Submitted:
21 May 2026
Posted:
28 May 2026
You are already at the latest version
Abstract

Keywords:
1. Introduction
2. Materials and Methods
2.1. Cells Culture and Virus Infection
2.2. Antibodies and Reagents
2.3. Lentiviral Packaging
2.4. Immunofluorescence
2.5. RNA Extraction and Quantitative PCR (qPCR)
2.6. TME
2.7. ELISA
2.8. Immunoblotting
2.9. Co-Immunoprecipitation assay (Co-IP)
2.10. Statistical Analysis
3. Results
3.1. BVDV Infection Induce NLRP3 Inflammasomes-Meidated Inflammatory Responses
3.2. BVDV NADL Induces NLRP3 Inflammasome Activation not TC Strain
3.4. BVDV Core Protein C Induces Pyroptosis in MDBK Cells
3.5. BVDV Core Protein Binds with ASC to Induce Inflammasome Assemble and Pyroptosis
4. Discussion
5. Conclusions
Author Contributions
Funding
References
- Rana, E.A. Molecular Epidemiology and Control Strategies for BVDV: A Global Systematic Review From 2000 to 2025. Vet. Med. Int. 2025, 6732453. [Google Scholar] [CrossRef] [PubMed]
- Wernike, K. Bovine viral diarrhea virus eradication in Germany: A never-ending success story or just the last 46 PI animals? Vet. Microbiol. 2025. 309, 110697. [Google Scholar] [CrossRef]
- Hu, X. Bovine Viral Diarrhea Virus and Vaccine Protection Strategies. Vet. Sci. 2026, 13(2). [Google Scholar] [CrossRef] [PubMed]
- Li, Y. Vitamin C combined with anti-PD-1 antibody alleviates peripheral lymphopenia and enhances CD4(+) T-cell antiviral immunity during BVDV infection. Vet. Microbiol. 2026, 312, 110825. [Google Scholar] [CrossRef]
- Tesfaye Melkamsew, A.; Tessema, T. Sisay; Paeshuyse, J. Host Immune Response to Bovine Viral Diarrhea Virus (BVDV): Insights and Strategies for Effective Vaccine Design. Vaccines 2025, 13(5). [Google Scholar] [CrossRef] [PubMed]
- Hou, Z. A Systematic Study of Bovine Viral Diarrhoea Virus Co-Infection with Other Pathogens. Viruses 2025, 17(5). [Google Scholar] [CrossRef]
- Yeşilbağ, K.; Alpay, G.; Becher, P. Variability and Global Distribution of Subgenotypes of Bovine Viral Diarrhea Virus. Viruses 2017, 9(6). [Google Scholar] [CrossRef]
- Tsu, B.V. Running With Scissors: Evolutionary Conflicts Between Viral Proteases and the Host Immune System. Front Immunol. 2021, 12, 769543. [Google Scholar] [CrossRef]
- Pang, F.; Long, Q.; Wei, M. Immune evasion strategies of bovine viral diarrhea virus. Front Cell Infect. Microbiol. 2023, 13, 1282526. [Google Scholar] [CrossRef]
- Zhang, Y. Identification of three novel B cell epitopes targeting the bovine viral diarrhea virus NS3 protein for use in diagnostics and vaccine development. Int. J. Biol. Macromol. 2025. 308, Pt 4, 142767. [Google Scholar] [CrossRef]
- Dong, Q. Screening and Characterization of TAT-Fused Nanobodies Targeting Bovine Viral Diarrhea Virus NS3/NS5A for Antiviral Application. Biomolecules 2025, 15(11). [Google Scholar] [CrossRef] [PubMed]
- Zhang, K. Integrative Transcriptomics and Proteomics Analysis Reveals Immune Response Process in Bovine Viral Diarrhea Virus-1-Infected Peripheral Blood Mononuclear Cells. Vet. Sci. 2023, 10(10). [Google Scholar] [CrossRef] [PubMed]
- Peterhans, E. Cytopathic bovine viral diarrhea viruses (BVDV): emerging pestiviruses doomed to extinction. Vet. Res. 2010, 41(6), 44. [Google Scholar] [CrossRef]
- La Polla, R. Identification of differentially expressed gene pathways between cytopathogenic and non-cytopathogenic BVDV-1 strains by analysis of the transcriptome of infected primary bovine cells. Virology 2022, 567, 34–46. [Google Scholar] [CrossRef]
- Georges, H.M. Epigenomic and Proteomic Changes in Fetal Spleens Persistently Infected with Bovine Viral Diarrhea Virus: Repercussions for the Developing Immune System, Bone, Brain, and Heart. Viruses 2022, 14(3). [Google Scholar] [CrossRef]
- Holthausen, D.J. Bovine viral diarrhea virus 2 strains generate deletion viral genomes primarily in the NS2 region of the viral genome. Front Vet. Sci. 2025. 12, 1686098. [Google Scholar] [CrossRef]
- Zhong, J. Molecular Characteristics and Pathogenicity Analysis of Bovine Viral Diarrhea Virus Strain Isolated from Persistently Infected Cattle. Animals 2026, 16(1). [Google Scholar] [CrossRef]
- Li, Z. Non-cytopathic bovine viral diarrhea virus (BVDV) inhibits innate immune responses via induction of mitophagy. Vet. Res. 2024, 55(1), 27. [Google Scholar] [CrossRef]
- Cui, Y. The activation of liver X receptors in Madin-Darby bovine kidney cells and mice restricts infection by bovine viral diarrhea virus. Vet. Microbiol. 2024, 288, 109948. [Google Scholar] [CrossRef]
- Mirosław, P. Transcriptomic Analysis of MDBK Cells Infected with Cytopathic and Non-Cytopathic Strains of Bovine Viral Diarrhea Virus (BVDV). Viruses 2022, 14(6). [Google Scholar] [CrossRef] [PubMed]
- Zheng, Q. The NLRP3 inflammasome in viral infection (Review). Mol. Med. Rep. 2023, 28(3). [Google Scholar] [CrossRef]
- Vande Walle, L.; Lamkanfi, M. Drugging the NLRP3 inflammasome: from signalling mechanisms to therapeutic targets. Nat. Rev. Drug Discov. 2024, 23(1), 43–66. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Zhang, L. Mechanistic and therapeutic insights into the function of NLRP3 inflammasome in sterile arthritis. Front Immunol. 2023, 14, 1273174. [Google Scholar] [CrossRef] [PubMed]
- Vora, S.M.; Lieberman, J.; Wu, H. Inflammasome activation at the crux of severe COVID-19. Nat. Rev. Immunol. 2021, 21(11), 694–703. [Google Scholar] [CrossRef]
- Shi, W. Inflammasome activation by viral infection: mechanisms of activation and regulation. Front Microbiol. 2023, 14, 1247377. [Google Scholar] [CrossRef]
- Su, N. Prevalence of bovine viral diarrhea virus in cattle between 2010 and 2021: A global systematic review and meta-analysis. Front Vet. Sci. 2022, 9, 1086180. [Google Scholar] [CrossRef]
- Zirra-Shallangwa, B. The Epidemiology of Bovine Viral Diarrhea Virus in Low- and Middle-Income Countries: A Systematic Review and Meta-Analysis. Front Vet. Sci. 2022, 9, 947515. [Google Scholar] [CrossRef]
- Rana, E.A. A Critical Review of Bovine Viral Diarrhea Virus: Spotlights on Host Plasticity and Potential Spillover Events. Viruses 2025, 17(9). [Google Scholar] [CrossRef]
- Yin, J. Tunneling nanotubes provide a new route for bovine viral diarrhea virus spreading. Front Vet. Sci. 2025, 12, 1667394. [Google Scholar] [CrossRef] [PubMed]
- Cookson, B.T.; Brennan, M.A. Pro-inflammatory programmed cell death. Trends Microbiol. 2001, 9(3), 113–4. [Google Scholar] [CrossRef]
- Ma, X. LPS Mediates Bovine Endometrial Epithelial Cell Pyroptosis Directly Through Both NLRP3 Classical and Non-Classical Inflammasome Pathways. Front Immunol. 2021, 12, 676088. [Google Scholar] [CrossRef]
- Fan, H.; Sun, M.; Zhu, J.H. S-nitrosoglutathione inhibits pyroptosis of kidney tubular epithelial cells in sepsis via the SIRT3/SOD2/mtROS signaling pathway. Ren. Fail 2025, 47(1), 2472987. [Google Scholar] [CrossRef] [PubMed]
- Cheng, K.T. Caspase-11-mediated endothelial pyroptosis underlies endotoxemia-induced lung injury. J. Clin. Invest 2017, 127(11), 4124–4135. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y. Nano-selenium alleviates the pyroptosis of cardiovascular endothelial cells in chicken induced by decabromodiphenyl ether through ERS-TXNIP-NLRP3 pathway. Sci. Total Env. 2024. 915, 170129. [Google Scholar] [CrossRef]
- Ma, Y. Effects of Adipose-Derived Mesenchymal Stem Cell-Secretome on Pyroptosis of Laparoscopic Hepatic Ischemia Reperfusion Injury in a Porcine Model. Cells 2025, 14(10). [Google Scholar] [CrossRef]
- Li, C. Dynamic changes in pyroptosis following spinal cord injury and the identification of crucial molecular signatures through machine learning and single-cell sequencing. J. Pharm. BioMed Anal. 2024, 251, 116449. [Google Scholar] [CrossRef] [PubMed]
- Pandey, K.P.; Zhou, Y. Influenza A Virus Infection Activates NLRP3 Inflammasome through Trans-Golgi Network Dispersion. Viruses 2022, 14(1). [Google Scholar] [CrossRef]
- Li, Y.; Jiang, Q. Uncoupled pyroptosis and IL-1β secretion downstream of inflammasome signaling. Front Immunol. 2023, 14, 1128358. [Google Scholar] [CrossRef]
- Weir, A.; Vince, J.E. No longer married to inflammasome signaling: the diverse interacting pathways leading to pyroptotic cell death. Biochem J. 2022, 479(10), 1083–1102. [Google Scholar] [CrossRef]
- Zhang, N.; Xu, D. Controlling pyroptosis through post-translational modifications of gasdermin D. Dev. Cell 2025, 60(7), 994–1007. [Google Scholar] [CrossRef] [PubMed]
- Schiffelers, L.D.J. Antagonistic nanobodies implicate mechanism of GSDMD pore formation and potential therapeutic application. Nat. Commun. 2024, 15(1), 8266. [Google Scholar] [CrossRef] [PubMed]
- Charleston, B. Establishment of persistent infection with non-cytopathic bovine viral diarrhoea virus in cattle is associated with a failure to induce type I interferon. J. Gen. Virol. 2001, 82 Pt 8, 1893–1897. [Google Scholar] [CrossRef]
- Yamane, D. The double-stranded RNA-induced apoptosis pathway is involved in the cytopathogenicity of cytopathogenic Bovine viral diarrhea virus. J. Gen. Virol. 2006, 87 Pt 10, 2961–2970. [Google Scholar] [CrossRef] [PubMed]
- Harris, J.; Borg, N.A. The multifaceted roles of NLRP3-modulating proteins in virus infection. Front Immunol. 2022, 13, 987453. [Google Scholar] [CrossRef]
- Ichinohe, T.; Pang, I.K.; Iwasaki, A. Influenza virus activates inflammasomes via its intracellular M2 ion channel. Nat. Immunol. 2010, 11(5), 404–10. [Google Scholar] [CrossRef]
- Ding, X. Hepatitis B core antigen can regulate NLRP3 inflammasome pathway in HepG2 cells. J. Med. Virol. 2019, 91(8), 1528–1536. [Google Scholar] [CrossRef] [PubMed]
- Wang, W. Zika virus infection induces host inflammatory responses by facilitating NLRP3 inflammasome assembly and interleukin-1β secretion. Nat. Commun. 2018, 9(1), 106. [Google Scholar] [CrossRef]
- Zhang, X. Pseudorabies Virus UL4 protein promotes the ASC-dependent inflammasome activation and pyroptosis to exacerbate inflammation. PLoS Pathog. 2024, 20(9), e1012546. [Google Scholar] [CrossRef]
- Xue, D. Atomic mechanisms of full-length ASC-mediated inflammasome assembly. Nat. Commun. 2025, 16(1), 10564. [Google Scholar] [CrossRef]
- Hoss, F.; Rodriguez-Alcazar, J.F.; Latz, E. Assembly and regulation of ASC specks. Cell Mol. Life Sci. 2017, 74(7), 1211–1229. [Google Scholar] [CrossRef]





| gene | Primer sequence (5′→3′) |
|---|---|
| NLRP3 | GATATFFCAGAGAATACGGAGAAGATG |
| AAFCACAGCACTACACAGAGAAG | |
| Caspase-1 | ATGGTCCTTCAACTTGGTGAATGTG |
| CTGACCACTTCGATAAGAACTGTATC | |
| ASC | GCTCTACTGTATGCACGAGA |
| TCTGCTFAAGACACTCGCT | |
| GSDMD | AGTGGTGACACCCTTGCCTT |
| GGGTCCTTGAGTCGTGTGAA | |
| IL-1β | AGATGAAGAGCGTGAGGAGC |
| CGAGCATCACTATGTGGGCC | |
| IL-18 | ACCGAGACTTCAGAGAGAATTGGAGAC |
| CCTTACCTGGCTATGGCTGTCTTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).