Submitted:
05 May 2026
Posted:
06 May 2026
You are already at the latest version
Abstract
Bacteriophages (phages) represent promising therapeutic agents. Their use in treatments is challenged by the rapid rise of resistant bacterial clones. To overcome this problem, phages can be trained in vitro to adapt them to the possible resistance that may arise. Here, we co-evolved phages with their hosts under different conditions and assessed the outcomes using qPCR. The co-evolution experiment yielded a panel of bacterial clones that were either adapted to a phage, a competing phage, or to a cocktail of both. The adaptation of a phage was done either in the continuous presence of an evolutionarily naïve host, or in a cocktail with a competing phage, or both conditions, or neither conditions. We assessed each obtained phage ability to infect evolved bacterial clones in the panel we created, and we used qPCR to enable high-throughput assessment. This allowed us to evaluate 500 phage-bacteria interactions. While all phages benefitted from the presence of evolutionary naïve hosts, the screening suggests that optimal training conditions are phage-specific, based on the four phages tested. For Enterobacter cloacae phages EC151 and EC152, the most extensive infectivity in our experiments was observed when a competing phage and/or an evolutionarily naïve host was included during adaptation. For Stenotrophomonas maltophilia phages StM171 and StenM174, the presence of an evolutionarily naïve hosts appeared beneficial in both replicates; co-adaptation with a competing phage led to a complete loss of StM171 infectivity in both experiments, but benefited StenM174. Phages passaged for 10 passages consistently infected a broader range of bacterial clones than those sampled after 5 passages. Sequencing of 8 phages obtained after adapting EC152 identified recurring mutations in a transcriptional regulator, and in some cases, in the baseplate and tail fiber genes.
Keywords:
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains and Phages Used and Growth Conditions
2.2. Adapting qPCR for Characterization of Phage Biological Characteristics and Phage Infection Yields
2.3. Co-Evolution Experiment and Studied Scenarios
2.4. Assessing the Infectivity of Passaged Phages
2.5. DNA Isolation and Sequencing of Adapted Phages
2.6. Bioinformatic Analysis of Phages’ Genomes
3. Results
3.Optimization of Sample Preparation with Phage DNA as a Template for qPCR
3.2. Results of Adaptation of Stenotrophomonas Phages StM171 and StenM174
3.3. Results of Adaptation of Enterobacter Phages EC151 and EC152
3.4. Results of Sequencing of the EC152 Adapted Populations
4. Discussion
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ling, H.; Lou, X.; Luo, Q.; He, Z.; Sun, M.; Sun, J. Recent Advances in Bacteriophage-Based Therapeutics: Insight into the Post-Antibiotic Era. Acta Pharm. Sin. B 2022, 12, 4348–4364. [CrossRef]
- Sahoo, K.; Meshram, S. The Evolution of Phage Therapy: A Comprehensive Review of Current Applications and Future Innovations. Cureus 2024. [CrossRef]
- Zalewska-Piątek, B. Phage Therapy—Challenges, Opportunities and Future Prospects. Pharmaceuticals 2023, 16, 1638. [CrossRef]
- Borin, J.M.; Lee, J.J.; Gerbino, K.R.; Meyer, J.R. Comparison of Bacterial Suppression by Phage Cocktails, Dual-receptor Generalists, and Coevolutionarily Trained Phages. Evol. Appl. 2023, 16, 152–162. [CrossRef]
- Feng, L.; Chen, H.; Qian, C.; Zhao, Y.; Wang, W.; Liu, Y.; Xu, M.; Cao, J.; Zhou, T.; Wu, Q. Resistance, Mechanism, and Fitness Cost of Specific Bacteriophages for Pseudomonas Aeruginosa. mSphere 2024, 9, e00553-23. [CrossRef]
- Abedon, S.T.; Danis-Wlodarczyk, K.M.; Wozniak, D.J. Phage Cocktail Development for Bacteriophage Therapy: Toward Improving Spectrum of Activity Breadth and Depth. Pharmaceuticals 2021, 14, 1019. [CrossRef]
- Borin, J.M.; Avrani, S.; Barrick, J.E.; Petrie, K.L.; Meyer, J.R. Coevolutionary Phage Training Leads to Greater Bacterial Suppression and Delays the Evolution of Phage Resistance. Proc. Natl. Acad. Sci. 2021, 118, e2104592118. [CrossRef]
- Bono, L.M.; Gensel, C.L.; Pfennig, D.W.; Burch, C.L. Competition and the Origins of Novelty: Experimental Evolution of Niche-Width Expansion in a Virus. Biol. Lett. 2013, 9, 20120616. [CrossRef]
- Gómez, P.; Buckling, A. Bacteria-Phage Antagonistic Coevolution in Soil. Science 2011, 332, 106–109. [CrossRef]
- Paterson, S.; Vogwill, T.; Buckling, A.; Benmayor, R.; Spiers, A.J.; Thomson, N.R.; Quail, M.; Smith, F.; Walker, D.; Libberton, B.; et al. Antagonistic Coevolution Accelerates Molecular Evolution. Nature 2010, 464, 275–278. [CrossRef]
- Sant, D.G.; Woods, L.C.; Barr, J.J.; McDonald, M.J. Host Diversity Slows Bacteriophage Adaptation by Selecting Generalists over Specialists. Nat. Ecol. Evol. 2021, 5, 350–359. [CrossRef]
- Zhang, Q.; Chu, X.; Buckling, A. Overcoming the Growth–Infectivity Trade-off in a Bacteriophage Slows Bacterial Resistance Evolution. Evol. Appl. 2021, 14, 2055–2063. [CrossRef]
- Betts, A.; Gray, C.; Zelek, M.; MacLean, R.C.; King, K.C. High Parasite Diversity Accelerates Host Adaptation and Diversification. Science 2018, 360, 907–911. [CrossRef]
- Paez-Espino, D.; Sharon, I.; Morovic, W.; Stahl, B.; Thomas, B.C.; Barrangou, R.; Banfield, J.F. CRISPR Immunity Drives Rapid Phage Genome Evolution in Streptococcus Thermophilus. mBio 2015, 6, e00262-15. [CrossRef]
- Rabiey, M.; Grace, E.R.; Pawlos, P.; Bihi, M.; Ahmed, H.; Hampson, G.E.; Al Riyami, A.; Alharbi, L.; Sanchez-Lucas, R.; Korotania, N.; et al. Coevolutionary Analysis of Pseudomonas Syringae –Phage Interactions to Help with Rational Design of Phage Treatments. Microb. Biotechnol. 2024, 17, e14489. [CrossRef]
- Jdeed, G.; Kravchuk, B.; Tikunova, N.V. Factors Affecting Phage–Bacteria Coevolution Dynamics. Viruses 2025, 17, 235. [CrossRef]
- Luo, J.; Liu, M.; Wang, P.; Li, Q.; Luo, C.; Wei, H.; Hu, Y.; Yu, J. Evaluation of a Direct Phage DNA Detection-Based Taqman qPCR Methodology for Quantification of Phage and Its Application in Rapid Ultrasensitive Identification of Acinetobacter Baumannii. BMC Infect. Dis. 2022, 22, 523. [CrossRef]
- Duyvejonck, H.; Merabishvili, M.; Pirnay, J.-P.; De Vos, D.; Verbeken, G.; Van Belleghem, J.; Gryp, T.; De Leenheer, J.; Van Der Borght, K.; Van Simaey, L.; et al. Development of a qPCR Platform for Quantification of the Five Bacteriophages within Bacteriophage Cocktail 2 (BFC2). Sci. Rep. 2019, 9, 13893. [CrossRef]
- Refardt, D. Real-Time Quantitative PCR to Discriminate and Quantify Lambdoid Bacteriophages of Escherichia Coli K-12. Bacteriophage 2012, 2, 98–104. [CrossRef]
- Morozova, V.; Jdeed, G.; Kozlova, Y.; Babkin, I.; Tikunov, A.; Tikunova, N. A New Enterobacter Cloacae Bacteriophage EC151 Encodes the Deazaguanine DNA Modification Pathway and Represents a New Genus within the Siphoviridae Family. Viruses 2021, 13, 1372. [CrossRef]
- Jdeed, G.; Morozova, V.; Kozlova, Y.; Tikunov, A.; Ushakova, T.; Bardasheva, A.; Manakhov, A.; Mitina, M.; Zhirakovskaya, E.; Tikunova, N. StM171, a Stenotrophomonas Maltophilia Bacteriophage That Affects Sensitivity to Antibiotics in Host Bacteria and Their Biofilm Formation. Viruses 2023, 15, 2455. [CrossRef]
- Morozova, V.V.; Yakubovskij, V.I.; Baykov, I.K.; Kozlova, Y.N.; Tikunov, A.Yu.; Babkin, I.V.; Bardasheva, A.V.; Zhirakovskaya, E.V.; Tikunova, N.V. StenM_174: A Novel Podophage That Infects a Wide Range of Stenotrophomonas Spp. and Suggests a New Subfamily in the Family Autographiviridae. Viruses 2023, 16, 18. [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [CrossRef]
- Prjibelski, A.; Antipov, D.; Meleshko, D.; Lapidus, A.; Korobeynikov, A. Using SPAdes De Novo Assembler. Curr. Protoc. Bioinforma. 2020, 70, e102. [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic Local Alignment Search Tool. J. Mol. Biol. 1990, 215, 403–410. [CrossRef]
- Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.-Y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-Depth Characterization and Visualization of Bacterial Genomes. Nucleic Acids Res. 2023, 51, W484–W492. [CrossRef]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across Computing Platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [CrossRef]
- Okonechnikov, K.; Golosova, O.; Fursov, M.; the UGENE team Unipro UGENE: A Unified Bioinformatics Toolkit. Bioinformatics 2012, 28, 1166–1167. [CrossRef]
- Camacho, C.; Coulouris, G.; Avagyan, V.; Ma, N.; Papadopoulos, J.; Bealer, K.; Madden, T.L. BLAST+: Architecture and Applications. BMC Bioinformatics 2009, 10, 421. [CrossRef]
- Soding, J.; Biegert, A.; Lupas, A.N. The HHpred Interactive Server for Protein Homology Detection and Structure Prediction. Nucleic Acids Res. 2005, 33, W244–W248. [CrossRef]
- McGuffin, L.J.; Bryson, K.; Jones, D.T. The PSIPRED Protein Structure Prediction Server. Bioinformatics 2000, 16, 404–405. [CrossRef]
- Betts, A.; Gray, C.; Zelek, M.; MacLean, R.C.; King, K.C. High Parasite Diversity Accelerates Host Adaptation and Diversification. Science 2018, 360, 907–911. [CrossRef]
- Sant, D.G.; Woods, L.C.; Barr, J.J.; McDonald, M.J. Host Diversity Slows Bacteriophage Adaptation by Selecting Generalists over Specialists. Nat. Ecol. Evol. 2021, 5, 350–359. [CrossRef]
- Zhang, Q.; Chu, X.; Buckling, A. Overcoming the Growth–Infectivity Trade-off in a Bacteriophage Slows Bacterial Resistance Evolution. Evol. Appl. 2021, 14, 2055–2063. [CrossRef]
- Mu, Y.; Song, Y.; Tian, X.; Ding, Z.; Yao, S.; Li, Y.; Wang, C.; Wei, D.; Vollmer, W.; Zhang, G.; et al. Leveraging Collateral Sensitivity to Counteract the Evolution of Bacteriophage Resistance in Bacteria. mLife 2025, 4, 143–154. [CrossRef]
- Oppenheim, A.B.; Kobiler, O.; Stavans, J.; Court, D.L.; Adhya, S. Switches in Bacteriophage Lambda Development. Annu. Rev. Genet. 2005, 39, 409–429. [CrossRef]
- Lucia-Sanz, A.; Peng, S.; Leung, C.Y. (Joey); Gupta, A.; Meyer, J.R.; Weitz, J.S. Inferring Strain-Level Mutational Drivers of Phage-Bacteria Interaction Phenotypes Arising during Coevolutionary Dynamics. Virus Evol. 2024, 10, veae104. [CrossRef]




| Phage | GenBank accession number | Genome size (b.p) | Bacterial host | Lytic ability | Notable accessory genes |
| EC151 | MW464860 | 60753 | E. cloacae CEMTC 2064 | Decreases host cell titer by 0.5 order in 30 minutes | 7-deazaguanine modification pathway against bacterial restriction modification systems |
| EC152 | PP681140 | 148277 | E. cloacae CEMTC 2064 | Weakly lytic/temperate | NAD+ salvage system, RII locus defense system |
| StM171 | MZ611865 | 44514 | S. maltophilia CEMTC 2355 | Decreases host cell titer by 0.5 order in 90 minutes | No DNA or RNA polymerase, DNA methyltransferase |
| StenM174 | OR729839.1 | 42956 | S. maltophilia CEMTC 2355 | Lytic, decreased host cell titer by 3 orders in 30 minutes | None |
| Temperature(С) | Time | Number of cycles | Signal reading |
| 95 | 3 minutes | 1 | No |
| 95 | 10 seconds | 39 cycles | Yes |
| 55 | 20 seconds |
| Phage | Oligo ID |
Oligo sequence 5’-3’ |
Target gene number(СDS) | Product size(b.p.) |
| EC151 | 151_F | aggagcaggtagaaca | Hypothetical protein in the 7-deazaguanine modification pathway (QSL98919.1) |
82 |
| 151_R | gtcgtcgattgaaacttatcct | |||
| 151_P | [FAM] ctggacaggcgccagcaatggat [BHQ1] | |||
| EC152 | 152_F | cccagtgatcttatcgcaac | Hypothetical protein (WZX10802.1) |
99 |
| 152_R | atgatgcctatcgaactggt | |||
| 152_P | [FAM] accactccagtgccagtacaacg [BHQ1] | |||
| StM171 | stm_stru_for | gcaggatccagtactacct | Structural protein (QYW06389.1) |
118 |
| stm_stru_rev | aatgcaacgtcgatattcgt | |||
| stm_stru_probe | [FAM] ccgctgtgggtgccttccta [BHQ1] | |||
| StenM_174 | 174_F | tcaggcttctacttcgttca | Murein transglucosylase-containing protein (WPK42350.1) | 102 |
| 174_R | cacttgtcattccacgtcag | |||
| 174_P | [FAM] accgctgcgcagatcaagca [BHQ1] |
| Scenario | Daily addition of evolutionarily naïve bacteria | Presence of a competing phage from the start of the experiment |
| A | No | No |
| B | Yes | No |
| C | No | Yes |
| D | Yes | Yes |
| Phage | Maximum standard deviation | Standard deviation of Cq between runs | Slope | Reaction efficiency range(%) |
| StenM174 | 0.24 | ±0.10 cycle | -3.15 | 106.7 - 108 |
| StM171 | 0.3 | ±0.62 cycle | -2.92 | 104.6 - 134 |
| EC151 | 0.1 | ±0.12 cycle | -3.25 | 103 - 106 |
| EC152 | 0.19 | ±0.15 cycle | -3.31 | 98.6 - 103 |
| Phage EC152 |
Co-occurring intergenic mutations 4 C->T; 23 G->T; 11597 C->T; 11603 C->G |
P14T mutation in the transcriptional regulatorWZX10670.1 | T26A in the baseplate protein WZX10726.1 | G342R in the tail fiber protein WZX10735.1 |
| Scenario A Exp #1 | + | + | - | - |
| Scenario A Exp #2 | + | + | - | - |
| Scenario B Exp #1 | - | - | - | - |
| Scenario B Exp #2 | + | + | - | - |
| Scenario C Exp #1 | + | + | - | - |
| Scenario C Exp #2 | - | + | + | + |
| Scenario D Exp #1 | + | + | - | - |
| Scenario D Exp #2 | + | + | + | + |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).