDH	ABclonal	Cat# AC033
Anti-PH3	ABclonal	Cat# AP0840SP
Continued
Anti-tubulin	DSHB	Cat# AB528499
Anti-cTnT	DSHB	Cat# AB2240831
Anti-Bcl11b	Abcam	Cat# ab18465
Anti-endomucin	Santa cruz	Cat# sc-69495
Alexa Fluor 488 Donkey anti-mouse	Jackson	Cat# 715-545-150
Cy3 AffiniPure Donkey anti-Goat	Jackson	Cat# 711-165-152
Cy5 AffiniPure Donkey anti-Goat	Jackson	Cat# 705-175-147
Cy3 Streptavidin	Jackson	Cat# 016-160-084
Anti-Rabbit secondary antibody/HRP	CST	Cat# 7074
Anti-Mouse secondary antibody/HRP	CST	Cat# 7076
DAPI	Beyotime	Cat# C1002
WGA	Biotium	Cat# 29022
Chemicals, peptides, and recombinant proteins
DMEM/F12 FBS Trypsin-EDTA HBSS Collagenase II Collagen Isoflurane PFA Triton X-100	Gibco Solarbio Cellmax Gibco Worthington Gibco RWD Sigma Macklin		Cat# C11330500BT Cat# S9030 Cat# CPT101.02 Cat# C14175500BT Cat# LS004176 Cat# S006100 Cat# Cat# P6148 Cat# I997471
REGENT or RESOURCE	SOURCE		IDENTIFIER
DMSO Citrate Antigen Retrieval Solution Protease inhibitor cocktail Phosphatase Inhibitor Cocktail RNAiMAX	Macklin Beyotime MCE MCE Invitrogen		Cat# D806645 Cat# P0083 Cat# HY-K0010 Cat# HY-K0022 Cat# 56532
Critical commercial assays
TRIzol reagent In situ Cell Death Detection Kit, POD SYBR Green Mix Enhanced BCA Protein Assay Kit BeyoECL Moon TIANgel Midi Purification Kit FastKing RT-PCR MasterMix	Invitrogen Roche ABclonal Beyotime Beyotime TIANGEN TIANGEN		Cat# 15596018CN Cat# 11684795910 Cat# RM21217 Cat# P0010S Cat# P0018FM Cat# DP209-03 Cat# KR123
Experimental models: Organisms/strains
Mouse: Nkx2.5-Cre	Jax		Cat# 03004
Continued
Mouse: Nfatc1-Cre	GemPharmatech		Cat# T006813
Mouse: cTnT-Cre	Jax		Cat# 024240
Mouse: Pou3f2^-/-	This paper		N/A
Recombinant DNA
AAV9-cTnT-NC/Pou3f2	PackGene	N/A
Software and algorithms
GraphPad Prism v10.1 ImageJ Imaris v10.2.0 Olympus FV3000 Vevo Lab 5.7.1	GraphPad Softwave lnc ImageJ Bitplane Olympus FUJIFILM	N/A https://imagej.net N/A N/A N/A

References

Chin, T.K.; Perloff, J.K.; Williams, R.G.; Jue, K.; Mohrmann, R. Isolated noncompaction of left ventricular myocardium. A study of eight cases. Circulation 1990, 82(2), 507–513. [Google Scholar] [CrossRef]
Jenni, R.; Oechslin, E.; Schneider, J.; Attenhofer Jost, C.; Kaufmann, P.A. Echocardiographic and pathoanatomical characteristics of isolated left ventricular non-compaction: a step towards classification as a distinct cardiomyopathy. Heart 2001, 86(6), 666–671. [Google Scholar] [CrossRef]
Towbin, J.A.; Lorts, A.; Jefferies, J.L. Left ventricular non-compaction cardiomyopathy. Lancet 2015, 386(9995), 813–825. [Google Scholar] [CrossRef]
Shi, W.Y.; Moreno-Betancur, M.; Nugent, A.W.; Cheung, M.; Colan, S.; Turner, C.; Sholler, G.F.; Robertson, T.; Justo, R.; Bullock, A. Long-Term Outcomes of Childhood Left Ventricular Noncompaction Cardiomyopathy: Results From a National Population-Based Study. Circulation 2018, 138(4), 367–376. [Google Scholar] [CrossRef] [PubMed]
Captur, G.; Wilson, R.; Bennett, M.F.; Luxan, G.; Nasis, A.; de la Pompa, J.L.; Moon, J.C.; Mohun, T.J. Morphogenesis of myocardial trabeculae in the mouse embryo. J. Anat. 2016, 229(2), 314–325. [Google Scholar] [CrossRef]
Del Monte-Nieto, G.; Ramialison, M.; Adam, A.A.S.; Wu, B.; Aharonov, A.; D'Uva, G.; Bourke, L.M.; Pitulescu, M.E.; Chen, H.; de la Pompa, J.L. Control of cardiac jelly dynamics by NOTCH1 and NRG1 defines the building plan for trabeculation. Nature 2018, 557(7705), 439–445. [Google Scholar] [CrossRef] [PubMed]
Tian, X.; Li, Y.; He, L.; Zhang, H.; Huang, X.; Liu, Q.; Pu, W.; Zhang, L.; Li, Y.; Zhao, H. Identification of a hybrid myocardial zone in the mammalian heart after birth. Nat. Commun. 2017, 8(1), 87. [Google Scholar] [CrossRef] [PubMed]
Choquet, C.; Kelly, R.G.; Miquerol, L. Defects in Trabecular Development Contribute to Left Ventricular Noncompaction. Pediatr. Cardiol. 2019, 40(7), 1331–1338. [Google Scholar] [CrossRef]
Luxan, G.; Casanova, J.C.; Martinez-Poveda, B.; Prados, B.; D'Amato, G.; MacGrogan, D.; Gonzalez-Rajal, A.; Dobarro, D.; Torroja, C.; Martinez, F. Mutations in the NOTCH pathway regulator MIB1 cause left ventricular noncompaction cardiomyopathy. Nat. Med. 2013, 19(2), 193–201. [Google Scholar] [CrossRef]
Chen, H.; Zhang, W.; Sun, X.; Yoshimoto, M.; Chen, Z.; Zhu, W.; Liu, J.; Shen, Y.; Yong, W.; Li, D. Fkbp1a controls ventricular myocardium trabeculation and compaction by regulating endocardial Notch1 activity. Development 2013, 140(9), 1946–1957. [Google Scholar] [CrossRef]
Pashmforoush, M.; Lu, J.T.; Chen, H.; Amand, T.S.; Kondo, R.; Pradervand, S.; Evans, S.M.; Clark, B.; Feramisco, J.R.; Giles, W. Nkx2-5 pathways and congenital heart disease; loss of ventricular myocyte lineage specification leads to progressive cardiomyopathy and complete heart block. Cell. 2004, 117(3), 373–386. [Google Scholar] [CrossRef]
Yang, J.; Bucker, S.; Jungblut, B.; Bottger, T.; Cinnamon, Y.; Tchorz, J.; Muller, M.; Bettler, B.; Harvey, R.; Sun, Q.Y. Inhibition of Notch2 by Numb/Numblike controls myocardial compaction in the heart. Cardiovasc Res. 2012, 96(2), 276–285. [Google Scholar] [CrossRef]
Cuevas, J.; Ptaszynski, R.; Cigarran, H.; Calvo, J.; Martin, M. Left ventricular noncompaction cardiomyopathy: Recent advances. Kardiol. Pol. 2022, 80(5), 529–539. [Google Scholar] [CrossRef] [PubMed]
van Waning, J.I.; Moesker, J.; Heijsman, D.; Boersma, E.; Majoor-Krakauer, D. Systematic Review of Genotype-Phenotype Correlations in Noncompaction Cardiomyopathy. J. Am. Heart Assoc. 2019, 8(23), e012993. [Google Scholar] [CrossRef] [PubMed]
Mazzarotto, F.; Hawley, M.H.; Beltrami, M.; Beekman, L.; de Marvao, A.; McGurk, K.A.; Statton, B.; Boschi, B.; Girolami, F.; Roberts, A.M. Systematic large-scale assessment of the genetic architecture of left ventricular noncompaction reveals diverse etiologies. Genet Med. 2021, 23(5), 856–864. [Google Scholar] [CrossRef]
Jolfayi, A.G.; Kohansal, E.; Ghasemi, S.; Naderi, N.; Hesami, M.; MozafaryBazargany, M.; Moghadam, M.H.; Fazelifar, A.F.; Maleki, M.; Kalayinia, S. Exploring TTN variants as genetic insights into cardiomyopathy pathogenesis and potential emerging clues to molecular mechanisms in cardiomyopathies. Sci. Rep. 2024, 14(1), 5313. [Google Scholar] [CrossRef]
Gramlich, M.; Michely, B.; Krohne, C.; Heuser, A.; Erdmann, B.; Klaassen, S.; Hudson, B.; Magarin, M.; Kirchner, F.; Todiras, M. Stress-induced dilated cardiomyopathy in a knock-in mouse model mimicking human titin-based disease. J. Mol. Cell Cardiol. 2009, 47(3), 352–358. [Google Scholar] [CrossRef]
Cao, C.; Li, L.; Zhang, Q.; Li, H.; Wang, Z.; Wang, A.; Liu, J. Nkx2.5: a crucial regulator of cardiac development, regeneration and diseases. Front Cardiovasc Med. 2023, 10, 1270951. [Google Scholar] [CrossRef]
Zhang, H.; Lui, K.O.; Zhou, B. Endocardial Cell Plasticity in Cardiac Development, Diseases and Regeneration. Circ. Res. 2018, 122(5), 774–789. [Google Scholar] [CrossRef]
Ye, L.; Liu, J.; Lei, W.; Ni, B.; Han, X.; Zhang, Y.; Wang, Y.; Hao, K.; Peng, Y.; Wu, H. Disruption of cTnT-Mediated Sarcomere-Mitochondrial Communication Results in Dilated Cardiomyopathy. Circulation 2025, 152(6), 397–415. [Google Scholar] [CrossRef] [PubMed]
Franco, D.; Lamers, W.H.; Moorman, A.F. Patterns of expression in the developing myocardium: towards a morphologically integrated transcriptional model. Cardiovasc Res. 1998, 38(1), 25–53. [Google Scholar] [CrossRef] [PubMed]
Sun, B.; Rouzbehani, O.M.T.; Kramer, R.J.; Ghosh, R.; Perelli, R.M.; Atkins, S.; Fatahian, A.N.; Davis, K.; Szulik, M.W.; Goodman, M.A. Nonsense Variant PRDM16-Q187X Causes Impaired Myocardial Development and TGF-beta Signaling Resulting in Noncompaction Cardiomyopathy in Humans and Mice. Circ. Heart Fail. 2023, 16(12), e010351. [Google Scholar] [CrossRef] [PubMed]
Lennon, M.J.; Jones, S.P.; Lovelace, M.D.; Guillemin, G.J.; Brew, B.J. Bcl11b-A Critical Neurodevelopmental Transcription Factor-Roles in Health and Disease. Front Cell Neurosci. 2017, 11, 89. [Google Scholar] [CrossRef] [PubMed]
Longabaugh, W.J.R.; Zeng, W.; Zhang, J.A.; Hosokawa, H.; Jansen, C.S.; Li, L.; Romero-Wolf, M.; Liu, P.; Kueh, H.Y.; Mortazavi Aet. Bcl11b combinatorial resolution of cell fate in the T-cell gene regulatory network. Proc. Natl. Acad. Sci. U.S.A. 2017, 114(23), 5800–5807. [Google Scholar] [CrossRef]
Granzier, H.L. Labeit S: Discovery of Titin and Its Role in Heart Function and Disease. Circ. Res. 2025, 136(1), 135–157. [Google Scholar] [CrossRef]
Fjodorova, M.; Noakes, Z.; De La Fuente, D.C.; Errington, A.C.; Li, M. Dysfunction of cAMP-Protein Kinase A-Calcium Signaling Axis in Striatal Medium Spiny Neurons: A Role in Schizophrenia and Huntington's Disease Neuropathology. Biol. Psychiatry Glob. Open Sci. 2023, 3(3), 418–429. [Google Scholar] [CrossRef]
Fjodorova, M.; Louessard, M.; Li, Z.; De La Fuente, D.C.; Dyke, E.; Brooks, S.P.; Perrier, A.L.; Li, M. CTIP2-Regulated Reduction in PKA-Dependent DARPP32 Phosphorylation in Human Medium Spiny Neurons: Implications for Huntington Disease. Stem Cell Rep. 2019, 13(3), 448–457. [Google Scholar] [CrossRef]
Valisno, J.A.C.; May, J.; Singh, K.; Helm, E.Y.; Venegas, L.; Budbazar, E.; Goodman, J.B.; Nicholson, C.J.; Avram, D.; Cohen, R.A. BCL11B Regulates Arterial Stiffness and Related Target Organ Damage. Circ. Res. 2021, 128(6), 755–768. [Google Scholar] [CrossRef]
Pearl, J.R.; Colantuoni, C.; Bergey, D.E.; Funk, C.C.; Shannon, P.; Basu, B.; Casella, A.M.; Oshone, R.T.; Hood, L.; Price, N.D. Genome-Scale Transcriptional Regulatory Network Models of Psychiatric and Neurodegenerative Disorders. Cell Syst. 2019, 8(2), 122–135 e127. [Google Scholar] [CrossRef]
Xing, Y.; Ichida, F.; Matsuoka, T.; Isobe, T.; Ikemoto, Y.; Higaki, T.; Tsuji, T.; Haneda, N.; Kuwabara, A.; Chen, R. Genetic analysis in patients with left ventricular noncompaction and evidence for genetic heterogeneity. Mol. Genet Metab. 2006, 88(1), 71–77. [Google Scholar] [CrossRef]
Klaassen, S.; Probst, S.; Oechslin, E.; Gerull, B.; Krings, G.; Schuler, P.; Greutmann, M.; Hurlimann, D.; Yegitbasi, M.; Pons, L. Mutations in sarcomere protein genes in left ventricular noncompaction. Circulation 2008, 117(22), 2893–2901. [Google Scholar] [CrossRef]
Miszalski-Jamka, K.; Jefferies, J.L.; Mazur, W.; Glowacki, J.; Hu, J.; Lazar, M.; Gibbs, R.A.; Liczko, J.; Klys, J.; Venner, E. Novel Genetic Triggers and Genotype-Phenotype Correlations in Patients With Left Ventricular Noncompaction. Circ. Cardiovasc Genet. 2017, 10(4). [Google Scholar] [CrossRef]
Srivastava, D.; Olson, E.N. A genetic blueprint for cardiac development. Nature 2000, 407(6801), 221–226. [Google Scholar] [CrossRef] [PubMed]
Wakabayashi, Y.; Watanabe, H.; Inoue, J.; Takeda, N.; Sakata, J.; Mishima, Y.; Hitomi, J.; Yamamoto, T.; Utsuyama, M.; Niwa, O. Bcl11b is required for differentiation and survival of alphabeta T lymphocytes. Nat. Immunol. 2003, 4(6), 533–539. [Google Scholar] [CrossRef] [PubMed]
Srinivasan, K.; Leone, D.P.; Bateson, R.K.; Dobreva, G.; Kohwi, Y.; Kohwi-Shigematsu, T.; Grosschedl, R.; McConnell, S.K. Anetwork of genetic repression derepression specifies projection fates in the developing neocortex. Proc. Natl. Acad. Sci. U.S.A. 2012, 109(47), 19071–19078. [Google Scholar] [CrossRef]
Liu, P.; Li, P.; Burke, S. Critical roles of Bcl11b in T-cell development and maintenance of T-cell identity. Immunol. Rev. 2010, 238(1), 138–149. [Google Scholar] [CrossRef]
Kominami, R. Role of the transcription factor Bcl11b in development and lymphomagenesis. Proc. Jpn. Acad. Ser. B Phys. Biol. Sci. 2012, 88(3), 72–87. [Google Scholar] [CrossRef]
Hasan, S.N.; Sharma, A.; Ghosh, S.; Hong, S.W.; Roy-Chowdhuri, S.; Im, S.H.; Kang, K.; Rudra, D. Bcl11b prevents catastrophic autoimmunity by controlling multiple aspects of a regulatory T cell gene expression program. Sci. Adv. 2019, 5(8), eaaw0706. [Google Scholar] [CrossRef]
Garcia-Aznar, J.M.; Alonso Alvarez, S.; Bernal Del Castillo, T. Pivotal role of BCL11B in the immune, hematopoietic and nervous systems: a review of the BCL11B-associated phenotypes from the genetic perspective. Genes Immun. 2024, 25(3), 232–241. [Google Scholar] [CrossRef] [PubMed]
Cherrier, T.; Le Douce, V.; Eilebrecht, S.; Riclet, R.; Marban, C.; Dequiedt, F.; Goumon, Y.; Paillart, J.C.; Mericskay, M.; Parlakian Aet. CTIP2 Is. A Negat. Regul. P-TEFb Proc. Natl. Acad. Sci. U.S.A. 2013, 110(31), 12655–12660. [CrossRef]
Stankunas, K.; Hang, C.T.; Tsun, Z.Y.; Chen, H.; Lee, N.V.; Wu, J.I.; Shang, C.; Bayle, J.H.; Shou, W.; Iruela-Arispe, M.L. Endocardial Brg1 represses ADAMTS1 to maintain the microenvironment for myocardial morphogenesis. Dev. Cell. 2008, 14(2), 298–311. [Google Scholar] [CrossRef]
Mysliwiec, M.R.; Bresnick, E.H.; Lee, Y. Endothelial Jarid2/Jumonji is required for normal cardiac development and proper Notch1 expression. J. Biol. Chem. 2011, 286(19), 17193–17204. [Google Scholar] [CrossRef]
Cho, E.; Mysliwiec, M.R.; Carlson, C.D.; Ansari, A.; Schwartz, R.J.; Lee, Y. Cardiac-specific developmental and epigenetic functions of Jarid2 during embryonic development. J. Biol. Chem. 2018, 293(30), 11659–11673. [Google Scholar] [CrossRef]
Rhee, S.; Chung, J.I.; King, D.A.; D'Amato, G.; Paik, D.T.; Duan, A.; Chang, A.; Nagelberg, D.; Sharma, B.; Jeong, Y. Endothelial deletion of Ino80 disrupts coronary angiogenesis and causes congenital heart disease. Nat. Commun. 2018, 9(1), 368. [Google Scholar] [CrossRef]
Liu, H.; Duan, R.; He, X.; Qi, J.; Xing, T.; Wu, Y.; Zhou, L.; Wang, L.; Shao, Y.; Zhang, F. Endothelial deletion of PTBP1 disrupts ventricular chamber development. Nat. Commun. 2023, 14(1), 1796. [Google Scholar] [CrossRef]
Lai, D.; Liu, X.; Forrai, A.; Wolstein, O.; Michalicek, J.; Ahmed, I.; Garratt, A.N.; Birchmeier, C.; Zhou, M.; Hartley, L. Neuregulin 1 sustains the gene regulatory network in both trabecular and nontrabecular myocardium. Circ. Res. 2010, 107(6), 715–727. [Google Scholar] [CrossRef]
Grego-Bessa, J.; Luna-Zurita, L.; del Monte, G.; Bolos, V.; Melgar, P.; Arandilla, A.; Garratt, A.N.; Zang, H.; Mukouyama, Y.S.; Chen, H. Notch signaling is essential for ventricular chamber development. Dev. Cell. 2007, 12(3), 415–429. [Google Scholar] [CrossRef]
Fernandes, V.S.; Caballero, R.; Siguero-Alvarez, M.; Papoutsi, T.; Gimeno-Blanes, J.R.; Delpon, E.; de la Pompa, J. L: Cardiac electrical abnormalities in a mouse model of left ventricular non-compaction cardiomyopathy. PLoS ONE 2025, 20(5), e0314840. [Google Scholar] [CrossRef]
McEvilly, R.J.; de Diaz, M.O.; Schonemann, M.D.; Hooshmand, F.; Rosenfeld, M.G. Transcriptional regulation of cortical neuron migration by POU domain factors. Science 2002, 295(5559), 1528–1532. [Google Scholar] [CrossRef]
Dominguez, M.H.; Ayoub, A.E.; Rakic, P. POU-III transcription factors (Brn1, Brn2, and Oct6) influence neurogenesis, molecular identity, and migratory destination of upper-layer cells of the cerebral cortex. Cereb. Cortex 2013, 23(11), 2632–2643. [Google Scholar] [CrossRef]
Lin, Y.J.; Hsin, I.L.; Sun, H.S.; Lin, S.; Lai, Y.L.; Chen, H.Y.; Chen, T.Y.; Chen, Y.P.; Shen, Y.T.; Wu, H.M. NTF3 Is a Novel Target Gene of the Transcription Factor POU3F2 and Is Required for Neuronal Differentiation. Mol. Neurobiol. 2018, 55(11), 8403–8413. [Google Scholar] [CrossRef]
Zhu, X.; Guo, Y.; Chu, C.; Liu, D.; Duan, K.; Yin, Y.; Si, C.; Kang, Y.; Yao, J.; Du, X. BRN2 as a key gene drives the early primate telencephalon development. Sci. Adv. 2022, 8(9), eabl7263. [Google Scholar] [CrossRef]
Yao, Z.; Mich, J.K.; Ku, S.; Menon, V.; Krostag, A.R.; Martinez, R.A.; Furchtgott, L.; Mulholland, H.; Bort, S.; Fuqua, M.A. : A Single-Cell Roadmap of Lineage Bifurcation in Human ESC Models of Embryonic Brain Development. Cell Stem Cell. 2017, 20(1), 120–134. [Google Scholar] [CrossRef]
Heavner, W.E.; Ji, S.; Notwell, J.H.; Dyer, E.S.; Tseng, A.M.; Birgmeier, J.; Yoo, B.; Bejerano, G.; McConnell, S.K. Transcription factor expression defines subclasses of developing projection neurons highly similar to single-cell RNA-seq subtypes. Proc. Natl. Acad. Sci. U.S.A. 2020, 117(40), 25074–25084. [Google Scholar] [CrossRef]
Amamoto, R.; Zuccaro, E.; Curry, N.C.; Khurana, S.; Chen, H.H.; Cepko, C.L.; Arlotta, P. FIN-Seq: transcriptional profiling of specific cell types from frozen archived tissue of the human central nervous system. Nucleic Acids Res. 2020, 48(1), e4. [Google Scholar] [CrossRef]
Barao, S.; Xu, Y.; Llongueras, J.P.; Vistein, R.; Goff, L.; Nielsen, K.J.; Bae, B.I.; Smith, R.S.; Walsh, C.A.; Stein-O'Brien, G. Conserved transcriptional regulation by BRN1 and BRN2 in neocortical progenitors drives mammalian neural specification and neocortical expansion. Nat. Commun. 2024, 15(1), 8043. [Google Scholar] [CrossRef]
Belinson, H.; Nakatani, J.; Babineau, B.A.; Birnbaum, R.Y.; Ellegood, J.; Bershteyn, M.; McEvilly, R.J.; Long, J.M.; Willert, K.; Klein, O.D. Prenatal beta-catenin/Brn2/Tbr2 transcriptional cascade regulates adult social and stereotypic behaviors. Mol. Psychiatry 2016, 21(10), 1417–1433. [Google Scholar] [CrossRef]
Marchetto, M.C.; Belinson, H.; Tian, Y.; Freitas, B.C.; Fu, C.; Vadodaria, K.; Beltrao-Braga, P.; Trujillo, C.A.; Mendes, A.P.D.; Padmanabhan, K. Altered proliferation and networks in neural cells derived from idiopathic autistic individuals. Mol. Psychiatry 2017, 22(6), 820–835. [Google Scholar] [CrossRef]
Ding, C.; Zhang, C.; Kopp, R.; Kuney, L.; Meng, Q.; Wang, L.; Xia, Y.; Jiang, Y.; Dai, R.; Min, S. Transcription factor POU3F2 regulates TRIM8 expression contributing to cellular functions implicated in schizophrenia. Mol. Psychiatry 2021, 26(7), 3444–3460. [Google Scholar] [CrossRef]
Han, S.; Zhang, Y.Y.; Geng, J. Case Report: A novel TTN gene variant and a concurrent rare COL4A4 gene variant in a Chinese patient with dilated cardiomyopathy. Front Cardiovasc Med. 2025, 12, 1668842. [Google Scholar] [CrossRef]
Lehman, M.B.; Orgil, B.O.; Guerrier, K.; Hirono, K.; Batsaikhan, E.; Saito, K.; Collyer, J.W.; Towbin, J.A.; Purevjav, E. Left Ventricular Noncompaction Cardiomyopathy in Children: A Focus on Genetic and Molecular Mechanisms. Rev. Cardiovasc Med. 2025, 26(8), 39044. [Google Scholar] [CrossRef] [PubMed]
Opitz, C.A.; Leake, M.C.; Makarenko, I.; Benes, V.; Linke, W.A. Developmentally regulated switching of titin size alters myofibrillar stiffness in the perinatal heart. Circ. Res. 2004, 94(7), 967–975. [Google Scholar] [CrossRef] [PubMed]
Cazorla, O.; Freiburg, A.; Helmes, M.; Centner, T.; McNabb, M.; Wu, Y.; Trombitas, K.; Labeit, S.; Granzier, H. Differential expression of cardiac titin isoforms and modulation of cellular stiffness. Circ. Res. 2000, 86(1), 59–67. [Google Scholar] [CrossRef] [PubMed]
Borbely, A.; Falcao-Pires, I.; van Heerebeek, L.; Hamdani, N.; Edes, I.; Gavina, C.; Leite-Moreira, A.F.; Bronzwaer, J.G.; Papp, Z.; van der Velden, J. Hypophosphorylation of the Stiff N2B titin isoform raises cardiomyocyte resting tension in failing human myocardium. Circ. Res. 2009, 104(6), 780–786. [Google Scholar] [CrossRef]
Opitz, C.A. Linke WA: Plasticity of cardiac titin/connectin in heart development. J. Muscle Res. Cell Motil. 2005, 26(6-8), 333–342. [Google Scholar] [CrossRef]
Van der Loop, F.T.; Van Eys, G.J.; Schaart, G.; Ramaekers, F.C. Titin expression as an early indication of heart and skeletal muscle differentiation in vitro. Developmental re-organisation in relation to cytoskeletal constituents. J. Muscle Res. Cell Motil. 1996, 17(1), 23–36. [Google Scholar] [CrossRef]
Ulanova, A.; Gritsyna, Y.; Vikhlyantsev, I.; Salmov, N.; Bobylev, A.; Abdusalamova, Z.; Rogachevsky, V.; Shenkman, B.; Podlubnaya, Z. Isoform composition and gene expression of thick and thin filament proteins in striated muscles of mice after 30-day space flight. BioMed Res. Int. 2015, 2015, 104735. [Google Scholar] [CrossRef]
Ulanova, A.; Gritsyna, Y.; Salmov, N.; Lomonosova, Y.; Belova, S.; Nemirovskaya, T.; Shenkman, B.; Vikhlyantsev, I. Effect of L-Arginine on Titin Expression in Rat Soleus Muscle After Hindlimb Unloading. Front Physiol. 2019, 10, 1221. [Google Scholar] [CrossRef]
Golonzhka, O.; Liang, X.; Messaddeq, N.; Bornert, J.M.; Campbell, A.L.; Metzger, D.; Chambon, P.; Ganguli-Indra, G.; Leid, M.; Indra, A.K. Dual role of COUP-TF-interacting protein 2 in epidermal homeostasis and permeability barrier formation. J. Invest Dermatol. 2009, 129(6), 1459–1470. [Google Scholar] [CrossRef]
Lin, Z.; Guo, Y.; Bai, H.; Liu, X.; Lin, M.; Zhang, Y.; Tang, R.; Hu, T.; Yu, L.; Wang, C. Distinct mammary stem cells orchestrate long-term homeostasis of adult mammary gland. Cell Discov. 2025, 11(1), 39. [Google Scholar] [CrossRef]
Henao-Mejia, J.; Williams, A.; Rongvaux, A.; Stein, J.; Hughes, C.; Flavell, R.A. Generation of Genetically Modified Mice Using the CRISPR-Cas9 Genome-Editing System. Cold Spring Harb. Protoc. 2016, 2016(2), pdb prot090704. [Google Scholar] [CrossRef]
Luo, X.; Liu, L.; Rong, H.; Liu, X.; Yang, L.; Li, N.; Shi, H. ENU-based dominant genetic screen identifies contractile and neuronal gene mutations in congenital heart disease. Genome Med. 2024, 16(1), 97. [Google Scholar] [CrossRef] [PubMed]
Ehler, E.; Moore-Morris, T.; Lange, S. Isolation and culture of neonatal mouse cardiomyocytes. J. Vis. Exp. 2013, 79. [Google Scholar]
Xie, C.; Gong, X.-M.; Luo, J.; Li, B.-L.; Song, B.-L. AAV9-NPC1 significantly ameliorates Purkinje cell death and behavioral abnormalities in mouse NPC disease. J. Lipid Res. 2017, 58(3), 512–518. [Google Scholar] [CrossRef] [PubMed]

Figure 1. Bcl11b expression is enriched in cardiomyocytes and cardiomyocyte-specific knockout of Bcl11b leads to LVNC. (A) Bcl11b expression levels in the mouse heart ventricles at different developmental stages. N=3-4. (B) Bcl11b expression in neonatal mouse cardiomyocytes (NMCMs) and non-cardiomyocytes (non-NMCMs). N=3. (C) Bcl11b protein expression in the left ventricle tissue of control (Bcl11b^f/f) and cardiomyocyte-specific knockout (cTnT-Cre; Bcl11b^f/f) mice. N=3. (D) light-sheet images and quantification data of defect incidence in E18.5 embryonic hearts from offspring of cTnT-Cre; Bcl11b^f/+ × Bcl11b^f/f crosses. The inset (right) shows a magnified view of the dashed region. N=21-28. (E) Quantification data of the trabecular-to-compact myocardial thickness ratio (NC/C) in the left ventricle (LV) of E18.5 mice with different genotypes. N=18–29. (F) Changes of LV trabecular thickness, compact myocardial thickness, and NC/C in heart sections from Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice at E12.5, E14.5, E16.5, and E18.5. N=3-13. Scale bar = 100 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test (B, C), the chi-square test with Bonferroni correction for multiple comparisons (D), one-way (A, E) or two-way ANOVA followed by multiple comparisons tests (F). *p < 0.05, **p < 0.01, ***p < 0.001; ns, non-significant.

Figure 2. Cardiomyocyte-specific deletion of Bcl11b reduces proliferation and cell size without affecting apoptosis. (A) PH3⁺ cardiomoycytes in the LV cross sections from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=4-6. (B) FITC-labeled wheat germ agglutinin (WGA) immunostaining for cardiomyocytes in the LV cross sections from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=4. (C) TUNEL⁺ cardiomyocytes in the LV cross sections from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=3. Scale bar = 50 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test. *p < 0.05, **p < 0.01, ***p < 0.001; ns, non-significant.

Figure 3. Bcl11b deficiency induces Pou3f2 upregulation while suppressing TTN expression in cardiomyocytes. (A) Volcano plot illustrating differentially up- (red) and down-(blue) regulated genes in heart ventricles of E16.5 cTnT-Cre; Bcl11b^f/f mice compared with Bcl11b^f/f controls. The horizontal line indicates a threshold of P=0.05. N=5. (B-D) qRT–PCR validation of gene expression changes identified by Bulk RNA-seq in the ventricles from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=11-13. (E-H) Changes of Bcl11b and downstream proteins in the ventricles from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=4-5. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test. *p < 0.05, **p < 0.01, ***p < 0.001; ns, non-significant.

Figure 4. Upregulation of Pou3f2 inhibits normal TTN expression in CMs. (A) Pou3f2⁺ staining in the LV cross sections from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=3-4. (B) TTN staining in the LV cross sections from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=3-5. (C) TTN staining in isolated CMs from E16.5 Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice. N=3-4. (D) Pou3f2 protein expression was overexpressed in the ventricles after intracardially injected AAV-cTnT-Pou3f2. N=3-4. (E) TTN protein expression was suppressed in the ventricles after intracardially injected AAV-cTnT-Pou3f2. N=3. Scale bar = 50 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test (A, B, C, E) or one-way followed by multiple comparisons tests (D). *p < 0.05, ***p < 0.001.

Figure 5. Inhibition of Pou3f2 markedly rescues the LVNC phenotype resulting from Bcl11b deficiency. (A) Pou3f2 protein level in the ventricles from E16.5 CM-specific knockdown/knockout Bcl11b mice with Pou3f2 knockdown or not. N=4. (B) Morphology of E18.5 embryonic hearts from CM-specific knockout Bcl11b mice with Pou3f2 knockdown or not. N=16-31. (C) PH3⁺ staining in the LV cross-sections from E16.5 cTnT-Cre; Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f; Pou3f2^+/- mice. N=3-4. (D) FITC-labeled WGA immunostaining for cardiomyocytes in the LV cross sections from E16.5 cTnT-Cre; Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f; Pou3f2^+/- mice. N=3. (E) Changes of Pou3f2 protein level in isolated NMCMs from Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice after treating with siPou3f2 or siNC. N=3. (F) TTN staining in isolated NMCMs from Bcl11b^f/f and cTnT-Cre; Bcl11b^f/f mice after treating with siPou3f2 or siNC. N=3. Scale bar = 100 μm. Means±SD are plotted; statistics of were performed using two-tailed unpaired Student’s t test (C, D, F), the chi-square test with Bonferroni correction for multiple comparisons (B), one-way (A) or two-way ANOVA followed by multiple comparisons tests (E). *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 6. Proposed model of bcl11b deficiency in cardiomyocytes leading to LVNC.

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

Copyright: This open access article is published under a Creative Commons CC BY 4.0 license, which permit the free download, distribution, and reuse, provided that the author and preprint are cited in any reuse.