Submitted:
21 May 2026
Posted:
22 May 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Materials and Methods
2.1. Animal Ethics Statement
2.2. Experimental Design and Diet Formulation
2.3 Bird management
2.4. Sample Collection
2.5. Intestinal Morphology
2.6. Quantitative Real-Time PCR (qRT-PCR)
2.7. 16S rRNA Gene Sequencing
2.8. Statistical Analysis
3. Results
3.1. Ileal Barrier and Inflammatory Factor Gene Expression
3.2. Ileal Morphology
3.3. Cecal Microbiota
4. Discussion
5. Conclusion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Wang, J.; Wu, Y.; Zhou, T.; Feng, Y.; Li, L.A. Common factors and nutrients affecting intestinal villus height - A review. Anim. Biosci. 2025, 38, 1557–1569. [Google Scholar] [CrossRef]
- Kiarie, E.; Romero, L.F.; Nyachoti, C.M. The role of added feed enzymes in promoting gut health in swine and poultry. Nutr. Res. Rev. 2013, 26, 71–88. [Google Scholar] [CrossRef]
- Jiang, H.; Chen, X.; Luo, J.; et al. Lysine promotes intestinal barrier function via mTORC1 signaling in mice. J. Nutr. 2021, 151, 2900–2909. [Google Scholar]
- Barekatain, R.; Chrystal, P.V.; Howarth, G.S.; McLaughlin, C.J.; Gilani, S.; Nattrass, G.S. Performance, intestinal permeability, and gene expression of selected tight junction proteins in broiler chickens fed reduced protein diets supplemented with arginine, glutamine, and glycine subjected to a leaky gut model. Poult. Sci. 2019, 98, 6761–6771. [Google Scholar] [CrossRef]
- Lee, C.Y.; Song, A.A.L.; Loh, T.C.; Rahim, R. Abdul. Effects of lysine and methionine in a low crude protein diet on the growth performance and gene expression of immunity genes in broilers. Poult. Sci. 2020, 99, 2916–2925. [Google Scholar] [CrossRef] [PubMed]
- Ban, Z.; Chen, S.; Li, L.; Zhang, Q.; Zhao, X.; Liang, H.; Guo, Y. Effects of dietary net energy/lysine ratio and sex on growth performance, digestive organ development, and cecal microbiota of broiler chickens. Animals 2025, 15, 1572. [Google Scholar] [CrossRef]
- Attia, Y.A.; Bovera, F.; Wang, J.; Al-Harthi, M.A.; Kim, W.K. Multiple Amino Acid Supplementations to Low-Protein Diets: Effect on Performance, Carcass Yield, Meat Quality and Nitrogen Excretion of Finishing Broilers under Hot Climate Conditions. Animals 2020, 10(6), 973. [Google Scholar] [CrossRef]
- Tian, D.L.; Guo, R.J.; Li, Y.M.; Chen, P.P.; Zi, B.B.; Wang, J.J.; Liu, R.F.; Min, Y.N.; Wang, Z.P.; Niu, Z.Y.; Liu, F.Z. Effects of lysine deficiency or excess on growth and the expression of lipid metabolism genes in slow-growing broilers. Poult. Sci. 2019, 98(7), 2927–2932. [Google Scholar] [CrossRef] [PubMed]
- Gao, J.; Yin, J.; Xu, X.; et al. Amylose/amylopectin ratio affects intestinal morphology and barrier function in weaned piglets. J. Anim. Sci. 2020, 98, skaa189. [Google Scholar]
- Gebeyew, K.; Yang, C.; Wang, Z.; et al. High amylose starch modulates gut microbiota and SCFA production in broilers. Front. Microbiol. 2022, 13, 892345. [Google Scholar]
- Adewole, D.; Akinyemi, F. Gut microbiota dynamics, growth performance, and gut morphology in broiler chickens fed diets varying in energy density with or without bacitracin methylene disalicylate (BMD). Microorganisms 2021, 9, 787. [Google Scholar] [CrossRef]
- Weurding, R.E.; Enting, H.; Verstegen, M.W. The relation between starch digestion rate and amino acid level for broiler chickens. Poult. Sci. 2003, 82(2), 279–84. [Google Scholar] [CrossRef] [PubMed]
- Latorre, J.D.; Adhikari, B.; Park, S.H.; Teague, K.D.; Graham, L.E.; Mahaffey, B.D.; Baxter, M.F.A.; Hernandez-Velasco, X.; Kwon, Y.M.; Ricke, S.C.; Bielke, L.R.; Hargis, B.M.; Tellez, G. Evaluation of the Epithelial Barrier Function and Ileal Microbiome in an Established Necrotic Enteritis Challenge Model in Broiler Chickens. Front Vet. Sci. 2018, 5, 199. [Google Scholar] [CrossRef]
- Mao, H.; Chen, J.; Zhang, J.; Zhang, X.; Xu, S.; Zhang, L. High-energy and high-amino acid diet enhances production performance and antioxidant capacity in yellow-feathered broilers under heat stress. Poult. Sci. 2024, 103(7), 103790. [Google Scholar] [CrossRef]
- Jiang, C.H.; Fang, X.; Huang, W.; Wang, Y.H.; Kang, L.; Wang, P.Y.; Xu, C.; Li, Z.S.; Zou, W.B.; Liao, Z. A reciprocal interaction between L-lysine and Holdemanella biformis modulates intestinal barrier function and anxiety in irritable bowel syndrome. IMetaOmics 2025, 2(3), e70042. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Wang, M.; Tang, X.; Yang, H.; Li, F.; Wang, Y.; Li, J.; Yin, Y. Effect of Dietary Amylose/Amylopectin Ratio on Intestinal Health and Cecal Microbes' Profiles of Weaned Pigs Undergoing Feed Transition or Challenged With Escherichia coli Lipopolysaccharide. Front Microbiol. 2021, 12, 693839. [Google Scholar] [CrossRef] [PubMed]
- Rodríguez, S.P.; Herrera, A.L.; Parra, J.E. Gene expression of pro-inflammatory (IL-8, IL-18, TNF-α, and IFN-γ) and anti-inflammatory (IL-10) cytokines in the duodenum of broiler chickens exposed to lipopolysaccharides from Escherichia coli and Bacillus subtilis. Vet. World 2023, 16(3), 564–570. [Google Scholar] [CrossRef]
- Mine, Y.; Zhang, H. Anti-inflammatory Effects of Poly-L-lysine in Intestinal Mucosal System Mediated by Calcium-Sensing Receptor Activation. J. Agric. Food Chem. 2015, 63(48), 10437–47. [Google Scholar] [CrossRef]
- Jankowski, J.; Ognik, K.; Konieczka, P.; Mikulski, D. Effects of different levels of arginine and methionine in a high-lysine diet on the immune status, performance, and carcass traits of turkeys. Poult. Sci. 2020, 99(10), 4730–4740. [Google Scholar] [CrossRef]
- Han, H.; Yin, J.; Wang, B.; Huang, X.; Yao, J.; Zheng, J.; Fan, W.; Li, T.; Yin, Y. Effects of dietary lysine restriction on inflammatory responses in piglets. Sci. Rep. 2018, 8(1), 2451. [Google Scholar] [CrossRef]
- Fan, M.Z.; Archbold, T.; Lackeyram, D.; Liu, Q.; Mine, Y.; Paliyath, G. Consumption of guar gum and retrograded high-amylose corn resistant starch increases IL-10 abundance without affecting pro-inflammatory cytokines in the colon of pigs fed a high-fat diet. J. Anim. Sci. 2012, 90 4 Suppl, 278–80. [Google Scholar] [CrossRef]
- Wang, Z.; Shao, D.; Kang, K.; Wu, S.; Zhong, G.; Song, Z.; Shi, S. Low protein with high amino acid diets improves the growth performance of yellow feather broilers by improving intestinal health under cyclic heat stress. J. Therm. Biol. 2022, 105, 103219. [Google Scholar] [CrossRef] [PubMed]
- Pirgozliev, V.R.; Rose, S.P.; Bedford, M.R. The effect of amylose: amylopectin ratio in dietary starch on growth performance and gut morphology in broiler chickens. Eur. Poult. Sci. 2010, 74, 21–29. [Google Scholar] [CrossRef]
- Oluseyifunmi, I.W.; Lourenco, J.; Olukosi, O.A. The interactivity of sources and dietary levels of resistant starches - impact on growth performance, starch, and nutrient digestibility, digesta oligosaccharides profile, cecal microbial metabolites, and indicators of gut health in broiler chickens. Poult. Sci. 2024, 103(12), 104337. [Google Scholar] [CrossRef]
- Deryabin, D.; Lazebnik, C.; Vlasenko, L.; Karimov, I.; Kosyan, D.; Zatevalov, A.; Duskaev, G. Broiler Chicken Cecal Microbiome and Poultry Farming Productivity: A Meta-Analysis. Microorganisms 2024, 12(4), 747. [Google Scholar] [CrossRef] [PubMed]
- Liao, X.; Shao, Y.; Sun, G.; et al. Cecal microbiota and SCFA are closely related to intestinal morphology in broilers. Front. Vet. Sci. 2021, 8, 678901. [Google Scholar]
- Kobel, C.M.; Leu, A.; Vera-Ponce de León, A.; Øyås, O.; Lai, W.; Altshuler, I.; Hagen, L.H.; Wollenberg, R.D.; Søndergaard, M.T.; Bakshani, C.R.; Willats, W.G.T.; Nicoll, L.; McIlroy, S.J.; Hvidsten, T.R.; Schmidt, O.; Greening, C.; Tyson, G.W.; Roehe, R.; Aho, V.T.E.; Pope, P.B. Protozoal populations drive system-wide variation in the rumen microbiome. Nat. Commun. 2025, 16(1), 6238. [Google Scholar] [CrossRef]
- Shen, J.; Fang, L.; Wu, Y.; Deng, N.; Peng, X.; Li, D.; Tan, Z. Intestinal Microbiota Dysbiosis Disrupts the Mucosal Barrier, Triggering Inflammatory Responses in Gut-Kidney Interaction and Exacerbating Diarrhea. J. Inflamm. Res. 2025, 18, 9379–9399. [Google Scholar] [CrossRef]





| SID Lys level1 | 1.00 | 1.20 | 1.40 | ||||||
| AM/AP ratio2 | 0.19 | 0.29 | 0.41 | 0.19 | 0.29 | 0.41 | 0.19 | 0.29 | 0.41 |
| Corn | 33.72 | 52.20 | 42.70 | 43.36 | 52.60 | 43.10 | 34.50 | 53.00 | 43.40 |
| Soybean meal | 18.75 | 19.56 | 10.90 | 17.03 | 17.44 | 8.80 | 14.55 | 15.34 | 6.69 |
| Soybean oil | 3.77 | 4.47 | 2.66 | 4.56 | 4.91 | 3.09 | 4.64 | 5.34 | 3.60 |
| Corn gluten meal | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 | 5.00 |
| Dicalcium phosphate | 1.16 | 1.21 | 1.09 | 1.21 | 1.23 | 1.11 | 1.21 | 1.25 | 1.13 |
| Limestone | 1.01 | 0.98 | 1.07 | 1.00 | 0.99 | 1.08 | 1.03 | 1.00 | 1.10 |
| Sodium chloride | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| Vitamins premix3 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 |
| Mineral premix4 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 | 0.20 |
| Choline chloride (50%) | 0.15 | 0.15 | 0.15 | 0.15 | 0.15 | 0.15 | 0.15 | 0.15 | 0.15 |
| Phytase 10,000, U/g | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 | 0.03 |
| Antioxidant | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 | 0.02 |
| L-Lysine hydrochloride (98%) | 0.42 | 0.40 | 0.35 | 0.73 | 0.72 | 0.67 | 1.06 | 1.04 | 0.99 |
| DL-Methionine (98%) | 0.24 | 0.24 | 0.28 | 0.36 | 0.36 | 0.40 | 0.47 | 0.48 | 0.51 |
| L-Threonine (98%) | 0.09 | 0.09 | 0.11 | 0.25 | 0.25 | 0.27 | 0.41 | 0.41 | 0.44 |
| L-Valine (98%) | - | 0.01 | 0.05 | 0.20 | 0.20 | 0.24 | 0.39 | 0.40 | 0.45 |
| L-Isoleucine (98%) | - | 0.01 | 0.05 | 0.19 | 0.19 | 0.23 | 0.35 | 0.36 | 0.40 |
| L-Arginine (98%) | 0.11 | 0.10 | 0.01 | 0.38 | 0.38 | 0.28 | 0.66 | 0.65 | 0.56 |
| Flour | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 | 15.00 |
| Pea | 0.00 | 0.00 | 20.00 | 0.00 | 0.00 | 20.00 | 0.00 | 0.00 | 20.00 |
| Waxy corn | 20.00 | 0.00 | 0.00 | 10.00 | 0.00 | 0.00 | 20.00 | 0.00 | 0.00 |
| Total | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 | 100 |
| Nutritional levels1 | |||||||||
| AME, Mcal/kg | 3.20 | 3.20 | 3.20 | 3.20 | 3.20 | 3.20 | 3.20 | 3.20 | 3.20 |
| CP, % | 18.50 | 18.50 | 18.50 | 18.50 | 18.50 | 18.50 | 18.50 | 18.50 | 18.50 |
| Calcium, % | 0.70 | 0.70 | 0.70 | 0.70 | 0.70 | 0.70 | 0.70 | 0.70 | 0.70 |
| NPP, % | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| SID Lys, % | 1.00 | 1.00 | 1.00 | 1.20 | 1.20 | 1.20 | 1.40 | 1.40 | 1.40 |
| SID Met, % | 0.52 | 0.52 | 0.52 | 0.63 | 0.63 | 0.63 | 0.73 | 0.73 | 0.73 |
| SID Met + Cys, % | 0.79 | 0.79 | 0.78 | 0.89 | 0.89 | 0.87 | 0.98 | 0.98 | 0.96 |
| SID Thr, % | 0.64 | 0.64 | 0.64 | 0.77 | 0.77 | 0.77 | 0.90 | 0.90 | 0.90 |
| SID Val, % | 0.75 | 0.75 | 0.75 | 0.90 | 0.90 | 0.90 | 1.06 | 1.06 | 1.06 |
| SID Ile, % | 0.67 | 0.67 | 0.67 | 0.81 | 0.81 | 0.81 | 0.94 | 0.94 | 0.94 |
| SID Arg, % | 1.04 | 1.04 | 1.04 | 1.25 | 1.25 | 1.25 | 1.46 | 1.46 | 1.46 |
| Total starch, %2 | 45.57 | 40.71 | 40.52 | 45.83 | 37.03 | 35.74 | 39.24 | 37.52 | 37.12 |
| Gene | Forward sequences (5′-3′) | Reverse sequences (5′-3′) |
| β-actin | CCACCGCAAATGCTTCTAAAC | AAGACTGCTGCTGACACCTTC |
| ZO-1 | CTTCAGGTGTTTCTCTTCCTCCTC | CTGTGGTTTCATGGCTGGATC |
| Occludin | ACGGCAGCACCTACCTCAA | GGGCGAAGAAGCAGATGAG |
| Claudin-1 | TACAGCCCTTGGCCAATACA | CCAAGAAACAACCACCAGCA |
| IL-18 | GTGTGTGCAGTACGGCTTAG | TCCACTGCCAGATTTCACCT |
| TNF-α | CCCCTACCCTGTCCCACAA | TGAGTACTGCGGAGGGTTCAT |
| IL-10 | CAGACCAGCACCAGTCATCAG | ATCCCGTTCTCATCCATCTTCTCG |
| Item | Occludin | ZO-1 | claudin-1 | IL-18 | TNF-α | IL-10 | |
| 1.00% SID Lys | AM/AP: 0.19 | 0.162c | 0.267e | 0.119d | 0.168 | 0.141b | 0.329 |
| AM/AP: 0.29 | 0.186c | 0.157e | 0.246cd | 0.168 | 0.179b | 0.268 | |
| AM/AP: 0.41 | 0.868b | 1.541cd | 2.139a | 1.247 | 0.952a | 2.662 | |
| 1.20% SID Lys | AM/AP: 0.19 | 1.184a | 1.898bc | 0.983bc | 1.197 | 0.960a | 1.229 |
| AM/AP: 0.29 | 1.026ab | 1.081d | 1.081b | 1.034 | 0.893a | 1.468 | |
| AM/AP: 0.41 | 0.757b | 1.586cd | 0.951bc | 1.520 | 1.060a | 2.661 | |
| 1.40% SID Lys | AM/AP: 0.19 | 0.921ab | 1.884bc | 1.415b | 1.618 | 0.844a | 2.963 |
| AM/AP: 0.29 | 0.956ab | 2.421b | 0.786bcd | 1.511 | 1.095a | 2.049 | |
| AM/AP: 0.41 | 1.189a | 3.505a | 1.966a | 2.147 | 1.103a | 4.791 | |
| SEM | 0.058 | 0.150 | 0.117 | 0.097 | 0.059 | 0.258 | |
| SID Lys | 1.00% | 0.405 | 0.655 | 0.835 | 0.527c | 0.844 | 1.086b |
| 1.20% | 0.989 | 1.522 | 1.005 | 1.251b | 1.095 | 1.786b | |
| 1.40% | 1.022 | 2.603 | 1.389 | 1.759a | 1.103 | 3.268a | |
| AM/AP | 0.19 | 0.756 | 1.350 | 0.839 | 0.994c | 0.424 | 1.507b |
| 0.29 | 0.723 | 1.220 | 0.704 | 0.904c | 0.971 | 1.262b | |
| 0.41 | 0.938 | 2.211 | 1.686 | 1.638b | 1.014 | 3.371a | |
| P Value | |||||||
| SID Lys | <0.001 | <0.001 | 0.14 | <0.001 | <0.001 | 0.001 | |
| AM/AP | 0.273 | 0.011 | <0.001 | 0.002 | 0.014 | 0.001 | |
| AM/AP×SID Lys | <0.001 | 0.001 | <0.001 | 0.147 | 0.004 | 0.675 | |
| Item | Villus height, um | Crypt depth, um | VH/CD | |
| 1.00% SID Lys | AM/AP: 0.19 | 658.61 | 138.5 | 4.84ᵇc |
| AM/AP: 0.29 | 601.88 | 129.2 | 4.73ᵇc | |
| AM/AP: 0.41 | 618.78 | 130.39 | 4.84ᵇc | |
| 1.20% SID Lys | AM/AP: 0.19 | 785.52 | 131.76 | 6.04a |
| AM/AP: 0.29 | 678.5 | 135.82 | 5.10ᵇ | |
| AM/AP: 0.41 | 619.16 | 139.34 | 4.69ᵇc | |
| 1.40% SID Lys | AM/AP: 0.19 | 594.21 | 134.18 | 4.46cd |
| AM/AP: 0.29 | 578.14 | 141.78 | 4.13ᵈe | |
| AM/AP: 0.41 | 550.46 | 144.2 | 3.91ᵉ | |
| SID Lys | 1.00% | 626.42ᵇ | 132.7 | 4.81ᵇ |
| 1.20% | 694.40ᵃ | 165.64 | 5.28ᵃ | |
| 1.40% | 574.27b | 140.05 | 4.17ᶜ | |
| AM/AP | 0.19 | 679.45ᵃ | 134.81 | 5.11ᵃ |
| 0.29 | 619.51aᵇ | 135.6 | 4.65ᵇ | |
| 0.41 | 596.13ᵇ | 137.98 | 4.48ᵇ | |
| P value | ||||
| SID Lys | 0.003 | 0.502 | <0.001 | |
| AM/AP | 0.043 | 0.871 | <0.001 | |
| AM/AP×SID Lys | 0.48 | 0.732 | 0.004 | |
| Group1 | Group2 | R | P-value |
| MWC | MP | 0.207407 | 0.021 |
| MWC | HWC | 0.196296 | 0.034 |
| MWC | HP | 0.211111 | 0.021 |
| MP | HWC | 0.090741 | 0.088 |
| MP | HP | 0.090741 | 0.065 |
| HWC | HP | 0.133333 | 0.036 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.