Submitted:
20 May 2026
Posted:
22 May 2026
You are already at the latest version
Abstract
Keywords:
1. Introduction
2. Results
2.1. Genotype Distributions and Allele Frequencies
2.2. Genotype Distribution by Playing Position
2.3. Exploratory Performance Analysis in the FC Hebar Sub-Cohort
3. Discussion
4. Materials and Methods
4.1. Study Population and Sample Collection
3.2. Genetic Analysis
3.3. Physical Performance Assesments
3.4. Yo-Yo Intermittent Recovery Test Level 2
3.5. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| CPNE5 | Copine 5 |
| SNP | Single Nucleotide Polymorphism |
| DNA | Deoxyribonucleic Acid |
| PCR | Polymerase Chain Reaction |
| PBS | Phosphate Buffered Saline |
| HWE | Hardy–Weinberg Equilibrium |
| SJ | Squat Jump |
| CMJ | Countermovement Jump |
| DJ | Drop Jump |
| IRT2 | Intermittent Recovery Test Level 2 |
| GK | Goalkeeper |
| DEF | Defense |
| MID | Midfield |
| ATT | Forward (Attacker) |
| ANOVA | Analysis of Variance |
| SD | Standard Deviation |
| β | Beta coefficient |
| VO2max | Maximal oxygen uptake |
| cm | Centimeter |
| m | Meter |
| s | Second |
| kg | Kilogram |
References
- Varillas-Delgado, D.; Del Coso, J.; Gutiérrez-Hellín, J.; Aguilar-Navarro, M.; Muñoz, A.; Maestro, A.; Morencos, E. Genetics and sports performance: The present and future in the identification of talent for sports based on DNA testing. Eur. J. Appl. Physiol. 2022, 122, 1811–1830. [Google Scholar] [CrossRef] [PubMed]
- Ferreira, L.B.; Ferreira, M.E.C.; de Souza, R.A.; Massetti, T. Influence of genetic polymorphism on sports talent: A systematic review. BMC Sports Sci. Med. Rehabil. 2024, 16, 24. [Google Scholar] [CrossRef] [PubMed]
- Bulgay, C.; Bayraktar, I.; Kazan, H.H.; Yıldırım, D.S.; Zorba, E.; Akman, O.; Ergun, M.A.; Cerit, M.; Ulucan, K.; Eken, Ö.; Ceylan, H.İ.; Badicu, G.; Grosz, W.R.; Mijaică, R. Evaluation of the association of VDR rs2228570 polymorphism with elite track and field athletes’ competitive performance. Healthcare 2023, 11, 681. [Google Scholar] [CrossRef]
- İpekoğlu, G.; Çetin, T.; Sırtbaş, T.; et al. Candidate gene polymorphisms and power athlete status: A meta-analytical approach. J. Physiol. Biochem. 2025, 81, 229–247. [Google Scholar] [CrossRef] [PubMed]
- Reichert, L.; Hacker, S.; Mutz, M.; Raab, M.; Wiese, L.; Krüger, K.; Zentgraf, K. How much can the genotype predict phenotypical power performance in elite male and female athletes? J. Hum. Kinet. 2024, 95, 95. [Google Scholar] [CrossRef]
- Ulucan, K.; Bayyurt, G.M.; Konuk, M.; Güney, A.I. Effect of alpha-actinin-3 gene on trained and untrained Turkish middle-school children’s sprinting performance: A pilot study. Biol. Rhythm Res. 2014, 45, 509–514. [Google Scholar] [CrossRef]
- Eken, B.F.; Yılmaz, Ö.Ö.; Polat, T.; Aslan, B.T.; Ulucan, K. Türk futbolcularda alfa-aktinin-3 (ACTN3) ve anjiyotensin dönüştürücü enzim (ACE) polimorfizmleri atletik performans için bir biyobelirteç olabilir mi? Eurasian Res. Sport Sci. 2021, 6, 147–159. [Google Scholar] [CrossRef]
- Łosińska, K.W.; Cięszczyk, P.; Ghiani, G.; Maszczyk, A. Effect size and replicability in genetic studies of athletic performance: A meta-analytical review. Genes 2025, 16, 1040. [Google Scholar] [CrossRef]
- GeneCards. CPNE5 Gene—Copine5. Available online: https://www.genecards.org/cgi-bin/carddisp.pl?gene=CPNE5 (accessed on 2026).
- UniProt. CPNE5—Copine-5. Available online: https://www.uniprot.org (accessed on 2026).
- The Human Protein Atlas. CPNE5 protein expression. Available online: https://www.proteinatlas.org/ENSG00000124772-CPNE5 (accessed on 2026).
- Creutz, C.E. The copines, a novel class of C2 domain-containing, calcium-dependent, phospholipid-binding proteins conserved from Paramecium to humans. J. Biol. Chem. 1998, 273, 1393–1402. [Google Scholar] [CrossRef]
- Uhlén, M.; Fagerberg, L.; Hallström, B.M.; Lindskog, C.; Oksvold, P.; Mardinoglu, A.; Pontén, F. Tissue-based map of the human proteome. Science 2015, 347, 1260419. [Google Scholar] [CrossRef]
- Human Protein Atlas. CPNE5 tissue expression. Available online: https://www.proteinatlas.org (accessed on 2024).
- Pickering, C.; Suraci, B.; Semenova, E.A.; Boulygina, E.A.; Kostryukova, E.S.; Kulemin, N.A.; Ahmetov, I.I.; et al. A genome-wide association study of sprint performance in elite youth football players. J. Strength Cond. Res. 2019, 33, 2344–2351. [Google Scholar] [CrossRef]
- Ward, L.D.; Kellis, M. Interpreting noncoding genetic variation in complex traits and human disease. Nat. Biotechnol. 2012, 30, 1095–1106. [Google Scholar] [CrossRef] [PubMed]
- Guilherme, J.P.L.F.; Semenova, E.A.; Zempo, H.; Martins, G.L.; Lancha Junior, A.H.; Miyamoto-Mikami, E.; et al. Are genome-wide association study identified SNPs associated with sprint athletic status? Int. J. Sports Physiol. Perform. 2021, 16, 489–495. [Google Scholar] [CrossRef]
- Semenova, E.A.; Hall, E.C.R.; Ahmetov, I.I. Genes and athletic performance: The 2023 update. Genes 2023, 14, 1235. [Google Scholar] [CrossRef]
- Haugen, T.A.; Tønnessen, E.; Hisdal, J.; Seiler, S. The role and development of sprinting speed in soccer. Int. J. Sports Physiol. Perform. 2014, 9, 432–441. [Google Scholar] [CrossRef]
- Eynon, N.; Banting, L.K.; Ruiz, J.R.; Cieszczyk, P.; Dyatlov, D.A.; Maciejewska-Karlowska, A.; Lucia, A.; et al. ACTN3 R577X polymorphism and team-sport performance. J. Sci. Med. Sport 2014, 17, 102–106. [Google Scholar] [CrossRef]
- Santiago, C.; González-Freire, M.; Serratosa, L.; Morate, F.J.; Meyer, T.; Gómez-Gallego, F.; Lucia, A. ACTN3 genotype in professional soccer players. Br. J. Sports Med. 2008, 42, 71–73. [Google Scholar] [CrossRef] [PubMed]
- Eynon, N.; Ruiz, J.R.; Yvert, T.; Santiago, C.; Gómez-Gallego, F.; Lucia, A.; Birk, R. The C allele in NOS3 polymorphism and elite soccer status. Int. J. Sports Med. 2012, 33, 521–524. [Google Scholar] [CrossRef]
- Massidda, M.; Scorcu, M.; Calò, C.M. New genetic model for predicting phenotype traits in sports. Int. J. Sports Physiol. Perform. 2014, 9, 554–560. [Google Scholar] [CrossRef] [PubMed]
- Pimenta, E.M.; Coelho, D.B.; Veneroso, C.E.; Coelho, E.J.B.; Cruz, I.R.; Morandi, R.F.; Fernández, J.A.D.P.; et al. Effect of ACTN3 gene on strength and endurance in soccer players. J. Strength Cond. Res. 2013, 27, 3286–3292. [Google Scholar] [CrossRef]
- Bulgay, C.; Cepicka, L.; Dalip, M.; Yıldırım, S.; Ceylan, H.İ.; Yılmaz, Ö.Ö.; Cerit, M.; et al. Relationships between ACTN3 and PPARA polymorphisms and performance. BMC Sports Sci. Med. Rehabil. 2023, 15, 121. [Google Scholar] [CrossRef] [PubMed]
- Muhan, A.; Polat, T.; Yılmaz, Ö.Ö.; Aslan, B.T.; Ulucan, K. ACTN3 rs1815739 polymorphism and playing position in football. Res. Sport Educ. Sci. 2023, 25, 14–18. [Google Scholar] [CrossRef]
- Nikolaidis, P.T.; Ruano, M.A.G.; De Oliveira, N.C.; Portes, L.A.; Freiwald, J.; Lepretre, P.M.; Knechtle, B. Who runs the fastest? Res. Sports Med. 2016, 24, 341–351. [Google Scholar] [CrossRef] [PubMed]
| Genotype | n | % |
|---|---|---|
| CC | 68 | 71.6 |
| CT | 27 | 28.4 |
| Allele | n | Frequency |
| C | 163 | 0.858 |
| T | 27 | 0.142 |
| Position | CC (n) | CT (n) | Total |
|---|---|---|---|
| Goalkeeper | 11 | 2 | 13 |
| Defense | 21 | 7 | 28 |
| Midfield | 19 | 11 | 30 |
| Forward | 17 | 7 | 24 |
| Predictor | β (estimate) | p value |
|---|---|---|
| Genotype (CT vs CC) | 0.025 | 0.814 |
| Height (cm) | 0.041 | 0.035 |
| Weight (kg) | −0.025 | 0.080 |
| Position: GK (ref = ATT) | 0.310 | 0.184 |
| Position: DEF (ref = ATT) | 0.060 | 0.773 |
| Position: MID (ref = ATT) | 0.047 | 0.815 |
| Outcome | CC (n=16) | CT (n=7) |
|---|---|---|
| SJ (cm) | 35.1±4.4 | 37.1±2.6 |
| CMJ (cm) | 36.8±4.5 | 36.7±2.6 |
| DJ (cm) | 35.6±4.4 | 36.2±3.6 |
| 5m Sprint (s) | 0.92±0.17 | 0.92±0.18 |
| 30m Sprint (s) | 3.94±0.25 | 3.90±0.36 |
| Yo-Yo IRT2 (m) | 1028±158 | 1011±202 |
| Body Fat (%) | 7.99±1.78 | 9.08±2.58 |
| DNA sequence (5'→3') | |
|---|---|
| VIC/FAM | GGCCAGAGAGTATGAGGGTCATGGT[C/T]CCAGCCAGGGCCAGA TGCCACAGCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.